Molecular marker K678 related to growth traits of portunus trituberculatus and application of molecular marker K678

Abstract

The invention discloses a molecular marker K678 related to growth traits of portunus trituberculatus and application of the molecular marker K678. The nucleotide sequence of the molecular marker K678 is as shown in SEQ ID No. 1, and the nucleotide sequences of a primer pair for detecting the molecular marker K678 are as shown in SEQ ID No. 2 and SEQ ID No. 3. The molecular marker K678 is an SNP marker, and the growth dominant genotype of the molecular marker K678 is a TT genotype. The molecular marker K678 provided by the invention can be used for accelerating the breeding speed of the portunus trituberculatus strain with excellent growth traits and promoting the breeding process of the improved variety of the portunus trituberculatus, and has important significance in the aspects of improving the growth performance and breeding efficiency of offspring crabs, increasing the breeding yield and income and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding of aquatic animals, and particularly relates to a molecular marker K678 related to growth traits of swimming crabs trituberculate and an application thereof. Background Art

[0002] Swimming crab ( Portunus trituberculatus ) belongs to the class of soft armor, the order of decapod, the family of swimming crabs, and the genus of swimming crabs. It is commonly known as swimming crabs and is an important large marine economic crab in my country. Swimming crabs have the advantages of short reproduction cycle, fast growth rate and strong adaptability. Because of their delicious meat and rich nutrition, they are well-known at home and abroad and are deeply loved by consumers. In the process of breeding swimming crabs, individuals of different sizes often appear. Swimming crabs have a strong habit of "cannibalism", especially larger individuals will prey on weak individuals that are smaller or have just shed their shells, resulting in greater economic losses. In the process of breeding swimming crabs, it is also common to see obvious growth differences in the same batch of crab seedlings under the same conditions such as bait conditions and water quality environment. Growth traits are one of the important breeding traits of swimming crabs, which is of great significance to increasing the yield of swimming crabs. The genetic progress of traditional breeding methods is slow, and it is urgent to use advanced molecular marker-assisted breeding technology to speed up the breeding process. The identification and innovative application of growth trait molecular markers are the necessary prerequisites and ways to carry out molecular marker-assisted breeding.

[0003] Molecular markers are genetic markers based on the variation of nucleotide sequences of genetic material between individuals, and are a direct reflection of genetic polymorphism at the DNA level. Molecular markers have significant advantages: most molecular markers are co-dominant, which is very convenient for selecting recessive traits; the genome variation is extremely rich, and the number of molecular markers is almost unlimited; DNA from different stages of biological development and different tissues can be used for marker analysis; molecular marker detection methods are simple and rapid. At present, there are few reports on molecular markers of growth traits of swimming crabs. Therefore, the development of molecular markers of growth traits is of great significance to the healthy cultivation and breeding of swimming crabs. Summary of the invention

[0004] The present invention provides a molecular marker K678 related to the growth traits of swimming crabs (Malvinas trituberculatus) and an application thereof. The present invention obtains SNPs by filtering and comparing polymorphic sites of sequencing data, and then gradually screens the markers to finally obtain a new molecular marker K678 related to the growth traits of swimming crabs (Malvinas trituberculatus). The use of the molecular marker is beneficial to the screening and breeding of the growth traits of swimming crabs (Malvinas trituberculatus).

[0005] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions: The present invention provides a molecular marker K678 related to the growth traits of swimming crab (Portunus trituberculatus), and the nucleotide sequence of the molecular marker K678 is shown in SEQ ID No.1.

[0006] Furthermore, the molecular marker K678 is a SNP marker.

[0007] Furthermore, the genotype TT of the 117th base of the molecular marker K678 is a growth advantage trait genotype.

[0008] The present invention also provides a primer pair for detecting the molecular marker K678 according to claim 1, characterized in that the nucleotide sequence of the forward primer in the primers is as shown in SEQ ID No. 2, and the nucleotide sequence of the reverse primer is as shown in SEQ ID No. 3.

[0009] The present invention also provides the application of the molecular marker K678 in screening varieties of swimming crabs with advantageous growth traits.

[0010] Furthermore, the step of screening varieties with advantageous growth traits of swimming crabs is as follows: the step of screening varieties with advantageous growth traits of swimming crabs is as follows: extracting DNA of a sample of swimming crabs to be tested and using it as a template, performing PCR amplification using amplification primers of molecular marker K678, sequencing the PCR products, and if the genotype of the 117th base of K678 in the sequencing result is TT, selecting the sequenced sample as a parent for breeding a fast-growing variety of swimming crabs.

[0011] Furthermore, the PCR amplification system is: template 2 μl, forward primer 0.8 μl, reverse primer 0.8 μl, 2×Rapid Taq Master Mix 10 μl, ddH2O 6.4 μl.

[0012] Furthermore, the PCR amplification procedure was: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 40 s, repeated for 35 cycles; and final extension at 72°C for 5 min.

[0013] The present invention also provides a kit for breeding fast-growing varieties of swimming crabs, wherein the kit contains the molecular marker K678 according to claim 1 and / or the amplification primers according to claim 4.

[0014] The present invention also provides the application of the molecular marker K678 in genetic diversity analysis, germplasm identification and genetic map construction of swimming crab trituberculate.

[0015] Compared with the prior art, the present invention has the following advantages and beneficial effects: 1. The molecular marker K678 related to the growth traits of the swimming crab provided by the present invention is not limited by the growth stage of the swimming crab, and can be used for the early crab seedling breeding of the swimming crab, thereby significantly promoting the breeding process of the swimming crab and accelerating the speed of breeding excellent traits.

[0016] 2. The present invention adopts molecular marker-assisted selection breeding to perform association analysis on the target trait with the help of alleles or genotypes closely related to the target trait, which improves the accuracy of selection, shortens the breeding period, reduces breeding costs, and is widely used in the breeding process of aquatic animals. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a diagram showing the sequencing results of the growth trait-related marker K678 of the swimming crab (Peninsula trituberculatum) of the present invention. DETAILED DESCRIPTION

[0018] The technical solution of the present invention is further described in detail below in conjunction with specific embodiments.

[0019] The three-spotted swimming crabs used in the present invention are all from the experimental base of Changyi Haifeng Aquatic Products Co., Ltd. of the Yellow Sea Fisheries Research Institute of the Chinese Academy of Fishery Sciences. Healthy three-spotted swimming crabs are randomly obtained from the pond by trawling, and are temporarily placed in a net basket and covered with a layer of water plants to prevent crabs from fighting. Finally, 298 three-spotted swimming crabs are obtained. The muscle tissue of the swimming foot is dissected in anhydrous ethanol and immediately frozen in liquid nitrogen.

[0020] Example 1 1. Screening of candidate molecular markers related to growth traits 1. Sequencing data filtering and alignment Genomic DNA was extracted using traditional phenol-chloroform. First, pre-cool the mortar and pestle with liquid nitrogen; Grind the sample thoroughly, put the ground sample into a 50ml centrifuge tube containing 20ml GP1 lysis buffer and 500ul mercaptoethanol lysis buffer with a medicine spoon pre-cooled with liquid nitrogen, mix it by inversion, incubate it at 55℃ for 60min, and shake it several times during the period to help complete lysis. Then, centrifuge it at 12500rpm for 8min in a high-speed low-temperature refrigerated centrifuge (model Eppendorf 5804R), and pipette the supernatant into a new 50ml centrifuge tube. Add an equal volume of saturated phenol / chloroform / isoamyl alcohol (25:24:1), mix it by inversion for 5min, centrifuge it at 12500rpm for 8min, carefully pipette the supernatant into a new tube (it is better to take less, and the tip of the gun should not touch the layer), add an equal volume of chloroform / isoamyl alcohol, shake and mix it, and centrifuge it at 12500rpm for 8min. Then, pipette the supernatant into a new 50ml centrifuge tube, add 3 / 4 volume of isopropanol, mix well and place at -20℃ for 20min (-80℃ for 10min), then centrifuge at 12000rpm for 10min. Then, pour out the liquid, being careful not to pour out the precipitate. Wash twice with 5ml 75% ethanol, the remaining small amount of liquid can be collected by centrifugation again, and then sucked out with a pipette tip. Then, blow dry on the clean bench or dry at room temperature (DNA samples should not be too dry, otherwise it will be difficult to dissolve), add 100ul EB to dissolve the DNA sample. Then, add 2ul RNase A, mix well by inversion, and incubate at 37℃ for 15min. Analyze the purity and integrity of DNA by agarose gel electrophoresis; use Nanodrop to detect the purity of DNA (OD260 / 280 ratio), and use Qubit to accurately quantify the DNA concentration.

[0021] The qualified DNA samples were randomly broken into fragments of 350 bp in length by Covaris crusher. The library was constructed using NEBNext® Ultra™ II DNA Library Prep Kit. The DNA fragments were repaired by end repair, ployA tailing, sequencing adapters, purification, PCR amplification and other steps to complete the entire library preparation. The constructed Russian library was checked by Qubit2.0, Agilent 5300 and Q-PCR methods. After the library was qualified, each library was sequenced by Illumina NovaseqTM PE150 at Novogene Technology Co. (Tianjin, China). After strict filtering of the sequencing data, high-quality data were obtained for subsequent analysis. The sequencing data results are shown in Table 1.

[0022] Table 1 Summary of sequencing data quality

[0023] The filtered valid data were aligned to the reference genome of the swimming crab by Burrows-Wheeler alignment tool (BWA) software (parameters: mem-t4-k32-M), and the alignment results were deduplicated by SAMTOOLS (parameters: rmdup). The alignment results showed that the average alignment rate of all samples was 98.3% ±1.7%, and the average sequencing depth was 15.91±3.49X, which can be used for subsequent analysis.

[0024] 2. Marker detection and annotation SNP detection was performed using VCFTOOLS and other software to ensure that the detected SNPs met the following principles: (1) sequencing coverage depth was not less than 6; (2) the deletion ratio of a single site was less than 0.1; (3) MAF (minimum allele frequency) was greater than 0.05; (4) the chi-square test of whether the marker genotype conformed to Hardy-Weinberg equilibrium (HWE) (P ≥ 1 × 10-6). The 38,735,045 SNP markers obtained were filtered to obtain 4,541,126 high-quality SNP markers.

[0025] 3. Genomewide association study (GWAS) Combined with the experimental individual weight data, GEMMA software was used to conduct trait association analysis using a mixed linear model (MLM). The first three principal components of PCA were used as fixed effects, and sex was added as a covariate and individual kinship as a random effect to correct for the effects of population structure and individual kinship: y = Xα + Zβ + Wμ + e y is the phenotypic trait, X is the indicator matrix of fixed effects, α is the estimated parameter of fixed effects; Z is the indicator matrix of SNPs, β is the effect of SNPs; W is the random matrix of random effects, μ is the predicted random individual, e is the random residual, and obeys e~(0,δe2).

[0026] The SNP GWAS threshold was set at P < 10 -5 A total of 47 SNP markers significantly associated with body weight were detected. The results of candidate SNPs are shown in Table 2.

[0027] Table 2 Statistical results of SNP marker detection and annotation

[0028] 2. Validation of Molecular Markers Related to Growth Traits PCR product sequencing was used to verify candidate molecular markers of growth traits in large and small body weight individuals: (1) First, design primers on the flanking sequences of the marker sites; (2) Use the designed primers to perform PCR amplification with DNA materials from 15 large-weight individuals and 16 small-weight individuals as templates, and sequence the successfully amplified PCR products. The sequencing primers are selected to be farther away from the marker site; (3) Use SnapGene software to analyze the sequencing peak graph and calculate the genotype of each individual based on the sequencing results.

[0029] The specific steps are as follows: 1. PCR amplification The PCR system in the present invention is: template 2 μl, forward primer (10 μM) 0.8 μl, reverse primer (10 μM) 0.8 μl, 2×Rapid Taq Master Mix (Novozyme) 10 μl, ddH2O 6.4 μl.

[0030] After adding the sample according to the above system, PCR amplification was performed according to the following reaction conditions: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 40 s, repeated for 35 cycles; final extension at 72°C for 5 min; and storage at 4°C.

[0031] 2. Electrophoresis detection Use agarose to prepare 1% electrophoresis gel, mix agarose and TAE in a certain ratio, heat in a microwave oven until dissolved into a colorless and transparent liquid, pour into the gel mold and insert a comb, let it stand for 20 minutes to solidify, then pull out the comb, put the prepared agarose gel into the horizontal electrophoresis tank, the sample well is located at the negative pole, use 1× TAE as the buffer, choose Genegreen as the nucleic acid stain, use a pipette to aspirate 6μl of the PCR product of the mixed template and spot it into the sample well, then adjust the voltage and current to 120V and 60mA respectively, set the time to 30min for gel electrophoresis, and stop when the band in the stained area reaches 2 / 3 of the gel. After the electrophoresis, use the gel imaging system to observe and take pictures, select the bright samples with a single band and send them to Bioengineering for DNA sequencing, and perform data image analysis on the returned sequencing results.

[0032] 3. Statistical analysis The sequencing results of the returned large-weight and small-weight individuals were observed using SnapGene software, and the genotype information was statistically analyzed to calculate the average weight of the TT and CC2 genotypes.

[0033] As shown in Table 3, when the genotype of the 46:1809915 site (K678) of the sampled swimming crab is TT, its average weight is 149.97; when the genotype is CC, its average weight is 85.77. It can be seen that the average weight of the swimming crab K678 marker when the genotype is TT is CC. The nucleotide sequence of the K678 molecular marker is shown in SEQ ID No. 1, and the amplification primers developed for the molecular marker are shown in SEQ ID No. 2 and SEQ ID No. 3.

[0034] SEQ ID No.1: Tcttcctcttcttgtgacttaatagggcacttcacttattttgaggccagtttccttttactttcgtcttttttacttcctatgcattatttt ccttatggagtatgtatttctagttatttttttttccctacaaaaaagtaacgttgttttaccccggcggcggtttattctgggtatgcttag.

[0035] Table 3 Genotype results of K678 molecular marker

[0036] Table 4 Amplification primers for K678 molecular marker .

[0037] Example 2 The molecular marker K678 obtained by the present invention can be used to assist in the selection of growth-advantage varieties of swimming crabs. The application steps are briefly as follows: extract DNA of a swimming crab test sample and use it as a template, use the amplification primers K678-F and K678-R of the molecular marker K678 for PCR amplification, and sequence the PCR product. If the genotype of the 117th base of K678 in the sequencing result is TT, the test sample can be selected as a parent for cultivating a growth-advantage variety of swimming crabs. In addition, the molecular marker K678 can also be used to analyze the genetic diversity and germplasm identification of swimming crabs.

[0038] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A molecular marker K678 related to the growth traits of Portunus trituberculatus, characterized in that: The nucleotide sequence of the molecular marker K678 is shown in SEQ ID No.

1.

2. The molecular marker K678 according to claim 1, characterized in that The 117th base of the molecular marker K678 is T or C.

3. The molecular marker K678 according to claim 2, characterized in that: The genotype TT of the 117th base of the molecular marker K678 is a growth advantage trait genotype.

4. The amplification primers for the molecular marker K678 according to claim 1, characterized in that: The nucleotide sequences of the forward primer and the reverse primer of the amplification primer are shown as SEQ ID No.2 and SEQ ID No.

3.

5. Use of the molecular marker K678 described in claim 1 or the amplification primer described in claim 4 in screening varieties with growth-dominant traits of swimming crabs.

6. The use according to claim 5, characterized in that: The steps of screening varieties with advantageous growth traits of swimming crabs are as follows: extracting DNA of a sample of swimming crabs to be tested and using it as a template, performing PCR amplification using amplification primers of molecular marker K678, and sequencing the PCR products; if the genotype of the 117th base of K678 in the sequencing result is TT, the sequenced sample is selected as a parent for breeding a fast-growing variety of swimming crabs.

7. The use according to claim 6, characterized in that: The PCR amplification system is: template 2 μl, forward primer 0.8 μl, reverse primer 0.8 μl, 2×Rapid Taq Master Mix 10 μl, ddH2O 6.4 μl.

8. The use according to claim 6, characterized in that: The PCR amplification procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 40 s, repeated for 35 cycles in total; and final extension at 72°C for 5 min.

9. A kit for breeding fast-growing varieties of swimming crabs, characterized in that: The kit contains the molecular marker K678 described in claim 1 and / or the amplification primer described in claim 4.

10. Use of the molecular marker K678 according to claim 1 in genetic diversity analysis, germplasm identification and genetic map construction of Portunus trituberculatus.

Images