Application of SNTB1 gene in colitis and proctitis cancer transformation

Abstract

The invention relates to application of an SNTB1 gene in occurrence and development of colorectal cancer caused by colitis and proctitis. The key effect of the SNTB1 gene in occurrence and development of colorectal cancer caused by colorectal cancer is creatively disclosed, a new perspective is provided for pathogenesis and molecular fundamental research of colorectal cancer, and development of targeted treatment strategies or prevention methods is facilitated. And secondly, the SNTB1 gene is used as a biomarker, so that effective screening of colitis cancer transformation high-risk groups can be realized, and the early diagnosis rate is improved. Besides, the SNTB1 gene expression promoter provided by the invention can be used for constructing a whole-process animal model for colorectal cancer transformation, and a powerful tool is provided for deeply researching pathogenesis of colorectal cancer and screening drugs. Meanwhile, the prepared preventive pharmaceutical composition is expected to effectively prevent transformation of colitis and proctitis cancers by inhibiting SNTB1 gene expression.

Description

[0001] Priority statement

[0002] This application claims priority to Chinese patent application number 202410770604.8, filing date June 14, 2024, entitled "Regulation of SNTB1 gene expression and its application in preventing and treating colon cancer," the contents of which are incorporated herein by reference in their entirety. Technical Field

[0003] The invention belongs to the field of biotechnology, and more specifically relates to the application of SNTB1 gene in colorectal cancer transformation. Background Art

[0004] The proliferation of colorectal cancer can lead to incomplete or complete intestinal obstruction, and patients will experience symptoms such as abdominal distension, abdominal pain, and constipation. Colorectal cancer can also lead to increased consumption of nutrients, weight loss, varying degrees of anemia, and bleeding in ulcerated areas. Advanced colorectal cancer can also metastasize widely, and metastasis to the abdominal cavity can cause symptoms of ascites. It can also metastasize to the liver and lungs, and tumor cancer cells can damage the tissues of the liver and lungs. Patients may experience abdominal pain or coughing up blood. The main ways of colorectal cancer metastasis include direct invasion, hematogenous metastasis, lymph node metastasis, and implantation metastasis. Cancer cells invade adjacent tissues, spread to other organs through blood vessels or lymphatic vessels, form colonization, cause serious illness, and often indicate poor recovery. Among all types of cancer, including colorectal cancer, metastasis is the main reason for the high cancer-related mortality rate. Therefore, selecting important factors that can inhibit colorectal cancer metastasis as targets, developing inhibitors or antibodies specific to these key factors, targeted regulation of colorectal cancer cell proliferation and metastasis, and reducing toxic and side effects have become hot topics in the current research on anti-colorectal cancer drugs.

[0005] SNTB1 is closely related to multiple tissues and organs of the human body. Its high expression may cause the loss of a certain function of human diseases and induce the occurrence and development of diseases. Existing studies have shown that the SNTB1 gene is closely related to the occurrence and development of diseases in multiple systems of the human body. Many studies have confirmed that this gene can mediate cell signal transduction pathways, mutate in several malignant tumors, and participate in the occurrence and development of many diseases, such as epilepsy, myopia, colorectal cancer, prostate cancer, lupus erythematosus and other common clinical diseases. However, there are no reports on whether the SNTB1 gene can regulate the occurrence and development of colorectal inflammatory colorectal cancer. Summary of the invention

[0006] In view of the above technical problems, the present invention provides an application of the SNTB1 gene in colorectal cancer transformation, in order to reveal the pathogenesis and molecular basis of colorectal cancer transformation, and develop new treatment strategies or prevention methods for colorectal cancer based on the mechanism of action of the SNTB1 gene.

[0007] To achieve the above objectives, the first scheme of the present invention is to provide a biomarker for screening high-risk populations for colorectal cancer transformation, wherein the biomarker is the SNTB1 gene. Overexpression of the SNTB1 gene can promote cell viability, proliferation, and migration, and can aggravate the severity of colorectal cancer associated with colorectal inflammation, and is an important target for inhibiting the generation of colorectal cancer associated with colorectal inflammation.

[0008] The second scheme of the present invention provides a SNTB1 gene expression promoter for constructing an animal model of the whole process of colorectal cancer transformation, the SNTB1 gene expression promoter includes an adeno-associated virus carrying the SNTB1 gene, and the vector of the adeno-associated virus includes pHBAAV-CMV-MCS-3flag-T2A-ZsGreen. Adeno-associated virus (AAV) is a genus of the microviridae family, with a virus particle size of about 20 to 26 nm, and a complete life cycle requires the participation of a helper virus (usually adenovirus or herpes virus). It encodes the cap and rep genes in the inverted repeat sequences (ITR) at both ends. Among them, the cap gene encodes the viral capsid protein, and the rep gene participates in the replication and integration of the virus. AAV has a variety of serotypes, and different serotypes have different affinities for different tissues, which are suitable for various in vivo infection experiments. Due to the advantages of good safety performance and long expression time of AAV, it has become the most promising gene therapy tool. The AAV packaging system consists of three plasmids, including a shuttle plasmid that can insert foreign genes, pAAV-RC encoding the genes encoding rep and cap proteins, and a pHelper plasmid that replaces the adenovirus that the adeno-associated virus relies on. After the three plasmids are co-transfected into the tool cell AAV-293, AAV virus particles carrying foreign inserted genes can be formed.

[0009] The third scheme of the present invention provides a composition for preparing a preventive drug for colorectal cancer transformation, the composition includes an adeno-associated virus shRNA vector, and the adeno-associated virus shRNA vector includes pHBAAV-U6-MCS-CMV-EGFP. The shRNA transcribed in the cell is processed and incorporated into the RNA-induced silencing complex (RISC) to guide the nuclease to degrade the target RNA. The viral shRNA vector can also be used for RNAi interference, and the vector marked with an antibiotic can continuously inhibit the expression of the target gene in the cell for several weeks or even longer. Compared with other vectors, the viral shRNA vector can directly and efficiently infect cells for gene silencing research, the transfection effect is stable, and the various inconveniences caused by the low efficiency of plasmid transfection can be avoided.

[0010] A more preferred composition scheme also includes siRNA for knocking down the SNTB1 gene, and its nucleotide sequence is the sequence shown in SEQ ID NO:1.

[0011] The nucleotide sequence shown in SEQ ID NO: 1 is as follows:

[0012] CCACTCCTTTCTGTCTGCTAAGATA.

[0013] In a further preferred composition scheme, it also includes shRNA for knocking down the SNTB1 gene, characterized in that its forward and reverse nucleotide sequences are shown as SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0014] The nucleotide sequence shown in SEQ ID NO:2 is as follows:

[0015] AATTCGCCACTCCTTTCTGTCTGCTAAGATATTCAAGAGATATCTTAGCAGACAGAAAGGAGTGGTTTTTTTTG.

[0016] The nucleotide sequence shown in SEQ ID NO:3 is as follows:

[0017] GATCCAAAAAACCACTCCTTTCTGTCTGCTAAGATATCTCTTGAATATCTTAGCAGACAGAAAGGAGTGGCG.

[0018] The nucleotide sequence of the SNTB1 gene is shown in SEQ ID NO:4.

[0019] The fourth embodiment of the present invention provides a pharmaceutical composition for preventing colorectal cancer transformation, which comprises an active substance that inhibits the SNTB1 gene or inhibits the expression of the SNTB1 gene.

[0020] A fifth embodiment of the present invention provides a kit for diagnosing colorectal cancer associated with enteritis and colorectal cancer, wherein the kit comprises a reagent for detecting the SNTB1 gene.

[0021] The sixth embodiment of the present invention provides a method for screening drugs for preventing or treating colorectal cancer associated with colorectal inflammation, comprising the following steps:

[0022] Providing cells expressing the SNTB1 gene;

[0023] contacting the drug to be screened with the cells;

[0024] Detecting the inhibitory effect of the drug to be screened on SNTB1 gene expression;

[0025] A target drug is selected according to the inhibitory effect results.

[0026] In a preferred embodiment, the cells expressing the SNTB1 gene include human colorectal cancer cell lines HCT-116 and LOVO.

[0027] In a further preferred embodiment, during the contact between the drug to be screened and the cells expressing the SNTB1 gene, an inflammatory cytokine or an activator of inflammation-related signaling pathways is also introduced. In this way, the pathological environment of CRC can be well simulated, the pathway can be activated, and the expression and regulation of the SNTB1 gene can be accelerated, thereby shortening the drug screening cycle, improving the screening efficiency, and the accuracy and reliability of the screening results. At the same time, the effects of the drugs on these pathways can be observed, thereby revealing the mechanism of action and target of the drugs, which helps to deeply understand the efficacy and safety of the drugs and provide a scientific basis for drug research and development.

[0028] Different from the prior art, the above technical scheme creatively reveals the key role of the SNTB1 gene in the transformation of colorectal cancer, provides a new perspective for the pathogenesis and molecular basis research of colorectal cancer, and helps to develop targeted treatment strategies or prevention methods. Secondly, using the SNTB1 gene as a biomarker, effective screening of high-risk groups for colorectal cancer transformation can be achieved, and the early diagnosis rate can be improved. In addition, the SNTB1 gene expression promoter provided by the present invention can construct an animal model of the whole process of colorectal cancer transformation, which provides a powerful tool for in-depth study of the pathogenesis and drug screening of colorectal cancer. At the same time, the prepared preventive pharmaceutical composition is expected to effectively prevent the transformation of colorectal cancer by inhibiting SNTB1 gene expression. Finally, the prevention or treatment of colorectal cancer-related drug screening method provided by the present invention introduces inflammatory cytokines or signaling pathway activators, simulates the CAC pathological environment, improves screening efficiency and accuracy, and provides a scientific basis for drug development.

[0029] The above-mentioned records related to the invention content are only an overview of the technical solution of the present application. In order to enable ordinary technicians in the field to more clearly understand the technical solution of the present application, and then implement it according to the text of the specification and the contents recorded in the drawings, and to make the above-mentioned purpose and other purposes, features and advantages of the present application easier to understand, the following is an explanation in combination with the specific implementation mode and drawings of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The accompanying drawings are only used to illustrate the principles, implementation methods, applications, features and effects of the specific implementation methods of the present application and other related contents, and cannot be considered as limiting the present application. In the accompanying drawings of the specification:

[0031] Figure 1 The effect of SNTB1 expression difference on the viability of colorectal cancer cells, A: HCT-116 cell viability statistics; B: LOVO cell viability statistics; compared with HCT-116 / NC group and LOVO / NC group, *P<0.05;

[0032] Figure 2 The effect of SNTB1 on colony formation of colorectal cancer cells by differential regulation of SNTB1 expression, including: A: HCT-116 and LOVO cell colony distribution; B: HCT-116 colony number analysis and statistical chart; C: LOVO cell colony number analysis and statistical chart. Compared with the NC group, *P<0.05;

[0033] Figure 3The effect of SNTB1 on the migration and invasion of colorectal cancer cells, including: A: Crystal violet staining of HCT-116 cell migration and invasion (200×); B: Crystal violet staining of LOVO cell migration and invasion; C: Statistical graph of HCT-116 cell migration; D: Statistical graph of LOVO cell migration; E: Statistical graph of HCT-116 cell invasion; F: Statistical graph of LOVO cell invasion; Compared with the NC group, *P<0.05;

[0034] Figure 4 The effect of SNTB1 expression difference on SNTB1 mRNA expression level in colorectal cancer cells, A: HCT-116 cells; B: LOVO cells; compared with NC group, *P<0.05;

[0035] Figure 5 The effect of overexpression of SNTB1 on the expression of SNTB1 protein in colorectal cancer cells, A: protein electrophoresis of HCT-116 and LOVO cells; B: gray value statistics of HCT-116 and LOVO cells, compared with the NC group, *P<0.05;

[0036] Figure 6 The effect of Babaodan BBD on the cell viability of colorectal cancer cells, A: HCT-116 cells; B: LOVO cells; compared with the NC group, *P<0.05; compared with the OE group, # P < 0.05;

[0037] Figure 7 The effect of Babaodan on the colony formation ability of colorectal cancer cells by regulating SNTB1, including A: crystal violet staining of HCT-116 and LOVO cell clones after sphere formation; B: statistical diagram of the number of HCT-116 cell clones; C: statistical diagram of the number of LOVO cell clones. Compared with the NC group, *P<0.05; compared with the OE group, # P < 0.05;

[0038] Figure 8 The effect of Babaodan on the migration and invasion of colorectal cancer cells mediated by SNTB1 (200×), where: A: Crystal violet staining of HCT116 and LOVO cell migration; B: Crystal violet staining of HCT116 and LOVO cell invasion;

[0039] Fig. 9The bar graphs show the effect of Babaodan on the migration and invasion of colorectal cancer cells mediated by SNTB1, among which, C: HCT116 cell migration number statistical graph; D: LOVO cell migration number statistical graph; E: HCT116 cell invasion number statistical graph; F: LOVO cell invasion number statistical graph; compared with the NC group, *P<0.05; compared with the OE group, # P < 0.05;

[0040] Fig.10 The effect of Babaodan on the scratch healing ability of HCT-116 and LOVO cells (×200), where: A: HCT-116 cell line; B: LOVO cell line; C: HCT-116 cell scratch healing rate statistics; D: LOVO cell scratch healing rate statistics. Compared with the NC group, *P<0.05; compared with the OE group, # P < 0.05;

[0041] Fig.11 The effect of BBD on the transcription level of SNTB1mRNA in colorectal cancer cells, A: HCT-116 cells; B: LOVO cells. Compared with the NC group, *P<0.05; compared with the OE group, # P < 0.05;

[0042] Fig.12 Effects of BBD on SNTB1 expression in colorectal cancer cells, A: protein electrophoresis of HCT116 cells; B: gray value statistics of SNTB1 in HCT116 cells; C: protein electrophoresis of LOVO cells; D: gray value statistics of SNTB1 in LOVO cells; compared with the NC group, *P<0.05; compared with the OE group, # P < 0.05;

[0043] Fig.13 This is a diagram of the AOM / DSS mouse model combined with adeno-associated virus modeling;

[0044] Fig.14 The effect of SNTB1 on the body weight of CAC mice, compared with the Control group, *P<0.05; compared with the Model group, ▽ P<0.05; compared with the Model / OE-NC group, # P<0.05; compared with Model / Sh-NC group, △ P < 0.05;

[0045] Fig.15 The effect of SNTB1 on fecal occult blood in CAC mice, compared with the Control group, *P<0.05; compared with the Model group ▽ P<0.05; compared with the Model / OE-NC group,# P<0.05; compared with Model / Sh-NC group, △ P < 0.05;

[0046] Fig.16 The effect of SNTB1 on the diarrhea index of CAC mice, compared with the Control group, *P<0.05; compared with the Model group ▽ P<0.05; compared with the Model / OE-NC group, # P<0.05; compared with Model / Sh-NC group, △ P < 0.05;

[0047] Fig.17 The effect of SNTB1 on the DAI index of CAC mice, compared with the Control group, *P<0.05; compared with the Model group ▽ P<0.05; compared with the Model / OE-NC group, # P<0.05; compared with Model / Sh-NC group, △ P < 0.05;

[0048] Fig.18 The effect of SNTB1 on the length of mouse colon tissue;

[0049] Fig.19 The effect of SNTB1 on the colon length and tumor number of mice: A: colon length; B: tumor number; compared with the Control group, *P<0.05; compared with the Model / OE-NC group, # P<0.05; compared with Model / Sh-NC group, △ P<0.05; compared with Model / OE group, ∞ P < 0.05;

[0050] Fig. 20 This is the result of in vivo imaging of mice;

[0051] Fig.21 Results for mouse frozen sections;

[0052] Fig. 22 The effect of SNTB1 on the positive expression of SNTB1 in colon tissue (400×), where A: SNTB1 immunohistochemistry; B: SNTB1 positive expression rate; compared with the Control group, *P<0.05; compared with the Model / OE group, ▽ P<0.05; compared with the Model / OE-NC group, # P<0.05; compared with Model / Sh-NC group, △ P < 0.05;

[0053] Fig.23 The effect of SNTB1 on the expression of SNTB1 mRNA in the colon tissue of mice, compared with the Control group, *P<0.05; compared with the Model / OE group, ▽ P<0.05; compared with the Model / OE-NC group, # P<0.05; compared with Model / Sh-NC group, △ P < 0.05;

[0054] Fig.24 The effect of SNTB1 on the expression of SNTB1 protein in the colon tissue of mice, compared with the Control group, *P<0.05; compared with the Model / OE group, ▽ P<0.05; compared with the Model / OE-NC group, # P<0.05; compared with Model / Sh-NC group, △ P < 0.05;

[0055] Fig.25 Build a diagram for the mouse CAC model;

[0056] Fig.26 The effect of Babaodan on the weight change of mice, compared with the Model group, ns, there was no statistical difference; compared with the Model+AAV-NC group, # P<0.05; compared with Model+AAV / NC+BBD group, △ P < 0.05;

[0057] Fig. 27 The effect of Babaodan on the fecal occult blood score of mice was compared with the Model group, ns, no statistical difference; compared with the Model+AAV-NC group, # P<0.05; compared with Model+AAV / NC+BBD group, △ P < 0.05;

[0058] Fig.28 The effect of Babaodan on diarrhea in mice, compared with the Model group, ns, there was no statistical difference; compared with the Model+AAV-NC group, # P<0.05; compared with Model+AAV / NC+BBD group, △ P < 0.05;

[0059] Fig.29 The effect of Babaodan on the DAI score of mice, compared with the Model group, ns had no statistical difference; compared with the Model+AAV-NC group, #P<0.05; compared with Model+AAV / NC+BBD group, △ P < 0.05;

[0060] Fig.30 The effect of Babaodan on the length of mouse colon tissue;

[0061] Fig.31 The effect of Babaodan on the length of the colon and the number of tumors in mice. Figure A: colon length; Figure B: number of tumors. Compared with the Model group, ns had no statistical difference; compared with the Model+AAV-NC group, # P<0.05; compared with Model+AAV / NC+BBD group, △ P < 0.05;

[0062] Fig.32 The effect of Babaodan on the colon histopathology of mice (100×, 200×);

[0063] Fig.33 The effect of Babaodan on the positive expression of SNTB1 in colon tissue (200×, 400×). Compared with the Model group, ns had no statistical difference; compared with the Model+AAV-NC group, # P<0.05; compared with Model+AAV / NC+BBD group, △ P < 0.05;

[0064] Fig.34 The effect of Babaodan on the expression of SNTB1mRNA in mouse colon tissue was compared with the Model group, ns had no statistical difference; compared with the Model+AAV-NC group, # P<0.05; compared with Model+AAV / NC+BBD group, △ P < 0.05;

[0065] Fig.35 The effect of Babaodan on the expression of SNTB1mRNA in mouse colon tissue was compared with the Model group, ns had no statistical difference; compared with the Model+AAV-NC group, # P<0.05; compared with Model+AAV / NC+BBD group, △ P < 0.05;

[0066] Fig.36 This is the pHBAAV-CMV-MCS-3flag-T2A-ZsGreen vector map;

[0067] Fig.37 This is the vector map of the interference vector pHBAAV-U6-MCS-CMV-EGFP. DETAILED DESCRIPTION

[0068] In order to explain in detail the possible application scenarios, technical principles, specific schemes that can be implemented, and the purposes and effects of the present application, the following is a detailed description in conjunction with the listed specific embodiments and the accompanying drawings. The embodiments described herein are only used to more clearly illustrate the technical solutions of the present application, and are therefore only used as examples, and the scope of protection of the present application cannot be limited by this. The reference to "embodiment" herein means that the specific features, structures or characteristics described in conjunction with the embodiment may be included in at least one embodiment of the present application. The term "embodiment" appearing in various positions in the specification does not necessarily refer to the same embodiment, nor does it particularly limit its independence or relevance to other embodiments. In principle, in the present application, as long as there is no technical contradiction or conflict, the various technical features mentioned in each embodiment can be combined in any way to form a corresponding implementable technical solution.

[0069] In the description of the present application, the term "and / or" is a statement used to describe the logical relationship between objects, indicating that three relationships may exist, for example, A and / or B, indicating: A exists, B exists, and A and B exist at the same time. In addition, the character " / " in this article generally indicates that the objects associated before and after are in an "or" logical relationship. Without further restrictions, in the present application, the terms "include", "comprise", "have" or other similar expressions used in the sentences are intended to cover non-exclusive inclusions, and these expressions do not exclude that other elements may also exist in the process, method or product including the elements, so that the process, method or product including a series of elements may include not only those limited elements, but also other elements not explicitly listed, or also include elements inherent to such process, method or product.

[0070] Similar to the understanding in the Examination Guidelines, in this application, expressions such as "greater than", "less than", "exceed" and the like are understood to exclude the number itself; expressions such as "above", "below", "within" and the like are understood to include the number itself. In addition, in the description of the embodiments of this application, "multiple" means more than two (including two), and similar expressions related to "multiple" are also understood in this way, such as "multiple groups", "multiple times", etc., unless otherwise clearly and specifically limited.

[0071] The mice used in the specific embodiment of the present invention are male Balb / c mice, grade: SPF grade, age: 4 weeks old, weight: 20-22g, purchased from Shanghai Slake Experimental Animal Co., Ltd. (License: SCXK (Shanghai) 2022-0016), and raised in the SPF-level laboratory of the Experimental Animal Center of Fujian University of Traditional Chinese Medicine. Experimental Animal Use License No.: SYXK (Min) 2019-0007 (valid from September 2020 to June 2023, Fujian Provincial Department of Science and Technology).

[0072] The human colorectal cancer cell lines HCT-116 and LOVO cells used in the specific embodiments of the present invention were purchased from Shanghai Life Science Research Center, and the cells were stored in a liquid nitrogen tank.

[0073] All operations and specifications of the specific embodiments of the present invention were carried out in strict accordance with international ethical standards and guidelines for the care and use of laboratory animals, and were approved by the Experimental Animal Ethics Management Committee of Fujian University of Traditional Chinese Medicine (approval number: FJTCM IACUC2022020).

[0074] The data obtained in the specific embodiment of the present invention were analyzed and processed using SPSS22.0 statistical software, and PrismGraphpad7.0 was used for drawing. All data were tested for normal distribution and homogeneity of variance. Those that met the normal distribution were expressed as (x±S), and the t test was used between the two groups; those that did not meet the normal distribution were tested using the nonparametric independent sample t test. P<0.05 indicated statistical significance.

[0075] The finished drug powder (batch number: 180901) of Babaodan (National Medicine Standard Z10940006) used in the specific embodiment of the present invention was provided free of charge by Xiamen Traditional Chinese Medicine Factory in the form of scientific research cooperation.

[0076] The medicines, consumables, instruments and reagents used in the specific embodiments of the present invention are listed in Table 1 and Table 2. Other medicines, consumables, instruments and reagents are conventional products in the field unless otherwise specified.

[0077] Table 1 Drugs, consumables and reagents used in specific embodiments of the present invention

[0078]

[0079]

[0080] Table 2 Instruments and equipment used in the specific embodiments of the present invention

[0081]

[0082]

[0083] Example 1 In vitro cell culture

[0084] 1. The HCT-116 and LOVO colorectal cancer cells were cultured in vitro by cell grouping, and stable colorectal cancer cell lines were constructed by SNTB1 lentivirus infection and puromycin screening, and the two cell lines were divided into HCT-116 / NC group, HCT-116 / OE group, LOVO / NC group, and LOVO / OE group. Among them, the HCT-116 / NC group refers to HCT-116 colorectal cancer cells without special treatment, and the HCT-116 / OE group refers to HCT-116 colorectal cancer cell lines infected with SNTB1 lentivirus and screened with puromycin and overexpressed the SNTB1 gene; the LOVO / NC group refers to LOVO colorectal cancer cells without special treatment, and the LOVO / OE group refers to LOVO colorectal cancer cell lines infected with SNTB1 lentivirus and screened with puromycin and overexpressed the SNTB1 gene.

[0085] 2 Cell culture and cell plating The HCT-116 / NC and HCT-116 / OE cells that were successfully cultured after transfection were cultured in DMEM medium containing 10% FBS and placed in a cell culture incubator at 37°C and 5% CO2. When the cell confluence reached 80% to 90% and the cells were in exponential growth phase, the medium was discarded, and the cells were washed once with an appropriate amount of PBS. Then 0.25% trypsin was added to digest the cells. Under the microscope, the cell morphology became round. Complete medium with twice the amount of trypsin was added to end the digestion, and then the cells were transferred to a centrifuge tube and centrifuged in a low-speed centrifuge (1000 rpm, 3min). After centrifugation, the supernatant was discarded and resuspended with an appropriate amount of complete medium. The cells were mixed evenly, counted, and plated (the number of cells for passage and plated was based on experimental needs).

[0086] 3 Construction of SNTB1 overexpressing colorectal cancer cell line

[0087] (1) SNTB1 lentiviral infection: After repeated mixing, the above reagents were added to HCT-116 and LOVO cells (about 1 mL / well). After continued culture for 8 h, the culture medium was replaced with complete medium. HCT-116 cells were cultured at 0.4×10 5 / mL density was inoculated in a 6-well plate, and lentivirus infection was performed when the cell confluence reached 30%. The multiplicity of infection (MOI) was calculated as 10, and the infection reagents were prepared: DMEM complete medium: 960μL, HitransGP infection enhancement solution (25x): 40μL, lentivirus (108 / μL): 5μL. When the infection efficiency observed under a fluorescence microscope reached more than 70% and the cell density reached 80%, the cells could be passaged (about 72h).

[0088] (2) Puromycin screening: HCT-116 cells infected with lentivirus were first inoculated into 24-well plates (0.5 mL / well) at 1.0×105 / mL. After the cells adhered to the wall, puromycin (0-12 μg / mL) was given for intervention and culture was continued for 48 h. Cell morphology and density changes were observed under an inverted microscope, and the appropriate puromycin concentration was selected for subsequent experiments. After puromycin screening twice, a 1 / 20 puromycin screening concentration was used to maintain the cultured cells. After HCT-116 and LOVO cells were transfected with SNTB136h in 96-well plates (100 μL / well), the culture medium was discarded, and a 10% MTT solution (i.e., 1 mL MTT stock solution plus 9 mL diluent) was prepared and added to a 96-well plate (100 μL / well, 3 replicates per group). After continuing to culture for 2 h, the absorbance at 450 nm was measured using an ELISA reader.

[0089] Cell viability calculation formula: Cell viability (%) = OD value of experimental group / OD value of control group × 100%

[0090] 4 Colony formation assay HCT-116 and LOVO cells were cultured in DMEM medium containing 10% FBS at 37°C, saturated humidity, and 5% CO2. 5 The density of cells / mL is 5×10 2 Each well was inoculated into a 12-well plate and continued to be cultured (fresh complete medium was replaced every two days for a total of 7 days). When the cells grew to the point where cell clusters could be seen with the naked eye, they were washed three times with PBS (1 mL / well), fixed with paraformaldehyde (1 mL / well) for 20 min, stained with crystal violet for 20 min, and finally photographed with a digital camera.

[0091] 5 Migration experiment The cells of HCT-116 / NC group, HCT-116 / OE group, LOVO / NC group, and LOVO / OE group were taken for migration experiment. After 36 h of cell culture, the culture medium was discarded, the cells were digested and resuspended in blank culture medium (without FBS) and the culture medium was adjusted to 2.5×10 5 The density of cells / ml was set. 0.2mL of cell suspension was added to each upper chamber of Transwell, and 0.7mL of complete culture medium was added to the lower chamber. Place it in a 37°C, 5% CO2 incubator, and take it out after 24 hours to observe the falling of cells in the lower chamber. When some intestinal cancer cells can be seen falling in the complete culture medium in the lower chamber of the migration plate under a microscope, fixation and staining can be started. The upper and lower chambers were fixed with 0.2mL and 0.7mL of 4% paraformaldehyde for 15-20min, respectively, and then the upper and lower chambers were stained with 0.2mL and 0.7mL of crystal violet solution for 15min, respectively. The cells in the upper chamber were wiped off with a cotton swab, and the photos were taken with an inverted microscope (200×) after drying the next day.

[0092] 6 Invasion assay The cells of HCT-116 / NC group, HCT-116 / OE group, LOVO / NC group, and LOVO / OE group were taken for invasion assay. After 36 h of cell culture, the culture medium was discarded, the cells were digested and resuspended in blank culture medium (without FBS) and the culture medium was adjusted to 2.5×10 5 The density of cells / ml was set. 0.2 mL of cell suspension was added to each upper chamber of the Transwell and 0.7 mL of complete medium was added to the lower chamber. The plates were placed in a 37°C, 5% CO2 incubator. After 24 hours, the plates were taken out to observe the cells falling off the lower chamber. When some intestinal cancer cells were seen falling off the complete medium in the lower chamber of the migration plate under a microscope, fixation and staining could be started. The steps were the same as those in 5 migration experiments.

[0093] 7RT-qPCR experiments were used to detect whether overexpression of SNTB1 could promote the upregulation of SNTB1 mRNA expression in colorectal cancer cells, and to clarify the impact of differential expression of SNTB1 on the transcription level in colorectal cancer cells.

[0094] 7.1 Extraction of total RNA from cells (1) Remove cells in the logarithmic growth phase from the incubator, discard the cell culture medium, wash with PBS, add 3 mL of Trizol solution to the T75 cell culture flask, wait for 1-2 minutes, and when the adherent cells fall off, transfer the cell suspension to a 5 mL centrifuge tube, place on ice, and mark it. Then perform the following operations: Transfer the Trizol suspension containing cells to a 5 mL centrifuge tube, and take 1 mL of the suspension for subsequent RT-qPCR experiments. Add 0.2 mL of chloroform to the 1 mL suspension, then cover the centrifuge tube tightly and oscillate for 15 seconds, and let it stand at room temperature for 5-10 minutes. After standing, centrifuge in a 4°C low-temperature centrifuge at 12,000 rpm for 20 minutes. (2) After centrifugation, the centrifuge tube is separated into three layers. Carefully remove the upper layer of liquid (about 0.3 mL) and place it in another RNase-free centrifuge tube. Add an equal volume of isopropanol, gently mix up and down, and let it stand at room temperature for 10-30 minutes to allow the RNA to be fully precipitated. After centrifugation again (4°C, 12,000 rpm, 10 min), carefully discard the supernatant. The white precipitate at the bottom is RNA. (3) Add 1 mL of 75% pre-cooled anhydrous ethanol to each tube, gently invert upside down, and rinse the RNA precipitate to remove residual isopropanol. (4) Centrifuge (4°C, 10,000 rpm, 10 min), carefully discard the supernatant, and place the precipitate to dry naturally at room temperature. After the white precipitate becomes transparent, add an appropriate amount of DEPC water to dissolve it.

[0095] 7.2 Determination of total RNA concentration in cells The RNA concentration was determined using Nanodrop 2000 software. The absorption wavelength was selected as 260nm, where RNA has the maximum absorption peak. When the ratio of the OD value read at a wavelength of 260nm / 280nm is usually around 2.0, the RNA has a high purity. Generally, the ratio is best when it is 1.8-2.0. (1) Construct a 10μL reaction system with a total RNA mass of 1000ng. According to the experimental instructions, dissolve each reagent on ice, shake and centrifuge. DNA removal reaction, after centrifugation, use a PCR instrument at 42℃ for 2min, and place on ice after the reaction. (2) RNA reverse transcription reaction (reaction system see Table 3), after centrifugation, use a PCR instrument at 37℃ for 15min, 85℃ for 5s, after the reaction, centrifuge and store the cDNA in a -80℃ ultra-low temperature refrigerator. (3) PCR amplification Dilute the above cDNA sample 10 times in advance; prepare the amplification reaction system (see Table 4).

[0096] Table 3 Reverse transcription reaction system

[0097]

[0098] Table 4 Reaction system

[0099]

[0100] A two-step method was used for amplification, and the reaction conditions are shown in Table 5.

[0101] Table 5 Reaction system

[0102]

[0103]

[0104] (4) GAPDH was used as an internal reference, and the relative expression level of the target gene in the colon tissue of each group was detected by calculation using the formula 2-△△Ct according to the CT value of each group.

[0105] Calculation formula: △CT = CT target gene - CT internal reference gene; △△CT = △CT treated sample - △CT control sample; relative expression level of gene = 2-△△CT.

[0106] 7.3 Primer sequences The primer sequences of SNTB1 and the internal reference gene GAPDH are shown in Table 6.

[0107] Table 6 Primer sequences of SNTB1 and internal reference gene GAPDH

[0108]

[0109] 8Western Blot Experiment

[0110] 8.1 Protein collection: HCT-116 / NC, HCT-116 / OE, LOVO / NC, and LOVO / OE cells in the logarithmic growth phase were collected and plated at 1.0×10 5 The density of cells / mL was inoculated in a 6-well plate (2mL / well) with 3 replicates per group. The culture conditions were 37°C, 5% CO2, and saturated humidity. The cells were treated with Babaodan solution in the logarithmic growth phase. After 24 hours of drug intervention, they were washed 3 times with pre-cooled PBS and the PBS residue was completely absorbed. After adding an appropriate amount of cell lysis solution to each well on ice, the cells were scraped off with a clean cell scraper and moved to a 1.5mL centrifuge tube. Mark it and shake it every 5 minutes for a total of 3 times. Finally, the centrifuge tube was placed in a low-temperature centrifuge (4°C, 14000 rpm, 20min) and centrifuged to obtain the supernatant, which was the protein sample.

[0111] 8.2 Determination of protein concentration by BCA method (1) Detect the concentration of protein samples according to the instructions of the kit, use an enzyme reader to measure the OD value at 562nm, draw a protein concentration standard curve according to the corresponding OD value, and add an appropriate amount of protein lysate to the sample based on the results of the determined protein concentration to make the concentration of all protein samples consistent. (2) Denaturation of protein samples: Add 1 / 4 of the corresponding volume of loading buffer to each tube of protein, heat and denature in a 100℃ metal bath for 8 minutes, divide into 1.5mL centrifuge tubes and store in a -80℃ ultra-low temperature refrigerator to avoid repeated freezing and thawing. (3) Take out the denatured protein sample from the -80℃ ultra-low temperature refrigerator, centrifuge and shake after the protein melts, and then load the sample in sequence according to the experiment. Transfer, blocking, antibody incubation, development and data analysis are as follows: Use SDS-PAGE gel system, pre-use 80V electrophoresis for 30 minutes, then use 95V electrophoresis until the separation degree of the protein marker to be labeled meets the corresponding molecular weight of the target protein, and stop electrophoresis. Transfer the membrane at 100V for 2 hours under ice bath conditions. Incubate the target protein with primary antibody and shake it in a 4°C cold storage overnight. The obtained PVDF target membrane was washed with 1xTBST solution (2 times, 8 min / time) and then blocked with TBST containing 5% skim milk powder for 1-2 hours. Recover the incubated primary antibody, then wash the membrane with 1xTBST solution (3 times, 10 min / time) and incubate the corresponding secondary antibody at room temperature for 1-2 hours. Wash the membrane with 1xTBST solution (3 times, 10 min / time), and evenly add ECL developer (A solution: B solution = 1:1) on the PVDF membrane. The protein index was imaged by the Bio-Rad imaging system. Finally, the obtained protein data was analyzed and sorted using ImageJ software.

[0112] See also Figure 1The MTT test results showed that the cell viability of HCT-116 / OE group was significantly higher than that of HCT-116 / NC group (P<0.05), with the viability of the two groups being (120±1.96)% and (100±1.06)% respectively; the cell viability of LOVO / OE group was significantly higher than that of LOVO / NC group (P<0.05), with the viability of the two groups being (115.58±0.88)% and (100±1.34)% respectively. These results indicate that SNTB1 has a regulatory effect on the viability of colorectal cancer cells.

[0113] See also Figure 2 The results of colony formation experiments to explore the effect of SNTB1 expression differences on the proliferation of colorectal cancer cells showed that the total number of cell colonies in the HCT-116 / NC group was (200±7.34), while the total number of cell colonies in the HCT-116 / OE group was (512±6.05), and the differences were statistically significant (P<0.05); the total number of LOVO / NC cell colonies was (189±7.36), and the total number of LOVO / OE cell colonies was (423±5.13), and the difference between the two groups was statistically significant (P<0.05). This result shows that differential expression of SNTB1 can affect the colony formation ability of colorectal cancer cells, and overexpression of the SNTB1 gene can enhance the proliferation ability of colorectal cancer cells.

[0114] See also Figure 3 The migration experiment shown detected the effect of overexpression of SNTB1 on the migration and invasion ability of HCT-116 cells and LOVO cells. The results showed that the number of migrating cells in the HCT-116 / NC group was significantly less than that in the HCT-116 / OE group (P<0.05), and the migration rates of the two groups were (100±2.21)% and (189±6.58)%, respectively. The number of migrating cells in the LOVO / OE group was significantly higher than that in the LOVO / NC group (P<0.05), and the migration rates of the two groups were (155±3.23%) and (102±2.31%)%, respectively. The results of invasion experiments showed that the number of invasion cells in the HCT-116 / NC group was significantly less than that in the HCT-116 / OE group (P<0.05), and the invasion rates of the two groups were (104±3.28%)% and (203±6.34%)%, respectively; the number of invasion cells in the LOVO / OE group was significantly higher than that in the LOVO / NC group (P<0.05), and the invasion rates of the two groups were (152±8.46%)% and (100±2.25%)%, respectively. The results of Transwell and Invasion experiments showed that SNTB1 has a regulatory effect on the migration and invasion function of colorectal cancer cells, and overexpression of SNTB1 will promote the migration and invasion ability of colorectal cancer cells.

[0115] See also Figure 4The results of the study showed that the differential expression of SNTB1 affected the transcription level in colorectal cancer cells: Compared with the HCT-116 / NC group, the expression level of SNTB1 mRNA in the HCT-116 / OE group was significantly increased, with statistical significance (P<0.05). Compared with the LOVO / NC group, the expression level of SNTB1 mRNA in the LOVO / OE group was upregulated (P<0.05). This result showed that we successfully constructed a stable colorectal cancer cell line overexpressing SNTB1, and also showed that overexpression of SNTB1 can enhance the expression level of SNTB1 mRNA in colorectal cancer cells.

[0116] See also Figure 5 The results of WB experiments shown in the figure detected the effect of overexpression of SNTB1 on SNTB1 protein expression in HCT-116 cells and LOVO cells: the expression level of SNTB1 protein in HCT-116 / OE and LOVO / OE groups was significantly upregulated (P<0.05).

[0117] From the above experimental results, it can be seen that overexpression of SNTB1 can increase the vitality and colony formation ability of colorectal cancer cells, while promoting the migration and invasion of colorectal cancer cells, and increasing the content of SNTB1 mRNA and SNTB1 protein expression in colorectal cancer cells. Therefore, the SNTB1 gene may be a potential core target in the occurrence and development of colorectal cancer.

[0118] Example 2 Effect of BBD on SNTB1 Colorectal Cancer Stable Cell Model (This approach can be used to screen drugs for preventing or treating colorectal cancer associated with colorectal inflammation)

[0119] 1.1 Preparation of complete cell culture medium (Table 7)

[0120] Table 7 Complete medium preparation

[0121]

[0122] 1.2 Preparation of protein lysis buffer (Table 8)

[0123] Table 8 Preparation of protein lysate

[0124]

[0125] 1.31× Transfer Buffer Preparation (Table 9)

[0126] Table 91× Transfer Solution Preparation

[0127]

[0128] 1. Preparation of 410× TBS solution (Table 10)

[0129] Table 10 10×TBS solution preparation

[0130]

[0131] 1.5 Preparation of 1×TBST solution (Table 11)

[0132] Table 1 1×TBST solution preparation

[0133]

[0134]

[0135] 1.6 Preparation of 5× electrophoresis buffer (Table 12)

[0136] Table 12 Preparation of 5× electrophoresis solution

[0137]

[0138] 1.7 Preparation method of Babaodan BBD reagent

[0139] Use an electronic balance to weigh 125 mg of Babaodan powder into a 7 mL centrifuge tube, add 5 mL of sterile PBS to prepare a solution with a concentration of 25 mg / mL, seal the tube with a sealing film, sonicate for 2 h to assist dissolution, filter and sterilize, and place in a 4 °C refrigerator for standby use to prepare a solution with a concentration of 25 mg / mL for subsequent cell experiments.

[0140] 1.8 Grouping of cells cultured in vitro HCT-116 and LOVO colorectal cancer stable cell lines were cultured in vitro, and after intervention with Babaodan, the two cell lines were divided into HCT-116 / NC group (HCT116 cells without special treatment), HCT-116 / OE group (HCT116 cells infected with SNTB1 lentivirus and overexpressed SNTB1 after puromycin selection), HCT-116 / NC+BBD group (HCT116 cells without special treatment and intervened with Babaodan), and HCT-116 / OE+BBD group (HCT116 cells overexpressing SNTB1 and intervened with Babaodan); LOVO / NC group (LOVO cells without special treatment), LOVO / OE group (LOVO cells overexpressing SNTB1), LOVO / NC+BBD group (LOVO cells without special treatment and intervened with Babaodan), and LOVO / OE+BBD group (LOVO cells overexpressing SNTB1 and intervened with Babaodan).

[0141] 1.9 MTT experiment HCT-116 and LOVO cells were transfected with SNTB136h in 96-well plates (100μL / well), the culture medium was discarded, 10% MTT solution (i.e. 1mL MTT stock solution plus 9mL diluent) was prepared, added to 96-well plates (100μL / well, 3 replicates per group), and cultured for 2h, and the absorbance at 490nm was measured with an enzyme marker. Cell viability calculation formula: Cell viability (%) = OD value of experimental group / OD value of control group × 100%

[0142] 2.0 Colony formation assay

[0143] HCT-116 / NC, HCT-116 / SNTB1, LOVO / NC, LOVO / SNTB1 cells in logarithmic growth phase were collected and 5×10 5 The cells were inoculated at 1,000 cells / well in a 6-well plate and cultured overnight in a constant temperature incubator at 37°C and 5% CO2 saturated humidity. When the cell confluence reached 50-60%, different concentrations of BBD solution were added for 24 hours, and the cells were digested, neutralized, centrifuged, resuspended, and counted again. 1,000 cells were inoculated in six-well plates respectively, and the medium was changed every 2-3 days. After continuous culture for 7-10 days, when visible clones appeared in the wells of the culture plate, the culture was stopped, the supernatant was discarded, and the plates were washed 2-3 times with PBS. The cells were fixed with 4% paraformaldehyde for 10 min, and then washed with PBS for 2 to 3 times after discarding the 4% paraformaldehyde. The cells were stained with crystal violet staining solution for 20 min, and the staining solution was removed. The cells were washed with PBS for 3 times, and photographed to observe the colony formation in the HCT-116 / NC group, HCT-116 / OE group, HCT-116 / NC+BBD group, HCT-116 / OE+BBD group; LOVO / NC group, LOVO / OE group, LOVO / NC+BBD group, and LOVO / OE+BBD group.

[0144] 2.1 Migration and invasion assays

[0145] HCT-116 / NC, HCT-116 / OE and LOVO / NC, LOVO / OE cells were cultured in DMEM medium containing 10% FBS, and the conditions were set at 37°C with saturated humidity and 5% CO2. After the cells were cultured for 36 hours, the medium was discarded, and the cells were digested and resuspended in blank medium (without FBS). 200 μL of cell suspension containing or without BBD was added to the upper chamber of the Transwell chamber, and 2.5x10 5cells, and add 0.7mL complete medium to the lower chamber. Put it in a 37°C, 5% CO2 incubator, take it out after 24 hours to observe the falling of cells in the lower chamber. When some intestinal cancer cells can be seen falling under the microscope in the complete medium in the lower chamber of the migration plate, fixation and staining can be started. The upper and lower chambers are fixed with 0.2mL and 0.7mL 4% paraformaldehyde for 15-20min respectively, and then the upper and lower chambers are stained with 0.2mL and 0.7mL crystal violet solution for 15min respectively. Wipe the cells in the upper chamber with a cotton swab, dry it the next day, and take pictures with an inverted microscope (200×). The scratch experiment is the same as the migration experiment in Example 1; the RT-qPCR experiment is the same as the RT-qPCR experiment in Example 1.

[0146] 2.2 Western Blot Experiment

[0147] Take out the denatured protein sample from the -80℃ ultra-low temperature refrigerator, after the protein melts, centrifuge and shake, and then load the sample in sequence according to the experiment. Electrophoresis: Use the SDS-PAGE gel system, pre-use 80V electrophoresis for 30min, then use 95V electrophoresis until the separation degree of the protein Marker to be labeled meets the corresponding molecular weight of the target protein, and stop electrophoresis. Transfer: Use 100V to transfer for 2h under ice bath conditions. Blocking: Wash the obtained PVDF target membrane with 1×TBST solution (2 times, 8min / time) and then use 5% skim milk powder containing TBST to block for 1-2h. Incubate the primary antibody: Incubate the target protein primary antibody in a 4℃ cold storage shaker overnight (SNTB1, dilution multiple 1:1000; GAPDH dilution multiple 1:1000). Incubate the secondary antibody: Recover the primary antibody, then wash the membrane with 1×TBST solution (3 times, 10 min / time), and incubate the corresponding secondary antibody at room temperature for 1-2 hours (the dilution ratio is 1:5000). Development: Wash the membrane with 1×TBST solution (3 times, 10 min / time), evenly add ECL developer (A solution: B solution = 1:1) on the PVDF membrane, and image the protein indicators using the Bio-Rad imaging system. Data analysis: Finally, use ImageJ software to analyze and organize the obtained protein data.

[0148] Effect of 2.3BBD on SNTB1-mediated colorectal cancer cell viability

[0149] The results of MTT experiment on the effect of BBD on the viability of SNTB1-mediated colorectal cancer cell HCT-116 and LOVO cells are shown in Figure 6As shown in the results, the cell viability of HCT-116 / OE group was significantly higher than that of HCT-116 / NC and HCT-116 / NC+BBD groups (P<0.05), and the cell viability of HCT-116 / OE group was higher than that of HCT-116 / OE+BBD group (P<0.05); meanwhile, the cell viability of HCT-116 / NC group was also higher than that of HCT-116 / NC+BBD group (P<0.05). The cell viability of LOVO / OE group was significantly higher than that of LOVO / NC group and LOVO / NC+BBD group (P<0.05), and the cell viability of LOVO / OE group was higher than that of LOVO / OE+BBD group (P<0.05), and the cell viability of LOVO / NC group was also higher than that of LOVO / NC+BBD group (P<0.05); indicating that SNTB1 may be a key target in the process of colorectal cancer occurrence, and Babaodan BBD has a significant inhibitory effect on the viability of colorectal cancer cells mediated by SNTB1.

[0150] 2.4 Effect of BBD on SNTB1-mediated colony formation of colorectal cancer cells

[0151] Colony formation experiments were used to investigate the effect of Babaodan on the proliferation of colorectal cancer HCT-116 and LOVO cells. Figure 7 As shown. The total number of HCT-116 cell colonies in the NC group was (213±5.89), and the total number of LOVO cell colonies was (205±2.86); the total number of HCT-116 cell colonies in the OE group was (489±4.51), and the total number of LOVO cell colonies was (398±6.32), and the differences were statistically significant (P<0.05). After BBD intervention, the total number of cell colonies in the HCT-116 / NC+BBD group was (186±3.57), and the total number of cell colonies in the LOVO / NC+BBD group was (102±5.78); the total number of cell colonies in the HCT-116 / OE+BBD group was (301±3.62), and the total number of cell colonies in the LOVO / OE+BBD group was (102±5.78), and the differences were statistically significant (P<0.05). This result indicates that Babaodan has the ability to inhibit the colony formation of colorectal cancer cells.

[0152] Effects of 2.5BBD on SNTB1-mediated migration and invasion of colorectal cancer cells

[0153] Migration experiment results ( Figure 8 , Fig. 9) showed that compared with the HCT-116 / NC group, the number of cells in the HCT-116 / OE group that migrated to the outside of the cell was significantly higher than that in the HCT-116 / NC group, and the migration rate reached (200±3.65%), which was statistically significant (P<0.05); and compared with the HCT-116 / NC group, Babaodan intervention could significantly reduce the number of cells that migrated to the outside of the cell, and the migration rate of the HCT-116 / NC+BBD group was (49±5.23%) (P<0.05). Compared with the HCT-116 / OE group, the migration of the HCT-116 / OE+BBD group was significantly reduced, and the migration rate was (138±8.26%) (P<0.05), indicating that Babaodan can inhibit the migration ability of HCT-116 cells. The number of cells in the LOVO / OE group that migrated to the outside of the chamber was significantly higher than that in the LOVO / NC group, and the migration rate reached (198±6.12%), which was statistically significant compared with the LOVO / NC group (P<0.05); at the same time, compared with LOVO / NC, the migration ability of cells in the LOVO / NC+BBD group was reduced (50±6.71) (P<0.05). Compared with the LOVO / OE group, the number of migration cells in the LOVO / OE+BBD group was significantly reduced (130±5.15%) (P<0.05). The above results indicate that Babaodan has a significant inhibitory effect on the migration ability of colorectal cancer cells mediated by SNTB1.

[0154] The results of the invasion experiment showed that compared with the HCT-116 / NC group, the invasion rate of the HCT-116 / OE group reached (210±8.25%) (P<0.05). After the intervention of Babaodan, the invasion of the HCT-116 / NC+BBD group was significantly reduced (P<0.05), and its invasion rate was (65±5.12%); compared with the HCT-116 / OE group, the invasion rate of the HCT-116 / OE+BBD group was (125±6.34%), and the difference was statistically significant (P<0.05).

[0155] Effect of 2.6BBD on SNTB1-mediated scratch healing ability of colorectal cancer cells

[0156] The results of the scratch experiment showed that the scratch healing speed of colorectal cancer cells in the HCT116 / OE and LOVO / OE groups was faster. After the cells were intervened by Babaodan for 6h, 12h, and 48h, the scratch healing ability of the cells was inhibited, and the scratch healing rate gradually decreased with the passage of time. The scratch healing rates of the Babaodan group at 6h, 12h, and 48h were significantly different (P < 0.05). Fig.10 .

[0157] Effect of 2.7BBD on SNTB1 mRNA expression in colorectal cancer cells

[0158] To further clarify the pharmacodynamic mechanism of Babaodan, we used RT-qPCR to detect whether Babaodan regulates the expression of SNTB1 mRNA in SNTB1 colorectal cancer cells. Fig.11 The results showed that compared with the HCT-116 / NC group, the SNTB1 mRNA expression level in the HCT-116 / NC+BBD group was significantly decreased, while the SNTB1 mRNA expression level in the HCT-116 / SNTB1 group was significantly increased (P<0.05). Compared with the HCT-116 / NC+BBD group, the SNTB1 mRNA expression level in the HCT-116 / SNTB1+BBD group was decreased, and the difference was statistically significant (P<0.05). Similarly, compared with the LOVO / NC group, the SNTB1 mRNA expression level in the LOVO / NC+BBD group was downregulated, while the SNTB1 mRNA expression level in the LOVO / OE group was significantly increased (P<0.05). Compared with the LOVO / NC+BBD group, the SNTB1 mRNA expression level in the LOVO / OE+BBD group was decreased (P<0.05). This further proves that the intervention of Babaodan can regulate the expression of the SNTB1 gene and reduce the SNTB1 transcription level in colorectal cancer cells.

[0159] Effect of 3.6BBD on SNTB1 expression in HCT-116 and LOVO colorectal cancer cells

[0160] To detect the effect of Babaodan on SNTB1 protein expression in colorectal cancer cells, Western Blot method was used for further verification. Fig.12 As shown in the results, compared with the HCT-116 / NC group, the protein expression level of SNTB1 in the HCT-116 / OE group was significantly increased (P<0.05). Compared with the HCT-116 / OE group, the protein expression level of SNTB1 in the HCT-116 / OE+BBD group was significantly decreased (P<0.05). Compared with the LOVO / NC group, the protein expression level of SNTB1 in the LOVO / OE group was significantly increased (P<0.05). Compared with the LOVO / OE group, the protein expression level of SNTB1 in the LOVO / OE+BBD group was significantly decreased (P<0.05). The above results indicate that Babaodan can significantly inhibit the increase of SNTB1 protein expression in colorectal cancer cells (P<0.05).

[0161] From the above results, it can be seen that Babaodan can significantly inhibit the proliferation of colorectal cancer cells overexpressing SNTB1 and reduce the migration, invasion and other metastatic abilities of tumor cells. At the same time, it can also downregulate the mRNA and protein expression levels of the SNTB gene in colorectal cancer cells (P<0.05). This shows that Babaodan contains active substances that inhibit the SNTB1 gene or inhibit the expression of the SNTB1 gene, thereby playing an important role in inhibiting the proliferation and metastasis of colorectal cancer cells.

[0162] By adopting the same method as in Example 2, the inhibitory effect of the drug to be tested on the vitality, colony formation ability, migration and invasion ability, scratch healing ability, SNTB1 mRNA expression and SNTB1 expression of colorectal cancer cells is measured. Inflammatory cytokines or inflammatory-related signaling pathway activators can also be introduced during the measurement process. According to the measurement results, the drug with the strongest comprehensive performance of the above-mentioned inhibitory results is selected as the target drug.

[0163] Example 3 Effect of SNTB1 on the Growth Status of CAC Mice

[0164] (I) Preparation method of experimental reagents

[0165] 1.1 Preparation of AOM solution The specification of AOM is 25 mg / bottle, and the intraperitoneal injection dose is 12.5 mg / kg. In this example, the intraperitoneal injection volume for mice is 100 μL / 10 g. Under light-proof conditions, add 20 mL of sterile saline to prepare a solution with a concentration of 1.25 mg / mL, mix thoroughly, and use it immediately after preparation.

[0166] 1.2 Animal grouping The laboratory environment was kept at a constant temperature and humidity, with light exposure for 12 hours a day, and mice were given normal feeding and drinking water. The mice were fed for 7 days in advance to adapt to the environment, and then randomly divided into 5 groups: Control group, Model group, Model / OE-NC group, Model / OE group, Model / Sh-NC group, and Model / Sh group. The animal procedures in this example were carried out in strict accordance with international ethical guidelines and guidelines for the care and use of laboratory animals, and were approved by the Animal Experiment Ethics Committee of Fujian University of Traditional Chinese Medicine. (Approval number: FJTCMIACUC2022020).

[0167] 1.3 Construction of CAC model and drug administration method

[0168] After the first round of DSS drinking water was stopped, mice in the Model / OE-NC group, Model / OE group, Model / Sh-NC group, and Model / Sh group showed obvious weight loss, fecal occult blood and diarrhea, and colitis was judged at this time. The specification of AOM is 25 mg / bottle, the intraperitoneal injection dose is 12.5 mg / kg, and the intraperitoneal injection volume of mice in this embodiment is 100 μL / 10g. Under light-proof conditions, 20 mL of sterile saline is added to prepare a solution with a concentration of 1.25 mg / mL, and it is fully mixed and used immediately. Seven days after AOM injection, sterile DSS drinking water was prepared under light-proof conditions. Mice in the Model / OE-NC group and the Model / Sh-NC group were intraperitoneally injected with 100 μL / mouse of SNTB1 overexpression empty adeno-associated virus and knockdown empty adeno-associated virus; mice in the Model / OE group and the Model / Sh group were injected with 100 μL / mouse of overexpression adeno-associated virus and knockdown adeno-associated virus, respectively. The virus expression peaked on the 21st day. In this example, we used three rounds of AAV injection to ensure the whole process of AAV infection of AOM / DSS mice with enteritis-related intestinal cancer. For details, please refer to Fig.13 .

[0169] 1.4 Disease monitoring of mice

[0170] During the experiment, the living conditions of the mice (fur sheen, activity status, diet, etc.) were observed every 3 days. The mice were placed in a clean 1000mL plastic beaker. When the mice produced feces, the feces were quickly collected to observe the hardness of the feces to evaluate the diarrhea of ​​the mice and the fecal blood score was measured using the Beso fecal occult blood test paper. Finally, the weight was measured. The formula for calculating the percentage of weight loss is: (this weighing - last weighing) / last weighing × 100%

[0171] For fecal occult blood evaluation, place the stool on the Beso fecal occult blood test paper, add the reagent according to the instructions and time it at the same time, and record the time when the test paper turns purple.

[0172] Diarrhea evaluation: feces were placed on dry filter paper and the diameter of the stain formed on the paper was used for evaluation. Disease Activity Index (DAI) calculation method: DAI = weight loss score + fecal occult blood score + diarrhea index score (as shown in Table 13).

[0173] Table 13 Evaluation criteria for animal weight, fecal occult blood, and diarrhea indicators

[0174]

[0175] 1.5 In vivo imaging of small animals

[0176] Two weeks after the Balb / c mice were intraperitoneally injected with AAV adenovirus, they were removed from the IVC cage, placed in a transparent anesthesia tank with a lid, and given gas anesthetic (concentration of 1.5%-3%; dose of 80 mg / kg body weight) for about 5 to 10 minutes. The expression of fluorescence at the colon injection site was observed under a live imaging system.

[0177] 1.6 Frozen sections

[0178] Place the colon tissue block flat in a disposable frozen section box (about 2 cm in diameter), add an appropriate amount of OCT embedding agent to immerse the tissue, and slowly place the disposable frozen section box flat on dry ice. When the bottom of the box contacts liquid nitrogen, it begins to vaporize and boil. At this time, the small box should remain in place and not be immersed in liquid nitrogen. The tissue will quickly freeze into blocks in about 10-20 seconds. After the frozen block is made, it can be placed in a constant temperature box slicer for frozen sectioning (if it needs to be preserved, it should be quickly wrapped with aluminum foil or plastic film and immediately placed in a -80℃ refrigerator for storage). When slicing, the low temperature room temperature should be -15℃ to -20℃. If the temperature is too low, the tissue is easy to break. The position and angle of the anti-roll plate should be appropriate. The slide is attached to the tissue section and should not be moved up and down. Clamp it in the fixed slot of the slicer, and the trimmer first uses 10μM for rough trimming and then 4μM for fine trimming. Prepare the slide, select the slice thickness, shake the handle, and you can make the slice, and carefully adsorb the slice on the glass slide. Place at room temperature for 15 min, then store in a -20°C refrigerator for subsequent fluorescence photography.

[0179] 1.7 Immunohistochemistry

[0180] After the embedded colon tissue sections and paraffin sections were dewaxed to water, the antigen retrieval solution was heated to boiling, and then placed on a glass slide. After 15 minutes, it was taken out and naturally cooled to room temperature. Rinse with PBS phosphate buffer 3 times, 5 minutes each time, circle the colon tissue mark with PAPpen, and then add 25-50μL of endogenous peroxidase blocker to each section sample, incubate in a wet box at room temperature for 10 minutes, rinse with PBS phosphate buffer 3 times, 5 minutes each time, add 25μL of goat serum blocking solution, block in a 37℃ oven for 1h, and rinse with PBS phosphate buffer 3 times, 5 minutes each time. After blocking, add 25μL of PBS phosphate buffer to the negative sample, and add SNTB1 primary antibody working solution (1:200) to the remaining samples, and place the wet box in a 4℃ refrigerator for overnight incubation. PBS was used to replace the primary antibody as a negative control. The next day, the wet box was taken out of the 4℃ refrigerator, rewarmed for 15 minutes, and rinsed with PBS phosphate buffer 3 times, 5 minutes each time. 25 μL of secondary antibody working solution was added to each slice sample, and incubated in a 37°C oven for 1 hour, and rinsed with PBS three times, each time for 5 minutes. 25 μL of streptomycin peroxidase was added to each sample, incubated at room temperature for 10 minutes, and rinsed with PBS phosphate buffer three times, each time for 5 minutes. DAB color development solution was prepared according to the instructions, and 50 μL of DAB working solution was added to each sample for color development for 2 minutes, followed by ultrapure water washing for 3 times. The color development was controlled under a light microscope until the color was brownish yellow. After complete color development, the color development was stopped by washing with distilled water. The hematoxylin staining solution was pre-filtered, and the paraffin sections were placed in the hematoxylin staining solution. The colon tissue cell nuclei were counterstained for 1.5 to 2 minutes, and ultrapure water was fully washed 2 to 3 times. PBS returned to blue for 10 minutes, and then washed thoroughly. Dry and seal with neutral gum. After sealing, 5 fields of view were randomly selected for each sample under a 400x microscope, and the appearance of brownish yellow particles was used as the criterion for positive expression. The results were semi-quantitatively analyzed using the positive rate. The acquired images were analyzed using the Motic6.0 image analysis system.

[0181] 1.8 RT-qPCR experiments

[0182] 1.8.1 Total RNA extraction from colon tissue

[0183] Before the experiment, the tissue samples were taken out of the -80℃ refrigerator and thawed on ice. Then the following operations were performed: 0.2mL of chloroform was added to each 1.5mL centrifuge tube, and then the centrifuge tube was tightly capped and shaken vigorously for 15s, and then allowed to stand at room temperature for 5-10min. After standing, the tubes were centrifuged in a 4℃ low-temperature centrifuge at 12000r / min for 20min. After centrifugation, the centrifuge tubes were separated into three layers. The upper layer of liquid (about 0.3mL) was carefully removed and placed in another RNase-free centrifuge tube. An equal volume of 0.3mL of isopropanol was added, and the mixture was gently mixed up and down, and allowed to stand at room temperature for 10-30min to allow the RNA to be fully precipitated. After another centrifugation (4℃, 12000 rpm, 10min), the supernatant was carefully discarded, and the white precipitate at the bottom was RNA. Then 1mL of 75% pre-cooled anhydrous ethanol was added to each tube, and the tubes were gently inverted up and down to rinse the RNA precipitate to remove residual isopropanol. Finally, centrifuge (4°C, 10,000 rpm, 10 min), carefully discard the supernatant, and place the precipitate at room temperature. Dry naturally, and add appropriate amount of DEPC water to dissolve the white precipitate after it becomes transparent.

[0184] 2.8.2 Determination of total RNA concentration in colon tissue

[0185] Use Nanodrop 2000 software to measure RNA concentration, select the absorption wavelength of 260nm, RNA has the maximum absorption peak. When the OD value read at a wavelength of 260nm / 280nm is usually around 2.0, RNA has a high purity, and the best ratio is generally 1.8-2.0.

[0186] 2.8.3 Reverse transcription of total RNA from colon tissue

[0187] A 10 μL reaction system was constructed with a total RNA mass of 1000 ng. According to the experimental instructions, each reagent was dissolved on ice, shaken and then centrifuged.

[0188] (1) gDNA removal reaction (gDNA removal reaction system see Table 14), after centrifugation, react at 42°C for 2 min in a PCR instrument, and place on ice after the reaction is completed.

[0189] Table 14gDNA removal reaction system

[0190]

[0191] (2) RNA reverse transcription reaction (see Table 15 for the reverse transcription reaction system). After centrifugation, the reaction was carried out at 37°C for 15 min and at 85°C for 5 s. After the reaction was completed, the reaction was centrifuged and the cDNA was stored in a -80°C ultra-low temperature refrigerator.

[0192] Table 15 Reverse transcription reaction system

[0193]

[0194]

[0195] 2.8.4 PCR amplification

[0196] (1) Dilute the cDNA sample 10 times in advance; (2) Prepare the amplification reaction system (see Table 16).

[0197] Table 16 PCR amplification reaction system

[0198]

[0199] (3) A two-step method was used for amplification. The reaction conditions and reaction steps are shown in Table 17.

[0200] Table 17 Amplification reaction conditions and reaction steps

[0201]

[0202] (4) GAPDH was used as an internal reference, and the relative expression level of the target gene in the colon tissue of each group was detected by calculation using the formula 2-△△Ct according to the CT value of each group.

[0203] Calculation formula: △CT = CT target gene - CT internal reference gene; △△CT = △CT treated sample - △CT control sample; relative expression level of gene = 2-△△CT.

[0204] The Western blot experiment was performed according to the method in Example 2.

[0205] 3 Experimental results

[0206] 3.1 Effect of SNTB1 on the disease progression of CAC mice The weight of mice in the control group increased steadily throughout the experiment, with no fecal occult blood or diarrhea, normal DAI index, and overall good condition. During the administration of DSS, mice in the Model, Model / OE-NC, and Model / Sh-NC groups were thinner and their activity level was slightly lower than that in the Control group. In the Model / OE group, mice showed symptoms such as erect hair, arched back, lack of energy, decreased activity, and abdominal contraction in the first 3-5 days of receiving DSS drinking water and returning to normal drinking water; mice in the Model / Sh group were in good mental state and had good activity level.

[0207] 3.1.1 Effect of SNTB1 on body weight changes in CAC mice

[0208] like Fig.14As shown in the data, the weight of mice in the Control group continued to increase during the experiment. After the first round of DSS, the weight of mice in the Model group, Model / OE-NC group, and Model / Sh-NC group decreased, and the Model / OE group showed a significant weight loss. Around the 55th day of the experiment, the weight loss of mice was significant and statistically significant (P<0.05). Compared with the Model / Sh-NC group, the weight loss of mice in the Model / Sh group was smaller (P<0.05).

[0209] Compared with the Control group, the mice in the Model group lost significant weight during the AOM / DSS modeling period, especially 2-3 days after the start of each round of DSS, and their weight gradually recovered after the end of DSS administration (P<0.05). Compared with the Model group, the mice in the Model / OE group lost significant weight during the modeling period, and the weight of the mice in the Model / Sh group decreased, but the trend was not obvious (P<0.05). These results indicate that SNTB1 can affect the weight changes of CAC model mice, and overexpression of SNTB1 can lead to weight loss in mice.

[0210] 3.1.2 Effect of SNTB1 on fecal occult blood in CAC mice

[0211] like Fig.15 As shown in the figure, during the period of DSS administration, the Model group, Model / OE-NC group, Model / Sh-NC group, and Model / OE group all showed obvious blood in the stool compared with the Model group, and some mice in the Model / OE group had severe pure blood in the stool, blood in the anus, and even rectal prolapse, accompanied by a depressed mental state; while the above symptoms (fecal occult blood) in the Model / Sh group were milder (P<0.05). The results show that high expression of SNTB1 will aggravate the occurrence of fecal occult blood in CAC mice.

[0212] 3.1.3 Effect of SNTB1 on diarrhea index of CAC mice

[0213] like Fig.16As shown in the figure, during the AOM / DSS intervention period, the mice in the Control group had no diarrhea throughout the whole process, and the feces quality and volume were normal. During the three rounds of DSS, the Model group, Model / OE-NC group, Model / Sh-NC group, and Model / OE group all had obvious diarrhea, and all had obvious watery feces; the severity of diarrhea gradually eased within 2 weeks after DSS. The mice in the Model / OE group had more severe diarrhea, with unformed and even watery feces, while the diarrhea of ​​the mice in the Model / Sh group was less obvious, and the diarrhea recovered rapidly with the cessation of DSS drinking water. The results suggest that SNTB1 can affect the diarrhea of ​​CAC model mice, overexpression of SNTB1 can aggravate the diarrhea index score of mice, and SNTB1 knockdown can reduce the diarrhea of ​​CAC mice.

[0214] 3.1.4 Effect of SNTB1 on DAI in CAC mice

[0215] like Fig.17 As shown in the figure, during the period of DSS administration, the Control group did not show obvious fluctuations in the DAI index during the experiment. Compared with the Model group, the Model / OE group showed a significant increase in the DAI index (P<0.05), and the disease conditions (diarrhea, weight loss, occult blood) of the mice in this group were the most serious. During the DSS administration, the stool was unformed or even watery, while the above disease changes in the Model / Sh group were not obvious (P<0.05); compared with the Model / Sh-NC group, the DAI index of the Model / Sh group was significantly reduced (P<0.05). With the cessation of DSS drinking water, diarrhea recovered rapidly. The results show that SNTB1 overexpression will cause an increase in the DAI index of CAC mice.

[0216] 3.1.5 Effects of SNTB1 on colon length and tumor number in CAC mice

[0217] like Fig.18 As shown in the figure, the colon of the mice in the Control group was smooth and intact, without obvious masses, congestion, shortening or thickening of the colon. Compared with the Model group, the colon of the mice in the Model / OE group was significantly enlarged, thickened, and shortened, while the colon length of the Model / Sh group was not significantly shortened (P<0.05). Compared with the Model / OE-NC group, the colon length of the Model / OE group was significantly shortened, and the difference was statistically significant (P<0.05); compared with the Model / Sh-NC group, the shortening of the colon length in the Model / Sh group was less obvious (P<0.05). The results show that the differential expression of SNTB1 affects the changes in the colon length of CAC mice, and high expression of SNTB1 aggravates the phenomenon of shortening of the colon length of CAC mice.

[0218] See Table 18 and Fig.19 By counting the number of tumors during sampling, it was found that compared with the Model / OE-NC group, the number of colon tumors in the Model / OE group increased, and the difference was statistically significant (P<0.05); compared with the Model / Sh-NC group, the number of tumors on the colon tissue was significantly reduced, and the number of tumors was statistically different (P<0.05).

[0219] Table 18 Statistics of body weight, colon length and number of tumors of each group of mice on the day of sampling (±s, n=10)

[0220]

[0221] Note: Compared with the Control group, *P<0.05; compared with the Model group, ▽ P<0.05; compared with the Model / OE-NC group, # P<0.05; compared with Model / Sh-NC group, △P<0.05

[0222] 3.2 Results of in vivo imaging of small animals

[0223] Small Animal In Vivo Imaging System Results (see Fig. 20 ) showed that each group of mice had obvious colon tumor fluorescence, indicating that the colon tissue had been infected with adeno-associated virus.

[0224] 3.3 Frozen section results

[0225] See also Fig.21 Under a fluorescence microscope, the frozen sections of mouse colon tissue showed green fluorescence, and the cross-sections of colon tissue showed strong green fluorescence, proving that the virus infected the colon tissue. This feature is also consistent with the results of small animal in vivo imaging.

[0226] 3.4 Effect of SNTB1 on SNTB1 positive expression in colon tissue

[0227] See also Fig. 22 Compared with the Control group, the positive expression of SNTB1 in the colon tissue of the mice in the Model group increased (P<0.05); compared with the Model group, the mice in the Model / OE group showed infiltration of inflammatory cells and destruction of the colon tissue structure, and the positive expression rate of SNTB1 increased, while the positive expression of SNTB1 in the colon tissue of the mice in the Model / Sh group decreased, and the loss of colon crypt tissue was not obvious (P<0.05).

[0228] Effect of SNTB1 on SNTB1 mRNA expression in colon tissue

[0229] The effects of differential expression of SNTB1 on the mRNA expression of SNTB1 gene in the intestinal tissues of mice were detected by RT-qPCR. Fig.23 As shown, compared with the Control group, the expression of SNTB1 mRNA in the colon tissue of the Model group mice increased (P<0.05); compared with the Model / OE-NC group, the expression of SNTB1 mRNA in the Model / OE group increased (P<0.05); compared with the Model / Sh-NC group, the expression level of SNTB1 mRNA in the colon tissue of the Model / Sh group mice decreased (P<0.05). This indicates that AOM / DSS-induced colitis-related colon cancer induces an increase in the expression of SNTB1 mRNA in the colon tissue, and the colon tissue of the mice in the SNTB1 overexpression group contains a higher expression level of SNTB1 mRNA.

[0230] 3.6 Effect of SNTB1 on protein expression in colon tissue

[0231] Western Blot was used to verify the effect of SNTB1 on the expression of SNTB1 in colon tissue of CAC mouse model. Fig.24 As shown in the figure, compared with the Model group, the expression of SNTB1 protein in the Model / OE group was increased, and the expression of SNTB1 in the Model / Sh group was decreased (P<0.05); compared with the Model / OE-NC group, the expression of SNTB1 in the Model / OE group was significantly increased (P<0.05); compared with the Model / Sh-NC group, the expression of SNTB1 in the Model / Sh group was decreased (P<0.05). Compared with the Control group, the expression of SNTB1 protein in the colon tissue of the mice in the Model group was significantly increased, indicating that the expression of SNTB1 in the CAC mouse model is high, and overexpression of SNTB1 will increase the expression of SNTB1 protein in the colon tissue of mice.

[0232] From the above results, it can be seen that overexpression of the SNTB1 gene will aggravate the severity of the disease in mice with colitis-related colon cancer, affect the survival status of mice, and promote the occurrence and development of colitis-related colon cancer. Therefore, the SNTB1 gene can be used as a biomarker for screening people at high risk of colorectal cancer transformation.

[0233] Example 4 Effect of Babaodan BBD on SNTB1-mediated colitis-related colon cancer mice

[0234] Use an electronic balance to weigh 125 mg of BBD powder into a 7 mL centrifuge tube, add 5 mL of sterile saline to prepare a solution with a final concentration of 25 mg / mL, seal with a sealing film, sonicate for 2 h to assist dissolution, and place in a 4°C refrigerator for use. Use 250 mg / kg (the clinical equivalent conversion dose of Babaodan) as the dosage for oral administration to mice.

[0235] 1 Construction of CAC model and drug administration method

[0236] See also Fig.25 After one week of adaptive feeding, Balb / c mice were randomly divided into Model group, Model+AAV-NC group, Model+AAV / NC+BBD group, and Model / OE-SNTB1+BBD group. AOM was injected intraperitoneally at a dose of 100 μL / mouse. Seven days after AOM injection, sterile DSS drinking water was prepared under light-proof conditions, and mice in Model+AAV-NC group and Model+AAV / NC+BBD group were injected intraperitoneally with SNTB1 empty adeno-associated virus at a dose of 100 μL / mouse; mice in Model / OE-SNTB1+BBD group were injected with 100 μL / mouse overexpressed adeno-associated virus. The virus expression reached a peak around the 21st day. Adeno-associated virus injection was taken at the beginning of each round of DSS to ensure that adeno-associated virus was combined and sufficiently infected in the whole process of enteritis-related intestinal cancer development in AOM / DSS mice.

[0237] The mouse disease condition monitoring and immunohistochemistry methods refer to "1.4 Mouse disease condition monitoring" and "1.7 Immunohistochemistry" of Example 3, respectively.

[0238] 2Hematoxylin-eosin stain (HE)

[0239] 2.1 Slicing

[0240] (1) The embedded wax block tissue was placed in a -20℃ refrigerator for 30 minutes before sectioning.

[0241] (2) Fix the wax block on a paraffin slicer, trim it to 10 μm until the entire tissue is intact, and then change to 4 μm scale for slicing.

[0242] (3) Spread the cut tissue slices evenly in a 38°C water bath. After the tissue is completely flattened, pick it up and fix it on a slide. Bake it at 60°C for 1-2 hours to prevent it from falling off. Finally, place it in a 37°C oven overnight for HE staining the next day.

[0243] 2.2 Staining

[0244] (1) Place the slide in an oven (60°C) and bake for 1 hour, then take it out and dewax and rehydrate it in the following order: xylene I, 15 minutes; xylene II, 15 minutes; anhydrous ethanol 5 minutes / time, 2 times in total; 95% ethanol, 5 minutes; 90% ethanol, 5 minutes; 80% ethanol, 5 minutes; 70% ethanol, 5 minutes; rinse with ultrapure water 3-5 times.

[0245] (2) Use filter paper to filter the hematoxylin stain solution (when hematoxylin stain is left at room temperature, oily substances tend to appear on the upper layer). Place the slide in the hematoxylin filtrate and stain for 1-3 minutes, then take it out (the staining time varies for different tissue samples). Rinse it three times with ultrapure water, quickly place it in a 1% hydrochloric acid solution to rinse once (about 1-2 seconds), and then place it in tap water to return to blue for 10-12 minutes.

[0246] (3) Mix eosin stain and ultrapure water at a dilution ratio of 1:3. Place the slices in the diluted eosin stain for 25 seconds to 1 minute (the staining time varies for different tissue samples) and then take them out. Rinse them twice with ultrapure water and use a hair dryer to dry excess water stains. Use neutral resin to seal the slices and place them in a fume hood to allow the resin glue to dry naturally.

[0247] (4) Images were collected under light microscopy using a Leica DM4000B inverted microscope (200×, 400×).

[0248] The RT-qPCR experiment and Western Blot experiment were performed according to the methods in Example 3 and Example 2, respectively.

[0249] 3 Experimental results

[0250] Effects of BBD intervention on the pathological state of CAC mice

[0251] 3.1.1 Effect of BBD on body weight changes in CAC mice

[0252] like Fig.26As shown in the figure, after each round of DSS induction, the weight of mice in each group showed a decreasing trend to varying degrees. Compared with the Model+AAV-NC group, the weight of mice in the Model+AAV / NC+BBD group recovered faster and increased significantly after intervention with Babaodan (P<0.05). In the third round of DSS induction, compared with the Model+AAV / NC group, the weight of mice in the Model+AAV / NC+BBD group began to increase significantly from the 54th day (P<0.05). Compared with the Model+AAV / NC+BBD group, the weight of mice in the Model / OE-SNTB1+BBD group was lower (P<0.05). This indicates that SNTB1 overexpression can cause weight loss in CAC mice, and Babaodan intervention can reverse the adverse reactions of SNTB1 overexpression, such as weight loss and emaciation in mice.

[0253] 3.1.2 Effect of BBD on fecal occult blood in CAC mice

[0254] like Fig. 27 As shown in the results, during the period of DSS administration, mice in each group had severe blood in the stool. After oral administration of BBD, the fecal occult blood scores of mice in the Model+AAV / NC+BBD group decreased compared with those in the Model group and the Model+AAV-NC group (P<0.05). The results showed that BBD intervention can improve the fecal occult blood in mice with colitis-related colon cancer.

[0255] 3.1.3 Effect of BBD on diarrhea index of CAC mice

[0256] like Fig.28 As shown in the figure, after DSS induction, mice in the Model group and the Model+AAV-NC group showed obvious diarrhea symptoms. The fecal diarrhea scores of mice in the Model+AAV / NC+BBD group and the Model / OE-SNTB1+BBD group were reduced (P<0.05) by oral administration of Babaodan, and the diarrhea condition was improved. No watery stools appeared in the process of colitis-related colon cancer formation. The results showed that BBD intervention can significantly alleviate the diarrhea symptoms in the process of colitis-related colon cancer in mice induced by AOM / DSS.

[0257] 3.1.4 Effect of BBD on the disease index (DAI) of CAC mice

[0258] like Fig.29As shown in the figure, after the first round of DSS induction, the DAI index of mice in the Model group and the Model+AAV-NC group increased significantly; BBD was continuously gavaged after the onset of inflammatory symptoms in mice. In the second round of DSS induction, compared with the Model group, the DAI scores of mice in the Model+AAV / NC+BBD group and the Model / OE-SNTB1+BBD group on days 36 and 54 decreased significantly. After normal drinking water began, the disease symptoms of mice in the Model+AAV / NC+BBD group were alleviated, and the DAI scores decreased; but in the third round of DSS intervention, from day 51 to sampling, the DAI of mice in the Model+AAV / NC+BBD group began to decrease significantly (P<0.05). The results showed that BBD intervention can significantly inhibit the disease symptoms in the process of AOM / DSS-induced colitis-related colon cancer.

[0259] 3.1.5 Effects of BBD on colon length and tumor number in CAC mice

[0260] like Fig.30 The colon length of mice in the Model group and Model+AAV-NC group was shorter, with the colon lengths of the two groups being (7.35±3.41) and (7.56±0.34) respectively, and the intestinal lumen thickness was thicker, while the Model+AAV / NC+BBD group could alleviate the above phenomenon. The colon length of mice was measured, as shown in Table 19. Fig.31 Compared with the Model group, the average colon length of the Model+AAV / NC+BBD group was longer, the colon tissue surface was clean and smooth, and the intestinal cavity was not shortened. The colon length was (8.57±3.52), and the difference was statistically significant (P<0.05). The number of tumors in the Model group was (8.29±4.18), the number of tumors in the Model+AAV-NC group was (8.12±4.28), the number of tumors in the Model+AAV / NC+BBD group was (6.58±4.29), and the number of tumors in the Model / OE-SNTB1+BBD group was (10.17±3.16), and the number of tumors was statistically significant (P<0.05).

[0261] Table 19 Statistics of body weight, colon length and number of tumors of mice in each group on the day of sampling ( n=10)

[0262]

[0263] 3.2 Effect of BBD intervention on HE staining of colon tissue

[0264] The results of HE staining experiments showed that compared with the Model group, there were no obvious changes in the colon tissue of CAC mice in the Model+AAV-NC group, and there was no statistical difference. Compared with the Model+AAV-NC group, the destruction of the mucosal tissue in the colon tissue of the Model+AAV / NC+BBD group was improved, the colon villi were arranged neatly, and no crypt erosion was observed. The difference was statistically significant (P<0.05). Compared with the Model+AAV / NC+BBD group, the mucosal structure of the colon tissue in the Model / OE-SNTB1+BBD group was significantly improved, and the number of inflammatory cells was reduced. The results showed that BBD can improve the severity of the disease in the colon tissue of mice with colitis-related colon cancer, as shown in Fig.32 .

[0265] Effect of BBD intervention on SNTB1 positive expression in colon tissue

[0266] like Fig.33 As shown, the results showed that compared with the Model group, there was no statistical difference in the positive expression of SNTB1 in the colon tissue of CAC mice in the Model+AAV-NC group. Compared with the Model+AAV-NC group, the positive expression of SNTB1 in the colon tissue of the Model+AAV / NC+BBD group was reduced, and the difference was statistically significant (P<0.05). Compared with the Model+AAV / NC+BBD group, the positive expression of SNTB1 in the colon tissue of the Model / OE-SNTB1+BBD group decreased, the infiltration of inflammatory cells was less, and the crypt arrangement was more regular, and the difference was statistically significant (P<0.05). It can be seen that Babaodan can affect the expression of SNTB1 positive cells in the colon tissue of CAC mice.

[0267] Effect of BBD intervention on SNTB1 mRNA expression in colon tissue

[0268] The RT-qPCR method was used to detect the effect of Babaodan intervention on the expression of SNTB1 gene mRNA in the intestinal tissue of CAC model mice. Fig.34 As shown, the result

[0269] The results showed that compared with the Model group, there was no statistical difference in the colon length of CAC mice in the Model+AAV-NC group. Compared with the Model+AAV-NC group, the colon length of the Model+AAV / NC+BBD group was shortened, and the difference was statistically significant (P<0.05). Compared with the Model+AAV / NC+BBD group, the colon length of the Model / OE-SNTB1+BBD group was shortened, and the difference was statistically significant (P<0.05). It can be seen that Babaodan affects the colon length of mice by regulating the expression of SNTB1 in the colon tissue of CAC mice, and the colon length of mice after Babaodan intervention increased. These results further indicate that BBD can improve the disease state of colitis-related colon cancer by regulating the expression of SNTB1.

[0270] Effect of BBD intervention on SNTB1 protein expression in colon tissue

[0271] Western blot experiments were used to detect the effect of Babaodan intervention on the expression of SNTB1 gene protein in the intestinal tissue of CAC model mice. Fig.35 As shown in the figure, compared with the Model group, there was no significant statistical difference in the expression of SNTB1 protein in the colon tissue of CAC mice in the Model+AAV-NC group. Compared with the Model+AAV-NC group, the expression of SNTB1 protein in the Model+AAV / NC+BBD group was reduced, and the difference was statistically significant (P<0.05). Compared with the Model+AAV / NC+BBD group, the expression of Model / OE-SNTB1+BBDSNTB1 protein increased, and the difference was statistically significant (P<0.05). It can be seen that Babaodan can restore the shortening of the colon length of mice caused by AOM / DSS combined with overexpression of SNTB1 adenovirus by regulating the expression of SNTB1 protein in the colon tissue of CAC mice. At the same time, it can reduce the number of tumors on the colon tissue, alleviate the disease activity index, and improve the survival status and pathological conditions of mice.

[0272] In summary, it can be determined that SNTB1 is the key target of Babaodan's ability to inhibit the proliferation and metastasis of colorectal cancer cells. The overexpression of the SNTB1 gene can promote the occurrence and development of colon cancer. BBD can inhibit the proliferation and metastasis of tumor cells by inhibiting the expression of SNTB1, ultimately achieving an anti-colorectal cancer effect.

[0273] The results of the above examples indicate that the SNTB1 gene can be used as a biomarker for screening people at high risk of colorectal cancer transformation, providing more solutions for early diagnosis and screening.

[0274] In addition, when studying the more comprehensive and complex mechanism of colorectal cancer associated with colorectal inflammation, the SNTB1 gene expression promoter provides a good modeling agent for constructing this type of full-process animal model, wherein the SNTB1 gene expression promoter carries the adeno-associated virus of the SNTB1 gene. The adeno-associated virus (AAV) is a genus of the microviridae family, with a virus particle size of about 20 to 26 nm. The complete life cycle requires the participation of a helper virus (usually adenovirus or herpes virus). It encodes the cap and rep genes in the inverted repeat sequences (ITR) at both ends. Among them, the cap gene encodes the viral capsid protein, and the rep gene is involved in the replication and integration of the virus. The vector of the adeno-associated virus includes pHBAAV-CMV-MCS-3flag-T2A-ZsGreen, and the map of the target vector (pHBAAV-CMV-MCS-3flag-T2A-ZsGreen) is shown in Fig.36 As shown. The adeno-associated virus AAV packaging system of the present invention is divided into 3 plasmids, including a shuttle plasmid into which the SNTB1 gene can be inserted, pAAV-RC encoding the rep and cap protein encoding genes, and a pHelper plasmid that replaces the adenovirus on which the adeno-associated virus depends. After the three plasmids are co-transfected into the tool cell AAV-293, AAV virus particles carrying exogenous inserted genes can be formed.

[0275] Furthermore, after knowing that the SNTB1 gene is a target of colorectal cancer associated with colorectal inflammation, it can be easily used to prepare a composition of a preventive drug for colorectal cancer associated with colorectal inflammation, including an adeno-associated virus shRNA vector, wherein the adeno-associated virus shRNA vector includes pHBAAV-U6-MCS-CMV-EGFP, and the map of the target vector (pHBAAV-U6-MCS-CMV-EGFP) is as follows: Fig.37As shown. The shRNA transcribed in the cell is processed and incorporated into the RNA-induced silencing complex (RISC), which guides the nuclease to degrade the target RNA. Viral shRNA vectors can also be used for RNAi interference, and the vectors marked with antibiotics can continuously inhibit the expression of target genes in cells for several weeks or even longer. The adeno-associated virus of the present invention is the same as described above. The adeno-associated virus shRNA vector can be used for RNAi interference, and the vectors marked with antibiotics can continuously inhibit the expression of target genes in cells for several weeks or even longer. Compared with other vectors, viral shRNA vectors can directly and efficiently infect cells for gene silencing research, the transfection effect is stable, and the various inconveniences caused by the low efficiency of plasmid transfection can be avoided. The nucleotide sequence of the siRNA for knocking down the SNTB1 gene is: CCACTCCTTTCTGTCTGCTAAGATA (SEQ ID NO: 1), and the forward and reverse nucleotide sequences of the shRNA for knocking down the SNTB1 gene are AATTCGCCACTCCTTTCTGTCTGCTAAGATATTCAAGAGATATCTTAGCAGACAGAAAGGAGTGGTTTTTTG (SEQ ID NO: 2) and GATCCAAAAAACCACTCCTTTCTGTCTGCTAAGATATCTCTTGAATATCTTAGCAGACAGAAAGGAGT GGCG (SEQ ID NO: 3), respectively.

[0276] Finally, it should be noted that although the above embodiments have been described in the specification and drawings of this application, this does not limit the scope of patent protection of this application. All technical solutions generated by replacing or modifying equivalent structures or equivalent processes based on the essential concept of this application using the contents recorded in the specification and drawings of this application, as well as directly or indirectly implementing the technical solutions of the above embodiments in other related technical fields, are included in the scope of patent protection of this application.

Claims

1. A biomarker for screening high-risk populations for colorectal cancer transformation, characterized in that: The biomarker is the SNTB1 gene.

2. A SNTB1 gene expression promoter for constructing an animal model of the whole process of colorectal cancer transformation, characterized in that: It comprises an adeno-associated virus carrying the SNTB1 gene, wherein the vector of the adeno-associated virus comprises pHBAAV-CMV-MCS-3flag-T2A-ZsGreen.

3. A composition for preparing a preventive drug for colorectal cancer transformation, characterized in that: It comprises an adeno-associated virus shRNA vector, wherein the adeno-associated virus shRNA vector comprises pHBAAV-U6-MCS-CMV-EGFP.

4. The composition according to claim 3, characterized in that Also included is siRNA for knocking down the SNTB1 gene, whose nucleotide sequence is the sequence shown in SEQ ID NO:

1.

5. The composition according to claim 3, characterized in that Also included is shRNA for knocking down the SNTB1 gene, characterized in that its forward and reverse nucleotide sequences are shown as SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

6. A pharmaceutical composition for preventing colorectal cancer transformation, characterized in that: It contains an active substance that inhibits the SNTB1 gene or inhibits the expression of the SNTB1 gene.

7. A kit for diagnosing colorectal cancer associated with colorectal inflammation, characterized in that: The kit comprises reagents for detecting the SNTB1 gene.

8. A method for screening drugs for preventing or treating colorectal cancer associated with colorectal inflammation, characterized in that: The following steps are involved: Providing cells expressing the SNTB1 gene; contacting the drug to be screened with the cells; Detecting the inhibitory effect of the drug to be screened on SNTB1 gene expression; A target drug is selected according to the inhibitory effect results.

9. The method according to claim 8, characterized in that The cells expressing the SNTB1 gene include HCT-116 and LOVO.

10. The method according to claim 8, characterized in that In the process of contacting the drug to be screened with the cells expressing the SNTB1 gene, inflammatory cytokines or inflammation-related signaling pathway activators are also introduced.

Images