Application of reagent for detecting BATF3 expression level in preparation of head and neck squamous cell carcinoma detection kit

Abstract

The invention discloses application of a reagent for detecting the expression level of BATF3 in preparation of a head and neck squamous cell carcinoma auxiliary diagnosis kit. The research finds that the expression level of the BATF3 gene in head and neck squamous cell carcinoma tissues is obviously higher than that of the BATF3 gene in normal and healthy tissues, and is positively correlated with the expression level of PD-1. Therefore, it is believed that the BATF3 gene can be used as a biomarker for auxiliary diagnosis of the head and neck squamous cell carcinoma, and a new auxiliary confirmation mode can be provided for early diagnosis of the head and neck squamous cell carcinoma by detecting the expression level of the BATF3 gene.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and particularly relates to the application of a reagent for detecting BATF3 expression level in the preparation of a head and neck squamous cell carcinoma detection kit. Background Art

[0002] Head and neck tumors usually occur in the oral cavity, nasopharynx, oropharynx, hypopharynx and larynx, of which more than 90% are squamous cell carcinoma (SCCHN). In addition to nasopharyngeal carcinoma, the causes of head and neck squamous cell carcinoma (SCCHN) are mainly related to tobacco carcinogens and alcohol, and also vary by country and region.

[0003] According to the statistics of WHO in 2020, there were 377,713 new cases of lip / oral cancer, 177,757 deaths, and 959,248 patients in 5 years worldwide; there were 184,615 new cases of laryngeal cancer, 99,840 deaths; 98,412 new cases of oropharyngeal cancer, 48,143 deaths; and 84,254 new cases of hypopharyngeal cancer, 38,599 deaths. In China, there were 30,117 new cases of lip / oral cancer and 14,785 deaths; 29,135 new cases of laryngeal cancer and 15,814 deaths; 6,251 new cases of hypopharyngeal cancer and 3,380 deaths; and 5,604 new cases of oropharyngeal cancer and 2,905 deaths. Most patients are in the late stage when they seek medical treatment. About 50-60% of patients with late stage SCCHN will have recurrence or distant metastasis within 2 years, and the prognosis of patients with recurrent or metastatic SCCHN (R / M SCCHN) is poor. In order to achieve early diagnosis of head and neck squamous cell carcinoma, a Chinese invention patent application with publication number CN117721208A discloses a pan-cancer tumor marker NPBWR1, indicating that NPBWR1 can be used as a diagnostic marker for lung cancer, breast cancer, head and neck squamous cell carcinoma, malignant pluripotent embryonal carcinoma, prostate cancer, liver cancer, gastric cancer, bladder cancer, prostate cancer and other cancers; obviously, the correlation between NPBWR1 and head and neck squamous cell carcinoma is not strong, and it is urgent to develop another biomarker that can specifically and sensitively diagnose head and neck squamous cell carcinoma. Summary of the invention

[0004] The purpose of the present invention is to provide a reagent for detecting the expression level of BATF3 for use in preparing a head and neck squamous cell carcinoma auxiliary diagnosis kit, thereby providing a new auxiliary method for the early diagnosis of head and neck squamous cell carcinoma.

[0005] To achieve the above-mentioned object of the invention, the technical solution of the present invention is as follows:

[0006] Application of a reagent for detecting BATF3 expression level in the preparation of an auxiliary diagnostic kit for head and neck squamous cell carcinoma.

[0007] The present invention found that the expression level of BATF3 gene in head and neck squamous cell carcinoma tissue is significantly higher than that in normal healthy tissue, and is positively correlated with the expression level of PD-1. Therefore, it is believed that BATF3 gene can be used as a biomarker for auxiliary diagnosis of head and neck squamous cell carcinoma, and detecting the expression level of BATF3 gene can provide a new auxiliary confirmation method for the early diagnosis of head and neck squamous cell carcinoma.

[0008] Preferably, the reagent for detecting the expression level of BATF3 comprises:

[0009] An oligonucleotide probe that specifically recognizes the BATF3 gene;

[0010] Alternatively, primers that specifically amplify the BATF3 gene.

[0011] As further preferred, the primers for specific amplification of BATF3 gene include:

[0012] Upstream primer: 5′-CAGAAGGCTGACAAGCTCCA-3′;

[0013] Downstream primer: 5′-TACTAGCTGCCAGGGTGGAT-3′.

[0014] In the present invention, the head and neck squamous cell carcinoma at least includes nasal cavity and paranasal sinus squamous cell carcinoma, oral squamous cell carcinoma, oropharyngeal squamous cell carcinoma, laryngeal squamous cell carcinoma, and hypopharyngeal squamous cell carcinoma. The present invention also provides a head and neck squamous cell carcinoma auxiliary diagnosis kit, which contains the above-mentioned reagent for detecting the expression level of BATF3.

[0015] The present invention also found that after reducing the expression level of BATF3 in head and neck squamous cell carcinoma cells, the invasiveness and migration ability of head and neck squamous cell carcinoma cells were significantly reduced, and the growth rate was significantly slowed down. Based on this, the present invention also provides the use of BATF3 expression inhibitors in the preparation of drugs for the treatment of head and neck squamous cell carcinoma.

[0016] The present invention also found that when anti-PD-1 antibody or IgG antibody is applied after the BATF3 expression level in head and neck squamous cell carcinoma cells is reduced by drugs, the anti-tumor effect is significantly better than the anti-tumor effect of anti-PD-1 antibody or IgG antibody alone. Therefore, the present invention also provides the use of BATF3 expression inhibitor combined with anti-PD-1 antibody or IgG antibody in the preparation of a drug for treating head and neck squamous cell carcinoma.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] (1) The present invention found that the expression level of BATF3 gene in head and neck squamous cell carcinoma tissue is significantly higher than that in normal healthy tissue, and is positively correlated with the expression level of PD-1. Therefore, it is believed that BATF3 gene can be used as a biomarker for auxiliary diagnosis of head and neck squamous cell carcinoma, and detecting the expression level of BATF3 gene can provide a new auxiliary confirmation method for the early diagnosis of head and neck squamous cell carcinoma.

[0019] (2) The present invention found that after reducing the expression level of BATF3 in head and neck squamous cell carcinoma cells, the invasiveness and migration ability of head and neck squamous cell carcinoma cells were significantly reduced, and the growth rate was significantly slowed down; therefore, BATF3 expression inhibitors can be used to prepare drugs for the treatment of head and neck squamous cell carcinoma, providing a new way for the treatment of head and neck squamous cell carcinoma.

[0020] (3) The present invention also found that when anti-PD-1 antibody or IgG antibody is administered after the BATF3 expression level in head and neck squamous cell carcinoma cells is reduced by drugs, the anti-tumor effect is significantly better than the anti-tumor effect of anti-PD-1 antibody or IgG antibody alone. This indicates that BATF3 expression inhibitors are beneficial to promoting the efficacy of anti-PD-1 antibody or IgG antibody on head and neck squamous cell carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 To compare the relative expression levels of BATF3 gene in normal tissues and head and neck squamous cell carcinoma tissues;

[0022] Among them, Normal represents normal tissue, Tumor represents head and neck squamous cell carcinoma tissue, Relative BATF3mRNA expression level represents the relative mRNA expression level of BATF3 gene, θθθ Indicates P < 0.001, the same below;

[0023] Figure 2 To compare the relative expression levels of PD-1 gene in normal tissues and head and neck squamous cell carcinoma tissues;

[0024] Figure 3 To compare the relative expression levels of PD-L1 gene in normal tissues and head and neck squamous cell carcinoma tissues;

[0025] Figure 4 This is the correlation analysis between BATF3 gene expression level and PD-1 gene expression level;

[0026] Figure 5The effect of short hairpin RNA BATF3 and BATF3 overexpression plasmid on BATF3 expression in Fadu cells (qRT-PCR analysis results);

[0027] Among them, Blank represents blank control, sh-NC and NC represent negative controls, sh#1, sh#2 and sh#3 represent short hairpin RNA BATF3 knockdown expression groups, and OE represents BATF3 overexpression group; *** Indicates P<0.001vs.sh-NC group & NC group; the same below;

[0028] Figure 6 The effect of short hairpin RNA BATF3 and BATF3 overexpression plasmid on BATF3 expression in Fadu cells (Western blot analysis results);

[0029] Figure 7 The effect of short hairpin RNA BATF3 and BATF3 overexpression plasmid on BATF3 expression in CAL-27 cells (qRT-PCR analysis results);

[0030] Figure 8 The effect of short hairpin RNA BATF3 and BATF3 overexpression plasmid on BATF3 expression in CAL-27 cells (Western blot analysis results);

[0031] Fig. 9 This is a microscopic observation of abnormal expression of BATF3 affecting the migration behavior of HNC cells;

[0032] Fig.10 The effect of abnormal expression of BATF3 on the migration rate of Fadu cells;

[0033] Among them, Relative migration rate (%) means relative migration rate, the same below;

[0034] Fig.11 The effect of abnormal expression of BATF3 on the migration rate of CAL-27 cells;

[0035] Fig.12 This is a microscopic observation of abnormal expression of BATF3 affecting the invasion behavior of SCCHN cells;

[0036] Fig.13 The effect of abnormal expression of BATF3 on the invasion rate of Fadu cells;

[0037] Wherein, Relative invasion rate (%) indicates relative invasion rate, the same below;

[0038] Fig.14The effect of abnormal expression of BATF3 on the invasion rate of CAL-27 cells;

[0039] Fig.15 The effect of BATF3 knockdown on the tumor volume in mice;

[0040] Among them, Tumor volume refers to tumor volume, the same below;

[0041] Fig.16 The results of the diagnostic performance analysis of BATF3 expression level for head and neck squamous cell carcinoma (ROC curve);

[0042] Among them, Specificity means specificity, Sensitivity means sensitivity, AUC means area under the curve, and ROC Curve (Tumor vs. Normal) means ROC curve (tumor sample vs. normal sample). DETAILED DESCRIPTION

[0043] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments.

[0044] Example 1 Analysis of the difference in expression levels of BATF3 in tumor tissues and normal tissues

[0045] Clinical samples of head and neck squamous cell carcinoma patients were collected, including head and neck squamous cell carcinoma tissues (sampling location was oral cavity) and normal tissues. RNA of each sample was extracted and cDNA was obtained by reverse transcription. The cDNA was amplified using the primers listed in Table 1 to obtain the expression levels of PD-1 gene, PD-L1 gene and BATF3 gene in each tissue respectively; GAPDH was used as the endogenous control, and the data were obtained using 2 -ΔΔCT Legal amount.

[0046] Table 1

[0047]

[0048] The analysis results are as follows Figure 1 , Figure 2 , Figure 3 and Figure 4 shown.

[0049] Depend on Figures 1 to 3 It can be seen that compared with normal tissues, the PD-1 gene, PD-L1 gene and BATF3 gene in head and neck squamous cell carcinoma tissues are significantly overexpressed; Figure 4 It can be seen that the expression levels of BATF3 gene and PD-1 gene are continuously positively correlated.

[0050] Example 2 Effect of BATF3 expression level on malignant biological behavior of SCCHN cells

[0051] 1. Construction of cells with abnormal BATF3 expression

[0052] In order to explore the effect of BATF3 expression level on the malignant biological behavior of SCCHN cells, the present invention first used head and neck squamous cell carcinoma cell lines (Fadu and CAL-27) as experimental subjects, and constructed BATF3 expression abnormal cells using short hairpin RNA BATF3 (shBATF3#1, shBATF3#2, shBATF3#3) and overexpression plasmid OE-BATF3 respectively:

[0053] (1) Knockdown expression group: 1×10 7 The cells were seeded in 15 cm culture dishes for 24 h, and the knockdown expression group was transfected with BATF3 short hairpin RNA using Lipofectamine 3000 transfection reagent for 48 h;

[0054] Among them, the sequences of shBATF3#1, shBATF3#2, and shBATF3#3 are as follows:

[0055] shBATF3#1: AGCAAGGAGCCTTGGTCATTT (SEQ ID No. 7);

[0056] shBATF3#2:GACAAGCTCCATGAGGAATAT(SEQ ID No.8);

[0057] shBATF3#3: TGCTCTGCCCTATGAACTTTG (SEQ ID No. 9);

[0058] (2) Overexpression group: BATF3 overexpression plasmid was established using pcDNA3.1(+) vector, and cells were transfected with OE-BATF3 overexpression plasmid using liposome transfection reagent for 48 h;

[0059] At the same time, blank control group (Blank), negative control group (NC) and sh-NC group were set up;

[0060] Western blot and qRT-PCR were used to detect the expression of BATF3 in the knockdown expression group and overexpression group cells, respectively. Figure 5 , Figure 6 , Figure 7 and Figure 8 shown.

[0061] Depend on Figures 5 to 8It can be seen that shBATF3#1, shBATF3#2, and shBATF3#3 all significantly downregulated the expression level of BATF3 in Fadu cells and CAL-27 cells; while OE-BATF3 plasmid significantly upregulated the expression level of BATF3 in Fadu cells and CAL-27 cells.

[0062] 2. Effects of abnormal BATF3 expression on malignant biological behavior of cells

[0063] Subsequently, the above-mentioned NC group, sh-NC group, shBATF3#1 group and OE-BATF3 group cells were used as experimental objects, and the malignant biological behavior of HNC cells was detected by scratch assay and Transwell invasion assay.

[0064] (1) Scratch test

[0065] Scratches were made on the monolayer of SCCHN cells using a pipette, and then floating cells were effectively removed with phosphate buffered saline; the migration area of ​​cells was quantified immediately after the scratch and 48 hours after the scratch under an optical microscope at a magnification of ×200. The observation and analysis results are shown in Fig. 9 , Fig.10 and Fig.11 .

[0066] Depend on Figures 9 to 11 It can be seen that the migration ability of SCCHN cells in the shBATF3 group was significantly reduced due to the significant downregulation of BATF3, while the migration ability of SCCHN cells in the OE-BATF3 group was significantly enhanced due to the significant upregulation of BATF3.

[0067] (2) Transwell invasion assay

[0068] A 24-well plate pre-coated with Matrigel was used and incubated at 37°C for 1 h. After incubation, serum-depleted HNC cells (2 × 10 cells per well) were placed in the culture medium. 4 ) was attached to the top of each chamber; serum-enriched medium was added to the lower well; after 24 h, the cells invading the bottom surface of the implant were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet, observed under an optical microscope with a magnification of ×200 and the cells were counted. The observation and analysis results are shown in Fig.12 , Fig.13 and Fig.14 .

[0069] Depend on Figure 12 to Figure 14 It can be seen that the SCCHN cells in the shBATF3 group had a significantly reduced invasive ability due to the significant downregulation of BATF3, while the SCCHN cells in the OE-BATF3 group had a significantly enhanced invasive ability due to the significant upregulation of BATF3.

[0070] Example 3 BATF3 knockdown combined with PD-1 antibody enhances anti-tumor effect

[0071] C3H / HeNCr MTV (C3H) mice (5 weeks old) weighing 18-25 g were selected and 2×10 5 CAL-27 cells (WT or transfected with shBATF3 or shNC) were subcutaneously inoculated into mice to make them tumor-bearing. Then, anti-PD-1 antibody or IgG antibody (0.2 mg) was intraperitoneally injected on days 8, 11, 14, and 17, respectively. The tumor growth of all mice was recorded every day. The mice were euthanized on day 20 after inoculation, and the tumor specimens were removed and preserved in time. The tumor volume was measured and the analysis results are shown in Fig.15 .

[0072] Depend on Fig.15 It can be seen that compared with shNC, shBATF3 significantly inhibited tumor growth; on the basis of shBATF3, after additional treatment with anti-PD-1 antibodies or IgG antibodies, the tumor volume was further reduced; this shows that the anti-tumor effect of shBATF3 combined with anti-PD-1 antibodies or IgG antibodies is better, and shBATF3 is beneficial to solve the tumor resistance to anti-PD-1 antibodies or IgG antibodies.

[0073] Example 4 Analysis of the diagnostic efficacy of BATF3 expression level for head and neck squamous cell carcinoma

[0074] Through TCGA-HNSC (GDC TCGA Head and Neck Cancer) (database: http: / / xena.ucsc.edu / ), the expression of BATF3 in the sample was taken as X, the patient phenotype tumor marker was 1, and the normal marker was 0 as Y. The ROC curve was drawn using the R language pROC package. The results are shown in the figure. Fig.16 shown.

[0075] Depend on Fig.16 It can be seen that the area under the curve (AUC) was 0.802, the 95% confidence interval (95% CI) was 0.719-0.886, the specificity was 0.816, and the sensitivity was 0.670, indicating that BATF3 level has a good diagnostic efficacy for head and neck squamous cell carcinoma.

Claims

1. Application of reagents for detecting BATF3 expression levels in the preparation of auxiliary diagnostic kits for head and neck squamous cell carcinoma.

2. The use according to claim 1, characterized in that The reagent for detecting the expression level of BATF3 comprises: An oligonucleotide probe that specifically recognizes the BATF3 gene; Alternatively, primers that specifically amplify the BATF3 gene.

3. The use according to claim 2, characterized in that The primers for specific amplification of BATF3 gene include: Upstream primer: 5′-CAGAAGGCTGACAAGCTCCA-3′; Downstream primer: 5′-TACTAGCTGCCAGGGTGGAT-3′.

4. The use according to claim 1, characterized in that The head and neck squamous cell carcinoma at least includes nasal cavity and paranasal sinus squamous cell carcinoma, oral squamous cell carcinoma, oropharyngeal squamous cell carcinoma, laryngeal squamous cell carcinoma, and hypopharyngeal squamous cell carcinoma.

5. A head and neck squamous cell carcinoma auxiliary diagnosis kit, characterized in that: Contains reagents for detecting BATF3 expression levels.

6. The head and neck squamous cell carcinoma auxiliary diagnosis kit according to claim 5, characterized in that: The reagent for detecting the expression level of BATF3 comprises: An oligonucleotide probe that specifically recognizes the BATF3 gene; Alternatively, primers that specifically amplify the BATF3 gene.

7. Application of BATF3 expression inhibitors in the preparation of therapeutic drugs for head and neck squamous cell carcinoma.

8. Application of BATF3 expression inhibitor combined with anti-PD-1 antibody in the preparation of therapeutic drugs for head and neck squamous cell carcinoma.

9. Application of BATF3 expression inhibitor combined with IgG antibody in the preparation of therapeutic drugs for head and neck squamous cell carcinoma.

Images