A liver fibrosis marker circRNA and application thereof

By using circSMAD2 as a molecular marker and AAV adeno-associated virus expression plasmid, the unclear role of circular RNA in liver fibrosis has been resolved, enabling effective diagnosis and treatment of liver fibrosis.

CN119776520BActive Publication Date: 2025-11-18ANHUI MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510212440.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-25
Publication Date
2025-11-18
Estimated Expiration
2045-02-25

AI Technical Summary

Technical Problem

The role, expression profile, and biological function of circular RNA in liver fibrosis have not been fully elucidated, and there is a lack of effective biomarkers and therapeutic targets for liver fibrosis.

Method used

circSMAD2 was used as a molecular marker for the diagnosis and treatment of liver fibrosis. The expression and activity of circSMAD2 were inhibited by AAV expression plasmids and siRNA, and viral packaging plasmids were constructed and applied to gene therapy.

Benefits of technology

circSMAD2, as a molecular marker of liver fibrosis, provides a new diagnostic indicator. Inhibiting its expression can significantly improve liver fibrosis, providing a new therapeutic target and direction for drug development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119776520B_ABST
    Figure CN119776520B_ABST
Patent Text Reader

Abstract

The application provides a liver fibrosis marker circRNA and application thereof, and belongs to the field of biological medicine.The circRNA is circSMAD2, and the nucleotide sequence is shown as SEQ ID NO.1.The application finds through experiments that circSMAD2 is significantly highly expressed in human liver cancer, liver cirrhosis serum and liver fibrosis mouse primary hepatic stellate cells, and therefore, circSMAD2 can be used as a basis for clinical diagnosis of liver fibrosis.The application further constructs an adeno-associated virus AAV knockdown vector by using circSMAD2, and finds through in-vivo verification that circSMAD2 can significantly improve mouse liver fibrosis.Therefore, circSMAD2 can be used as a novel target and potential drug for clinical treatment of liver fibrosis, and provides a new direction for research and development of a therapeutic drug for liver fibrosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, and in particular relates to a liver fibrosis marker circRNA and its applications. Background Technology

[0002] Liver fibrosis is a common wound-healing response to chronic liver injury, characterized by the excessive accumulation of extracellular matrix (ECM) in activated hepatic stellate cells (HSCs). HSC activation into proliferating myofibroblasts has been identified as a core driver of fibrosis in experimental and human liver injury. Therefore, understanding the regulatory mechanisms of HSC activation is a prerequisite for advancing therapeutic strategies for liver fibrosis.

[0003] Aerobic glycolysis is a metabolic phenotype of activated hepatic stellate cells, and lactate is an essential byproduct of the glycolytic pathway. Once hepatic stellate cells enter an activated state, lactate levels rise rapidly. Blocking intracellular lactate accumulation can inhibit cell proliferation, suppress the expression of myofibroblast-related genes, and promote the transition of activated hepatic stellate cells to a static phenotype. Increasing evidence suggests that inhibiting lactate accumulation is an effective strategy for reversing hepatic stellate cell phenotype transformation and alleviating liver fibrosis. However, the specific role and precise mechanisms of lactate produced by metabolic remodeling in regulating hepatic stellate cell phenotype and function remain unclear.

[0004] Circular RNAs (circRNAs) belong to the long ncRNA family and are not easily degraded by nucleases. They can persist stably in cells for extended periods and have potential applications as targets and prognostic biomarkers for clinical diagnosis, disease prevention, and treatment. Dysregulation of circRNAs has been reported in the pathophysiology of various diseases, including cancer, liver fibrosis, diabetes, and others. Although increased lactate production has been observed during hepatic stellate cell activation, the underlying mechanisms linking lactate to the expression profiles and biological functions of circRNAs remain not fully elucidated. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to explore the role of circular RNA in the occurrence and development of liver fibrosis. The potential mechanism related to the expression profile and biological function of circular RNA in hepatic stellate cells lactate production has not been fully elucidated. This invention aims to provide the application of circular RNA as a marker and therapeutic target for liver fibrosis.

[0006] The present invention solves the above-mentioned technical problems through the following technical means:

[0007] The first aspect of the present invention proposes the use of circRNA as a molecular marker in the preparation of products for the diagnosis, detection, monitoring or prediction of the progression of liver fibrosis, wherein the circRNA is circSMAD2; the nucleotide sequence of circSMAD2 is shown in SEQ ID NO.1.

[0008] A second aspect of the present invention provides a viral packaging plasmid for treating liver fibrosis, wherein the viral packaging plasmid is a plasmid containing the aforementioned circSMAD2 packaged with adeno-associated virus (AAV).

[0009] The AAV expression plasmid is AAV2 / 8-sh-circSMAD2. AAV has advantages such as high expression titer, high safety, and mild host immune response, and has become one of the most widely used viral vectors in the field of gene therapy in recent years.

[0010] Preferably, the viral packaging plasmid is constructed by inserting the circSMAD2 sequence into the multiple cloning site of the aforementioned AAV adeno-associated virus expression plasmid. The constructed viral packaging plasmid sequentially contains AAV2 / 8, the α-SMA hepatic stellate cell promoter, the circSMAD2 sequence, and a LUC fluorescent tag. It can effectively achieve the knockdown of circSMAD2 in hepatic stellate cells.

[0011] A third aspect of the present invention provides a liver fibrosis-associated biomarker, circular RNA (circSMAD2), the nucleotide sequence of which is shown in SEQ ID NO.1.

[0012] A fourth aspect of the present invention provides a substance that inhibits circSMAD2 expression and / or reduces its activity, including RNA interference molecules, antisense oligonucleotides, small molecule inhibitors, shRNAs, substances that inhibit circSMAD2, and substances that induce lentiviral infection or gene knockdown.

[0013] Preferably, the substance that inhibits circSMAD2 expression and / or reduces its activity includes siRNA.

[0014] More preferably, the nucleic acid sequence of the siRNA is as shown in SEQ ID NO.2 or SEQ ID NO.3.

[0015] Preferably, the siRNA can exert its inhibitory function in the form of nucleic acid fragments, in the form of plasmids, directly linked to an AAV vector, or through transfection with liposomes, or in host cells that express the siRNA.

[0016] A fifth aspect of the invention provides a nucleic acid fragment, recombinant vector, or host cell that contains and / or expresses siRNA as shown in SEQ ID NO.2 or SEQ ID NO.3.

[0017] A sixth aspect of the present invention is an anti-liver fibrosis drug, said drug comprising the above-described nucleic acid fragment, recombinant vector or host cell.

[0018] The seventh aspect of the present invention proposes the use of the above-mentioned viral packaging plasmid, substances that inhibit circSMAD2 expression and / or reduce its activity in the preparation of a medicament for treating liver fibrosis.

[0019] The beneficial effects of this invention are as follows:

[0020] 1. This invention reveals for the first time the structural stability of circular RNA circSMAD2 and its application in liver fibrosis, proposes the key role of circSMAD2 in the progression of liver fibrosis, provides a new molecular marker for the clinical diagnosis and assessment of liver fibrosis, and provides a new target for drug development of liver fibrosis.

[0021] 2. This invention provides a novel circular RNA, named circSMAD2, which is a circular RNA molecule structure formed by reverse splicing of the nucleotide sequence shown in SEQ ID NO.1. This circular RNA circSMAD2 is formed by circularization of exons 2 and 11 of the host gene SMAD2, and its genomic location is chr18:76422093-76464430, with a length of 1502 nt.

[0022] 3. Application of circRNA in the preparation of drugs for treating liver fibrosis: Knockdown of circRNA can significantly improve liver fibrosis in mice, therefore circRNA can serve as a potential therapeutic target for liver fibrosis. We screened and identified differentially expressed circular RNAs and found that circSMAD2 is upregulated in lactate-activated hepatic stellate cells. Silencing circSMAD2 can inhibit stellate cell activation and alleviate liver fibrosis damage in mice.

[0023] 4. This invention discovered that circSMAD2 expression is significantly upregulated in patients with liver fibrosis, suggesting that this circular RNA could serve as a novel biomarker for the clinical diagnosis of liver fibrosis. Experimental verification showed that inhibiting circSMAD2 expression significantly reduced the production of liver fibrosis markers, suggesting that drugs targeting this circular RNA could inhibit glycolysis levels in liver fibrosis and could be used as anti-liver fibrosis drugs. Attached Figure Description

[0024] Figure 1This is a diagram of the screening process for circular RNA circSMAD2 in Example 1 of the present invention. A is a schematic diagram of screening for lactate-related target circular RNAs, B is a circRNA-seq volcano plot, C is a histogram showing the differentially expressed circular RNAs (TOP5), and D is a qRT-PCR analysis of the expression of circular RNAs in lactate-stimulated primary mouse hepatic stellate cells.

[0025] Figure 2 This diagram shows the gene information, circularization pattern, and Sanger sequencing results of the circular RNA circSMAD2 in Example 2 of this invention.

[0026] Figure 3 The figure shows the verification results of the circSMAD2 characteristics in Embodiment 2 of the present invention, proving that the stability of circSMAD2 is much higher than that of linear SMAD2.

[0027] Figure 4 The image shows a comparison of the expression of circSMAD2 in human liver fibrosis and human hepatocellular carcinoma serum detected by qRT-PCR in Example 3 of this invention (A) and a comparison of the expression of circSMAD2 in three mouse liver fibrosis models (MCD, TAA, and CCL4) detected by qRT-PCR (B).

[0028] Figure 5 This is a graph illustrating the therapeutic effect of circSMAD2 knockdown on mouse liver fibrosis using the constructed circSMAD2 knockdown AAV viral vector in Example 4 of this invention. A represents the effect detected by qRT-PCR.

[0029] A) shows the expression of circSMAD2 in liver tissue induced by CCL4 after AAV2 / 8-sh-circSMAD2 injection. B) shows the expression of circSMAD2 in liver tissue induced by TAA after AAV2 / 8-sh-circSMAD2 injection detected by qRT-PCR. C) shows the expression of circSMAD2 in liver tissue induced by MCD diet after AAV2 / 8-sh-circSMAD2 injection detected by qRT-PCR. DG) shows the expression of COL1A1, α-SMA, and TIMP-1 proteins detected by Western blot.

[0030] Figure 6 This is a graph showing the therapeutic effect of circSMAD2 knockdown siRNA in a TGF-β1-induced LX-2 cell model, constructed in Example 5 of this invention. In the graph, A is the efficiency of circSMAD2 knockdown siRNA detected by qRT-PCR, and BC are the expression graphs of COL1A1, α-SMA and TIMP-1 proteins detected by Western blot. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0032] Unless otherwise specified, all test materials and reagents used in the following examples are commercially available.

[0033] Unless otherwise specified, all techniques or conditions described in the embodiments can be performed in accordance with the techniques or conditions described in the literature in this field or in the product manual. Unless otherwise specified, the quantitative experiments in the following embodiments are all repeated three times or more, and the results are averaged.

[0034] Example 1:

[0035] circRNA profiling was performed on primary mouse hepatic stellate cells (PmHSCs) after lactate treatment.

[0036] circRNA sequencing primarily improves circRNA enrichment by removing rRNA from the sample and digesting linear RNA. After library construction and sequencing, circRNA identification, distribution statistics, annotation analysis, and expression level calculation can be performed. Figure 1 A). After screening for differentially expressed circular RNAs, 68 upregulated circular RNAs and 15 downregulated circular RNAs were found between lactate-treated PmHSCs and the control group. Figure 1 B), qRT-PCR analysis confirmed the upregulation of the first five circular RNAs (circBbs9, circTbcel, circSMAD2, circRasa2, and circBckdhb). Figure 1 C), consistent with circular RNA-seq data. Compared with the control group, circSMAD2 was significantly upregulated in lactate-induced PmHSCs (C). Figure 1 D).

[0037] Example 2:

[0038] Basic characteristics and determination of circSMAD2

[0039] 1. circSMAD2 sequence

[0040] Based on the circBase and circBank databases, the circular RNA circSMAD2, consisting of 1502 bases and located at chr18:76422093-76464430, is formed by circularization of exons 2 and 11 of the host gene SMAD2. In this study, it was named circSMAD2. To verify the circularization characteristics of circSMAD2, we used cDNA from mouse hepatic stellate cells JS-1 as a template to perform PCR amplification of the sequence at the adapter site, and then performed Sanger sequencing on the product. The results showed that the adapter sequence was correct, confirming the presence of circSMAD2 in JS-1 cells. Figure 2 ).

[0041] 2. Ring structure characteristics

[0042] To further verify the circular structure of circSMAD2, we treated human hepatic stellate cells LX-2 amplified circSMAD2 with RNase R. We found that circSMAD2 exhibited high RNase R resistance, suggesting that it may possess a circular structure. Figure 3 ).

[0043] Example 3:

[0044] circSMAD2 expression in liver fibrosis

[0045] like Figure 4 AB results showed that circSMAD2 expression was significantly upregulated in the blood of patients with liver fibrosis compared to normal liver tissue. Further qRT-PCR analysis revealed circSMAD2 expression in three mouse models of liver fibrosis (MCD, TAA, and CCL4), as well as in primary hepatic stellate cells and TGF-β1-induced LX-2 cells. This study suggests that circSMAD2 shows promise as a novel biomarker for the clinical diagnosis of liver fibrosis.

[0046] Example 4:

[0047] This embodiment provides a viral packaging plasmid for treating liver fibrosis, which is a plasmid containing circRNA packaged with adeno-associated virus (AAV). The circRNA is circSMAD2; the nucleotide sequence of circSMAD2 is shown in SEQ ID NO.1. The above viral packaging plasmid is constructed by inserting the circRNA sequence into the multiple cloning site of the AAV expression plasmid.

[0048] The AAV adeno-associated virus expression plasmid is AAV2 / 8-sh-circSMAD2.

[0049] This experiment used the AAV adeno-associated virus expression plasmid AAV2 / 8-sh-circSMAD2 for packaging, and designed the circSMAD2 knockdown vector—AAV2 / 8-sh-circSMAD2. These were sent to Qingke Biotechnology Co., Ltd. for plasmid synthesis, PCR identification, sequencing, plasmid extraction, and adeno-associated virus packaging and quality testing. The circSMAD2 sequence in the knockdown vector is shown in SEQ ID NO.1. All animal treatment procedures were approved by the institution's animal ethics committee (Hefei, China; No.: LLSC20200977). The hepatic stellate cell promoter (α-SMA) drove the specific expression of luciferases AAV2 / 8-sh-circSMAD2 and AAV2 / 8-empty in mouse liver tissue, designed and synthesized by Qingke Biotechnology Co., Ltd. (Nanjing, China). AAV2 / 8-sh-circSMAD2 and AAV2 / 8-empty (1×10⁻⁶) were expressed in stellate cells. 12 The carbon tetrachloride (cTCH) injection was diluted with physiological saline and injected into the tail vein of mice. For the carbon tetrachloride-induced liver fibrosis model, male mice were randomly assigned to receive intraperitoneal injections of olive oil and carbon tetrachloride (10% v / v dissolved in olive oil, 2 mL / kg), twice weekly for 6 weeks. For the thioacetamide (TAA)-induced liver fibrosis model, male mice were randomly assigned to receive intraperitoneal injections of TAA (100 mg / kg), twice weekly for 6 weeks. For the methionine- and choline-deficient (MCD) diet-induced liver fibrosis model, male mice were fed a normal diet (NC) or an MCD diet (D200421, study diet) for 6 weeks. All mice were humanely euthanized 6 weeks after modeling and their tissues were harvested for Western blot analysis to detect the therapeutic effect of circSMAD2 on liver fibrosis. Results are as follows: Figure 5 As shown.

[0050] The specific steps of qRT-PCR are as follows: Using the cDNA sample obtained from reverse transcription as a template, RT-qPCR amplification is performed using the circular RNA circSMAD2 back-to-back primers from Example 1, or primers corresponding to other gene species. After the program runs, the data is exported. GAPDH is used as an internal control, and 2... -△△ct The expression of each gene in the sample was analyzed using qRT-PCR. qRT-PCR analysis showed that AAV2 / 8-sh-circSMAD2 effectively knocked out the expression of circSMAD2 in liver tissue. Figure 5 (A, B, C)

[0051] Western blot detection of liver fibrosis markers ( Figure 5 D). The specific steps include:

[0052] Total cellular protein was extracted using Western blotting and IP lysis buffer, and proteins were separated by polyacrylamide gel electrophoresis and transferred to a PVDF membrane. The membrane was blocked with 5% skim milk powder at room temperature for 1 hour, followed by overnight incubation with primary antibody at 4°C. The membrane was then incubated with the corresponding secondary antibody at room temperature for 1 hour. Protein visualization was performed using an enhanced chemiluminescence assay kit and imaging was performed using a Tanon 5200Multi chemiluminescence imaging system (Tanon, Shanghai, China).

[0053] Example 5:

[0054] Silencing circSMAD2 can inhibit the expression of liver fibrosis markers induced by TGF-β1 in LX-2 cells.

[0055] 1. Cell transfection

[0056] siRNA design and synthesis: This invention designs siRNA targeting the circularization site of circSMAD2. The sequences used are shown in SEQ ID NO.2 and SEQ ID NO.3, and the siRNA was synthesized by Gemma Biotechnology Co., Ltd.

[0057] Cell transfection: Strict aseptic technique must be followed throughout the entire cell transfection process. Enzyme-free consumables must be used for experimental materials that come into direct contact with siRNAs. The specific steps are as follows:

[0058] a1. The optimal cell density for transfection is approximately 70%-80%. Add 2.5 μL of Lipofectamine™ 3000 liposome solution to 100 μL of Opti-MEM serum-free cell culture medium. Gently mix and incubate at room temperature for 5 minutes. Label this transfection working solution A. Separately, prepare another 100 μL of Opti-MEM serum-free cell culture medium and add 210 pmol siRNA. Gently mix and incubate at room temperature for 5 minutes. Label this transfection working solution B. Combine working solutions A and B, gently mix, and incubate at room temperature for 10 minutes to allow the complex to form.

[0059] a2. After standing for 20 min, add 200 μL of the complex solution to each well of the 12-well plate, and add 800 μL of Opti-MEM serum-free cell culture medium to each well to a total volume of 1 mL.

[0060] a3. Aspirate the cell culture medium to remove the cell transfection medium containing liposome Lipofectamine™ 2000; add 1 mL of DMEM high-glucose medium containing 10% serum to each well and continue culturing in a 37°C, 5% CO2 incubator; collect cell samples at the corresponding time points according to the subsequent experimental requirements and extract cellular RNA.

[0061] Following the detection steps described in Example 3, RT-qPCR was used to verify the transfection and silencing efficiency of circSMAD2. The results showed that compared to the si-NC blank vector control group, the expression level of circSMAD2 in the circSMAD2 silencing group was reduced, indicating a significant silencing effect. This demonstrates successful inhibition of circSMAD2. The experimental results are as follows: Figure 6 As shown in Figure A. Similarly, in LX-2 cells cultured for 24 hours in a medium containing TGF-β1, silencing circSMAD2 showed that inhibiting circSMAD2 reduced the expression of liver fibrosis markers ( Figure 6 B).

[0062] circSMAD2 sequence: (SEQ ID NO.1)

[0063] GGTAGATTTACCGGGCTTTTCTGAGTGTGGATTGTTACCTTTGGTAAGAAAATGT

[0064] CGTCCATCTTGCCATTCACTCCGCCAGTGGTGAAGAGACTTCTGGGATGGAAAAA

[0065] ATCAGCCGGTGGGTCTGGAGGAGCAGGTGGTGGAGAGCAGAATGGACAGGAAG

[0066] AAAAGTGGTGTGAAAAAGCAGTGAAAAGTCTGGTGAAAAAGCTAAAGAAACA

[0067] GGACGGTTAGATGAGCTTGAGAAAGCCATCACCACTCAGAATTGCAATACTAAAT

[0068] GTGTCACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACAGCAAATAC

[0069] GGTAGATCAGTGGGACACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCT

[0070] CTTGATGGCCGTCTTCAGGTTTCACACCGGAAAGGGTTGCCACATGTTATATATTG

[0071] CCGGCTCTGGCGCTGGCCGGACCTTCACAGTCATCATGAGCTCAAGGCAATCGAA

[0072] AACTGCGAATATGCTTTTAATCTGAAAAAAGATGAAGTGTGTGTAAATCCGTACC

[0073] ACTACCAGAGAGTTGAGACCCCAGTCTTGCCTCCAGTCTTAGTGCCTCGGCACAC

[0074] GGAGATTCTAACAGAACTGCCGCCCCTGGATGACTACACCCACTCCATTCCAGAA

[0075] AACACAAATTTCCCAGCAGGAATTGAGCCACAGAGTAATTACATCCCAGAAACA

[0076] CCACCACCTGGATATATCAGTGAAGATGGAGAAACAAGTGACCAACAGTTGAAC

[0077] CAAAGTATGGACACAGGCTCTCCGGCTGAACTGTCTCCTACTACTCTCTCTCCTGT

[0078] TAATCACAGCTTGGATTTGCAGCCAGTTACTTACTCGGAACCTGCATTCTGGTGTT

[0079] CAATCGCATACTATGAACTAAACCAGAGGGTTGGAGAGACCTTCCATGCGTCACA

[0080] GCCCTCGCTCACTGTAGACGGCTTCACAGACCCATCAAACTCGGAGAGGTTCTGC

[0081] TTAGGCTTGCTCTCCAACGTTAACCGAAATGCCACTGTAGAAATGACAAGAAGAC

[0082] ATATAGGAAGGGGAGTGCGCTTGTATTACATAGGTGGGGAAGTGTTTGCTGAGTG

[0083] CCTAAGTGATAGTGCAATCTTTGTGCAGAGCCCCAACTGTAACCAGAGATACGGC

[0084] TGGCACCCTGCAACAGTGTGTAAGATCCCACCAGGCTGTAACCTGAAGATCTTCA

[0085] ACAACCAAGAATTTGCTGCTCTTCTGGCTCAGTCTGTCAACCAGGGTTTTGAAGC

[0086] CGTTTATCAGCTAACCCGAATGTGCACCATAAGAATGAGTTTTGTGAAGGGCTGG

[0087] GGAGCAGAATATCGGAGGCAGACAGTAACAAGTACTCCTTGCTGGATTGAACTTC

[0088] ATCTGAATGGCCCTCTGCAGTGGCTGGACAAAGTATTAACTCAGATGGGATCCCC

[0089] TTCAGTGCGATGCTCAAGCATGTCGTAAACCCATCAAAGACTCGCTGTAACAGCT

[0090] CCTCCGTCGTAGTATTCAT

[0091] Nucleic acid sequence of siRNA:

[0092] SEQ ID NO.2:

[0093] GUCGUAGUAUUCAUGGUAGTT-CUACCAUGAAUACUACGACTT

[0094] SEQ ID NO,3:

[0095] AUUCAUGGUAGAUUUACCGTT-CGGUAAAUCUACCAUGAAUTT

[0096] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of a reagent for detecting circSMAD2 expression levels in the preparation of products for diagnosing liver fibrosis, characterized in that, The nucleotide sequence of circSMAD2 is shown in SEQ ID NO.

1.

2. The use of a substance that inhibits circSMAD2 expression in the preparation of a drug for treating liver fibrosis, characterized in that, The substance that inhibits circSMAD2 expression is siRNA, and the nucleic acid sequence of the siRNA is shown in SEQ ID NO. 2 and SEQ ID NO. 3.

Citation Information

Patent Citations

  • Methods for assessing and treating leukemia

    CN101426928A

  • Application of circSpred1 gene as marker in diagnosis of fibrosis liver and liver cancer and drug preparation

    CN114045335A