Molecular marker associated with hypoxia resistance of silver carp, gene and application

Abstract

The invention relates to the technical field of hypoxia-resistant silver carps, in particular to a molecular marker associated with hypoxia resistance of silver carps, a gene and application. The molecular marker comprises C and T single nucleotide polymorphism of 29647765th nucleotide of the LG8 chromosome number of silver carp, and the gene is CTSC. The molecular marker and the gene are both associated with hypoxia resistance. The hypoxia-resistant silver carp variety can be obtained by screening CC genotype individuals at the molecular marker or screening individuals with low gene expression quantity and expression deficiency, and technical support is provided for breeding hypoxia-resistant silver carp, increasing the breeding yield and reducing the economic loss of breeding.

Description

Technical Field

[0001] The technical field of hypoxia-resistant silver carp of the present application specifically relates to molecular markers, genes and applications associated with hypoxia-resistant silver carp. Background Art

[0002] Silver carp (Hypophthalmichthys molitrix) has the advantages of a short food chain, easy breeding, low cost and the ability to regulate water quality. It has become one of the important freshwater aquaculture species in my country, and its aquaculture output ranks second among freshwater fish aquaculture outputs all year round. At present, the silver carp aquaculture industry has problems such as "slow growth, poor stress resistance, and low survival rate" and other problems of germplasm degradation. In addition, silver carp has poor tolerance to low oxygen in water bodies. When the dissolved oxygen in the water is low, it is easy to float, suffocate, and "flood the pond" during the aquaculture process, causing huge economic losses to the majority of farmers.

[0003] Therefore, screening or cultivating silver carp species or groups that are resistant to low oxygen has a very significant positive effect on the silver carp farming industry. Summary of the invention

[0004] The invention of this application creatively discovered that the C and T single nucleotide polymorphisms present in the nucleotide at position 29647765 of chromosome LG8 of silver carp are associated with its hypoxia resistance, and the CC genotype is the dominant genotype. To this end, this application uses the genotype detection of the SNP site to quickly screen silver carp varieties or groups that are resistant to hypoxia from the silver carp population, providing technical support for breeding to obtain hypoxia resistance and increase aquaculture production, and reduce aquaculture economic losses.

[0005] To this end, the embodiments of the present application disclose at least the following technical solutions:

[0006] In a first aspect, the embodiments disclose molecular markers associated with hypoxia tolerance in silver carp, including a nucleotide sequence formed by the presence of C and T single nucleotide polymorphisms at position 29647765 of chromosome number (CM084784.1) of the silver carp (Hypophthalmichthys molitrix) genome (GCA_041475455.1).

[0007] In a second aspect, the embodiments disclose a nucleic acid, such as a nucleotide sequence shown in SEQ ID NO:23 and / or SEQ ID NO:24.

[0008] In a third aspect, the embodiment discloses a primer pair for detecting the molecular marker described in the first aspect, and the nucleotide sequence of the primer pair is shown in SEQ ID NO:1 and SEQ ID NO:2.

[0009] In a fourth aspect, an embodiment discloses a method for detecting the molecular marker described in the first aspect, the method comprising the following steps: extracting genomic DNA of the silver carp to be tested; performing PCR amplification on the genomic DNA of the silver carp to be tested to obtain a PCR amplification product; sequencing the PCR amplification product to obtain a sequencing result; based on the sequencing result, interpreting the genotype of the nucleotide at position 29647765 of chromosome number (CM084784.1) of chromosome LG8 of the silver carp (Hypophthalmichthys molitrix) genome (GCA_041475455.1).

[0010] In a fifth aspect, an embodiment discloses a method for breeding a hypoxia-tolerant silver carp strain, the method comprising the following steps: detecting the genotype of the nucleotide at position 29647765 of chromosome number (CM084784.1) of LG8 of the silver carp (Hypophthalmichthys molitrix) genome (GCA_041475455.1), selecting individuals with a genotype of CC as breeding silver carp, or detecting individuals with a nucleotide at position 29647765 of silver carp being T as breeding silver carp.

[0011] In the sixth aspect, the embodiment discloses the use of the molecular marker described in the first aspect, the nucleic acid described in the second aspect, and the primer pair described in the third aspect in screening hypoxia-resistant silver carp strains, wherein the molecular marker includes a nucleotide sequence formed by the presence of C and T single nucleotide polymorphisms at the 29647765th nucleotide of chromosome number CM084784.1 on LG8 of the silver carp genome.

[0012] The application is selected from at least one of the following: detecting the single nucleotide polymorphism of the nucleotide at position 29647765 of chromosome number CM084784.1 of LG8 of silver carp genome; detecting the genotype of the nucleotide at position 29647765 of chromosome number CM084784.1 of LG8 of silver carp genome; detecting the hypoxia resistance of silver carp; breeding hypoxia resistant silver carp strains; improving the survival rate of hypoxia resistant silver carp; improving the venous hemoglobin concentration of hypoxia resistant silver carp; improving the antioxidant enzyme activity of silver carp; improving the structural integrity of the gills of hypoxia resistant silver carp; reducing neuronal damage of hypoxia resistant silver carp; reducing the number of apoptotic brain cells of hypoxia resistant silver carp; reducing the expression of CTSC gene of hypoxia resistant silver carp; improving the antioxidant performance of silver carp; reducing the damage of hypoxia resistant silver carp;

[0013] In a seventh aspect, the embodiments disclose a gene associated with hypoxia tolerance in silver carp, the nucleotide sequence of which is shown in nucleotides 29637713 to 29646638 of chromosome number (CM084784.1) of LG8 of the silver carp (Hypophthalmichthys molitrix) genome (GCA_041475455.1).

[0014] In an eighth aspect, an embodiment discloses an application of the CTSC gene, the nucleotide sequence of the CTSC gene is shown in SEQ ID NO:, and the application selects at least one of the following: screening hypoxia-resistant silver carp strains; down-regulating CTSC gene expression, wherein the down-regulation includes knocking out or deleting HIF-1α binding sites; detecting hypoxia-resistant silver carp performance; breeding hypoxia-resistant silver carp strains; improving the survival rate of hypoxia-resistant silver carp; improving the venous hemoglobin concentration of hypoxia-resistant silver carp; increasing the activity of antioxidant enzymes of silver carp; improving the structural integrity of the gills of hypoxia-resistant silver carp; reducing neuronal damage in hypoxia-resistant silver carp; reducing the number of apoptotic brain cells in hypoxia-resistant silver carp; improving the antioxidant properties of silver carp; and reducing damage to hypoxia-resistant silver carp. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 A diagram of the water tank structure for testing the hypoxia tolerance of different genotypes provided in the examples.

[0016] Figure 2 Survival curves of individuals with TT (blue), TC (orange) and CC (red) genotypes (n=20) under hypoxic stress provided in the examples. There is a significant statistical difference between the TT genotype and the TC genotype, *p<0.05.

[0017] Figure 3 The results of changes in the number of red blood cells (A), hemoglobin concentration (B), SOD activity (C) and CAT activity (D) of individuals of the three genotypes under hypoxic conditions provided in the examples. Dates are expressed as mean ± SD (n = 3). Hy_0h refers to normal hypoxia, indicating no exposure to a hypoxic environment. Hy_24h means exposure to hypoxia (2 mg / L) for 24 hours. Blue represents the TT genotype, orange represents the TC genotype, and red represents the CC genotype. Different letters represent statistically significant differences between the three genotypes at a single time point (P < 0.05). Asterisks indicate that the differences between the same genotype at two time points are statistically significant ( * P<0.05, ** P<0.01, *** P<0.001).

[0018] Figure 4 The examples provide the results of structural changes in the gills of three genotype individuals under hypoxic conditions. Figure 4 A is a scanning electron microscope image. Figure 4 B is a HE staining image, in which the green arrow indicates the gill lamella, and the red arrow indicates the interlamellar cell cluster between two adjacent gill lamellae. Figure 4 C is the statistical results of gill surface area under normoxic and anoxic conditions. Figure 4D is the thickness of the gill interlamellar matrix (ILCM) under normoxic and hypoxic conditions. Dates are shown as mean ± SD (n = 3). Hy_0h indicates normal hypoxic state, indicating no exposure to hypoxia. Hy_24h indicates exposure to hypoxia (2 mg / L) for 24 h. Different letters indicate that the differences among the three genotypes under hypoxia are statistically significant (P < 0.05). Asterisks indicate that the differences between the same genotype at two time points are statistically significant ( ** P<0.01, *** P<0.001).

[0019] Figure 5 The results of TUNEL staining of brain tissues of individual fish of three genotypes under hypoxic conditions are provided in the examples. Figure 5 A is a light microscope image under 24h hypoxia, in which apoptotic cells are brown and normal cells are light blue. The right image is an enlarged image of the area in the red frame in the left image. Figure 5 B is a fluorescence micrograph under 24 h of hypoxia. In the figure, green fluorescence indicates apoptotic cells, blue fluorescence indicates DAPI-stained cell nuclei, and the white box in the upper right corner of the figure represents an enlarged view of the area delineated by the dotted line. Figure 5 C is a statistical diagram of the apoptosis rate of subcranial cells detected by light microscopy under 24 h hypoxia conditions. In the figure, the date is represented by mean ± SD (n = 3), and different letters indicate significant differences (P < 0.05). Figure 5 D is a statistical graph of brain apoptosis rate detected by fluorescence microscopy under 24h hypoxia conditions. In the figure, the date is represented by mean±SD (n=3), and different letters indicate significant differences (P<0.05).

[0020] Figure 6 Schematic diagram of the CTSC gene structure (A) and the schematic diagram of the structure of the molecular marker (B) provided in the examples. Figure 6 In A, ovals represent the core promoter region and boxes represent exons. Figure 6 In B, the box represents the Hif-1α binding site, the oval represents the core promoter region, and the arrow is the molecular marker.

[0021] Figure 7 A is a statistical graph of the expression of CTSC genes in the heart of individuals with three genotypes under hypoxic conditions provided in the example. Hy_0h refers to normal hypoxia, indicating no exposure to a hypoxic environment. Dates are shown as mean ± SD (n = 3). Hy_24h indicates exposure to hypoxia (2 mg / L) for 24 h. Different letters indicate that the differences between the three genotypes under hypoxic conditions are statistically significant (P < 0.05). Asterisks indicate that the differences between the same genotype at two time points are statistically significant ( ** P<0.01, *** P<0.001).

[0022] Figure 7 B is a statistical graph of the expression of CTSC genes in the brain of individuals with three genotypes under hypoxic conditions provided in the example. Hy_0h refers to normal hypoxia, indicating no exposure to a hypoxic environment. Dates are shown as mean ± SD (n = 3). Hy_24h indicates exposure to hypoxia (2 mg / L) for 24 h. Different letters indicate that the differences between the three genotypes under hypoxic conditions are statistically significant (P < 0.05). Asterisks indicate that the differences between the same genotype at two time points are statistically significant ( ** P<0.01, *** P<0.001).

[0023] Figure 7 C is a statistical graph of the expression of CTSC genes in the liver of individuals with three genotypes under hypoxic conditions provided in the example. Hy_0h refers to normal hypoxia, indicating no exposure to a hypoxic environment. Dates are shown as mean ± SD (n = 3). Hy_24h indicates exposure to hypoxia (2 mg / L) for 24 h. Different letters indicate that the differences between the three genotypes under hypoxia are statistically significant (P < 0.05). Asterisks indicate that the differences between the same genotype at two time points are statistically significant ( ** P<0.01, *** P<0.001).

[0024] Figure 7 D is a statistical graph of the expression of CTSC genes in gills of individuals of the three genotypes under hypoxia provided in the examples. Hy_0h refers to normal hypoxia, indicating that there is no exposure to hypoxia. Different letters indicate that the differences between the three genotypes under hypoxia are statistically significant (P<0.05). Asterisks indicate that the differences between the same genotype at two time points are statistically significant ( ** P<0.01, *** P<0.001). Dates are shown as mean ± SD (n = 3). Hy_24h indicates exposure to hypoxia (2 mg / L) for 24 h. Different letters indicate that the differences among the three genotypes under hypoxia are statistically significant (P<0.05). Asterisks indicate that the differences between the same genotype at two time points are statistically significant ( ** P<0.01, *** P<0.001).

[0025] Figure 8Statistical graphs of the relative expression of GOT1 (A), LYZ (B), angpt2 (C) and IL-6R (D) gene mRNA in the livers of individuals with three genotypes under hypoxic conditions provided in the examples. Dates are expressed as mean ± SD (n = 3). Hy_0h represents a normal hypoxic state, indicating no exposure to a hypoxic environment. Hy_24h represents exposure to hypoxia (2 mg / L) for 24 hours. Blue represents the TT genotype, orange represents the TC genotype, and red represents the CC genotype. Different letters indicate that the differences between the three genotypes under hypoxic conditions are statistically significant (P < 0.05). Asterisks indicate that the differences between the same genotype at two time points are statistically significant ( * P<0.05, ** P<0.01, *** P<0.001). DETAILED DESCRIPTION

[0026] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0027] In this application, the silver carp genome and chromosomes are numbered using the NCBI and Genbank database numbers.

[0028] The inventor of the present application obtained a significantly associated SNP locus from the 52 SNP loci related to oxygen consumption rate of silver carp. The SNP locus is a single nucleotide polymorphism of C and T at the 29647765th nucleotide of chromosome number (CM084784.1) of the silver carp (Hypophthalmichthys molitrix) genome (GCA_041475455.1) on LG8.

[0029] The inventors of the present application further discovered that the genotypes of the SNP individual include TT genotype, TC genotype and CC genotype, wherein the CC genotype is a hypoxia-resistant genotype, the CC genotype is a dominant genotype for hypoxia resistance, and C is a dominant allele for hypoxia resistance.

[0030] The inventors of the present application further found that the red blood cell count, hemoglobin (Hb) concentration, gill lamella respiratory area, gill lamella interlamellar matrix (ILCM) thickness and number of brain cell apoptosis in individuals with CC genotype were also significantly different from those of individuals with other genotypes.

[0031] Based on this, the embodiment discloses a molecular marker associated with hypoxia tolerance of silver carp, including a nucleotide sequence formed by the presence of C and T single nucleotide polymorphisms in the 29647765th nucleotide of chromosome number (CM084784.1) of the silver carp (Hypophthalmichthysmolitrix) genome (GCA_041475455.1).

[0032] Based on this, the embodiments disclose a nucleic acid, such as the nucleotide sequence shown in SEQ ID NO:23 and / or SEQ ID NO:24.

[0033] Based on this, the embodiment discloses a primer pair for detecting molecular markers, and the nucleotide sequences of the primer pair are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0034] Based on this, the embodiment discloses a method for detecting molecular markers, which comprises the following steps: extracting genomic DNA of silver carp to be tested; performing PCR amplification on the genomic DNA of silver carp to be tested to obtain a PCR amplification product; sequencing the PCR amplification product to obtain a sequencing result; based on the sequencing result, interpreting the genotype of the nucleotide at position 29647765 of chromosome number (CM084784.1) of chromosome LG8 of silver carp (Hypophthalmichthys molitrix) genome (GCA_041475455.1).

[0035] In a fifth aspect, an embodiment discloses a method for breeding a hypoxia-tolerant silver carp strain, the method comprising the following steps: detecting the genotype of the nucleotide at position 29647765 of chromosome number (CM084784.1) of LG8 of the silver carp (Hypophthalmichthys molitrix) genome (GCA_041475455.1), selecting individuals with a genotype of CC as breeding silver carp, or detecting individuals with a nucleotide at position 29647765 of silver carp being T as breeding silver carp.

[0036] In the sixth aspect, the embodiment discloses the use of the molecular marker described in the first aspect, the nucleic acid described in the second aspect, and the primer pair described in the third aspect in screening hypoxia-resistant silver carp strains, wherein the molecular marker includes a nucleotide sequence formed by the presence of C and T single nucleotide polymorphisms at the 29647765th nucleotide of chromosome number CM084784.1 on LG8 of the silver carp genome.

[0037] In the sixth aspect, the embodiment discloses the use of the molecular marker described in the first aspect, the nucleic acid described in the second aspect, and the primer pair described in the third aspect in screening hypoxia-resistant silver carp strains, wherein the molecular marker includes a nucleotide sequence formed by the presence of C and T single nucleotide polymorphisms at the 29647765th nucleotide of chromosome number CM084784.1 on LG8 of the silver carp genome.

[0038] The application is selected from at least one of the following:

[0039] Detection of single nucleotide polymorphism at position 29647765 of chromosome CM084784.1 on LG8 of silver carp genome

[0040] The genotype of nucleotide 29647765 of chromosome number CM084784.1 on LG8 of silver carp genome was detected;

[0041] Testing the hypoxia resistance of silver carp;

[0042] Breeding silver carp strains tolerant to hypoxia;

[0043] Improve the survival rate of hypoxia-tolerant silver carp;

[0044] Improve the venous hemoglobin concentration of hypoxia-tolerant silver carp;

[0045] Improve the antioxidant enzyme activity of silver carp;

[0046] Improve the structural integrity of the gills of hypoxia-tolerant silver carp;

[0047] Reduce neuronal damage in hypoxia-tolerant silver carp;

[0048] Reduce the number of apoptotic cells in the brain of hypoxia-tolerant silver carp;

[0049] Reduce the expression of CTSC gene in hypoxia-tolerant silver carp;

[0050] Improve the antioxidant properties of silver carp;

[0051] Reduce damage to hypoxia-tolerant silver carp;

[0052] The embodiment discloses a gene associated with hypoxia tolerance in silver carp, and the nucleotide sequence thereof is shown in nucleotides 29637713 to 29646638 of chromosome number (CM084784.1) of LG8 of silver carp (Hypophthalmichthys molitrix) genome (GCA_041475455.1).

[0053] The embodiment discloses the application of the CTSC gene, the nucleotide sequence of the CTSC gene is shown in SEQ ID NO:, and the application selects at least one of the following:

[0054] Screening of silver carp strains tolerant to hypoxia;

[0055] Down-regulating CTSC gene expression, including knocking out or deleting HIF-1α binding sites;

[0056] Testing the hypoxia resistance of silver carp;

[0057] Breeding silver carp strains tolerant to hypoxia;

[0058] Improve the survival rate of hypoxia-tolerant silver carp;

[0059] Improve the venous hemoglobin concentration of hypoxia-tolerant silver carp;

[0060] Improve the antioxidant enzyme activity of silver carp;

[0061] Improve the structural integrity of the gills of hypoxia-tolerant silver carp;

[0062] Reduce neuronal damage in hypoxia-tolerant silver carp;

[0063] Reduce the number of apoptotic cells in the brain of hypoxia-tolerant silver carp;

[0064] Improve the antioxidant properties of silver carp;

[0065] Reduce damage to hypoxia-tolerant silver carp;

[0066] The following will illustrate the implementation of the present application in conjunction with more specific examples, but does not constitute a limitation on the implementation of the present application.

[0067] 1. Experimental Animals

[0068] Experimental animals Changfeng silver carp were obtained from the Changfeng silver carp breeding farm in Xishui City, Hubei Province. 5000 Changfeng silver carp (weight 14.52±4.3g, body length 9.5±1.2cm) were randomly selected from the same pond and transferred to the National Silver Carp Genetic Resources Farm in Ezhou City, Hubei Province, and raised in ponds using dechlorinated circulating tap water. Subsequently, these fish were raised in ponds using dechlorinated circulating tap water. The breeding conditions were maintained at a temperature of 25±0.1℃ and a dissolved oxygen concentration of 7.0±0.5mL / L for 7 days.

[0069] 2. Screening of SNPs associated with hypoxia tolerance in Changfeng silver carp

[0070] 1150 individuals were placed in 23 fish tanks with dimensions of 51 cm × 38 cm × 29 cm, with 50 fish in each tank. By covering the top of the fish tank with plastic film, the dissolved oxygen level in the water gradually decreased due to the respiration of the fish. The dissolved oxygen was monitored using a portable multi-parameter meter. Loss of balance was selected as an indicator of hypoxia, taking into account physiological and behavioral determinants. As the duration of hypoxia increased, individual fish in each tank began to lose balance. The first five fish to lose balance were designated as the hypoxia-intolerant group, at which time the average dissolved oxygen concentration recorded was 0.34 mL / L; subsequently, as more fish lost balance, the last five remaining fish were classified as the hypoxia-tolerant group, at which time the average dissolved oxygen concentration measured was 0.24 mL / L. A total of 115 Changfeng silver carp were divided into a hypoxia-tolerant group and a hypoxia-intolerant group. The tail fins of the hypoxia-intolerant group and the hypoxia-tolerant group were collected and stored in anhydrous ethanol.

[0071] Genomic DNA was extracted from the hypoxia-tolerant and hypoxia-intolerant groups using a genomic DNA extraction kit, followed by electrophoresis on a 1% agarose gel. Samples considered qualified were sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for genotyping using the SNPshot method. Due to the failure of amplification of two samples in the hypoxia-tolerant group, a total of 113 results were obtained. The chi-square test was used to analyze the genotype frequencies of the 52 SNP loci associated with the oxygen consumption rate in the hypoxia-tolerant and non-hypoxia-tolerant groups, and the SNP loci significantly associated with the hypoxia-tolerant trait were identified.

[0072] As shown in Table 1, a significantly associated SNP locus was obtained from the 52 SNP loci associated with the oxygen consumption rate of silver carp. The SNP locus is a C and T single nucleotide polymorphism at the 29647765th nucleotide of chromosome number (CM084784.1) of the silver carp (Hypophthalmichthys molitrix) genome (GCA_041475455.1) on LG8.

[0073] Table 1. Chi-square test of SNPs genotypes in hypoxia-tolerant and hypoxia-intolerant groups

[0074]

[0075]

[0076] 3. Detection of SNP genotype

[0077] The embodiment also provides a method for detecting the genotype of the nucleotide at position 29647765 of chromosome number (CM084784.1) of LG8 of silver carp (Hypophthalmichthys molitrix) genome (GCA_041475455.1). The method comprises: extracting genomic DNA of the silver carp to be tested; performing PCR amplification on the genomic DNA of the silver carp to be tested to obtain a PCR amplification product; sequencing the PCR amplification product to obtain a sequencing result; and based on the sequencing result, interpreting the genotype of the nucleotide at position 29647765 of chromosome number (CM084784.1) of LG8 of the silver carp (Hypophthalmichthys molitrix) genome (GCA_041475455.1).

[0078] Wherein, the primer pair shown in SEQ ID NO: 3 and SEQ ID NO: 4 was used for PCR amplification.

[0079] The genotypes of the nucleotide at position 29647765 of chromosome LG8 detected by the above steps include TT genotype, TC genotype and CC genotype. Genomic DNA was extracted from 300 Changfeng silver carp tail fin samples, and after the above steps, a total of 83 TT genotypes, 165 TC genotypes and 52 CC genotypes were detected.

[0080] In order to evaluate the hypoxia tolerance of different genotypes of silver carp in Changfeng, twenty fish from each of the three genotypes (TT, TC and CC) were selected for the experiment. Figure 1 The three genotypes were separated by a porous divider in a tank with dimensions of 70 cm × 53 cm × 37 cm as shown. The tank was sealed with plastic film to promote natural oxygen consumption, and the time when the fish lost balance and failed to regain normal posture within 10 seconds was recorded as the endpoint.

[0081] Survival rate is an important indicator of the ability of fish to tolerate low oxygen levels. At the same dissolved oxygen concentration, fish that flipped later showed a stronger ability to adapt to low dissolved oxygen levels.

[0082] like Figure 2 As shown in the figure, the survival rate of CC genotype individuals was significantly higher than that of TT genotype individuals (P<0.05). This indicates that CC genotype may have a better ability to adapt to hypoxic environment, thereby prolonging survival time, and CC genotype is the dominant genotype for hypoxia resistance.

[0083] 4. Blood analysis and enzyme activity detection of three genotype individuals

[0084] The hematological indicators of fish reflect their physiological state and health status, and hypoxia stress significantly affects their blood composition. The oxygen-carrying capacity of blood is related to the red blood cell count, and fish respond to hypoxia by increasing the red blood cell count.

[0085] In this test, 30 TT genotype Changfeng silver carp, 30 TC genotype Changfeng silver carp and 30 CC genotype Changfeng silver carp were placed in a circular pool for continuous hypoxia test. Hypoxia was achieved by directly pumping nitrogen into the water to reach 2 mg / L of dissolved oxygen, cutting off the nitrogen supply, and using slow aeration to maintain the dissolved oxygen content at 2 ± 0.3 mg / L. A portable multi-parameter instrument was used to monitor dissolved oxygen every 20 min and adjusted as needed to maintain hypoxia. At 0 h (Hy_0h) and 24 h (Hy_24h) ​​after the start of the experiment, the fish were anesthetized with 100 mg / L of MS-222 and the blood, liver, brain, heart and gill tissues of 15 fish of each genotype were collected. The samples used for hematoxylin-eosin (H&E) staining and TUNEL staining were fixed with Boun's solution; the tissue samples used for electron microscopy observation were fixed with glutaraldehyde solution; the tissue samples used for enzyme activity determination and RNA extraction were immediately frozen with liquid nitrogen and stored at -80°C.

[0086] Blood was drawn from the tail vein of the individuals of the three genotypes using a 1 mL plastic syringe flushed with heparin, and the hemoglobin concentration and red blood cell count were quantitatively determined using a blood analyzer.

[0087] Liver tissue samples of individuals with three genotypes were homogenized in ice-cold phosphate buffer (0.1 M, pH 7.4) at a ratio of 1:9 (weight / volume). Subsequently, the resulting homogenate was centrifuged at 3000 g for 10 min at 4 °C. Then, the supernatant was collected and the superoxide dismutase (SOD) and catalase (CAT) were measured three times in parallel for each genotype using the corresponding commercial kits. All enzyme analyses were performed within 12 h after the above treatment. Detailed information on the detection kits used is shown in Table 2.

[0088] Table 2 Detection kits used in this test

[0089] Reagent test kit factory Product Number CATassayKit NanjingJianchengBio. A007-2-1 SODassaykit NanjingJianchengBio. A001-1-2

[0090] like Figure 3B. Under normoxic conditions, the hemoglobin concentrations of individuals with TT, TC, and CC genotypes were 224.00 g / L, 280.67 g / L, and 294.75 g / L, respectively. After 24 hours of hypoxia, the hemoglobin concentrations of individuals with TT, TC, and CC genotypes were 258.40 g / L, 322.00 g / L, and 332.33 g / L, respectively. It is worth noting that the hemoglobin concentrations of CC and TC genotypes were significantly higher than those of TT genotype (P<0.05). This indicates that individuals with CC genotypes exhibit higher hemoglobin oxygen affinity and improve their oxygen carrying capacity.

[0091] like Figure 3 C and Figure 3 D, The activities of SOD and CAT in the serum of individuals with TT, TC, and CC genotypes increased with the duration of hypoxic stress. It is worth noting that after 24 hours of hypoxia, the antioxidant enzyme activity of CC genotype was significantly higher than that of TT and TC genotypes (P<0.05).

[0092] Oxidative stress stimulates the organism to activate antioxidant defense mechanisms, thereby maintaining dynamic balance and improving the resistance of fish. In the antioxidant system, the first to occur is a series of antioxidant enzymatic reactions. Superoxide dismutase (SOD) and catalase (CAT) are important antioxidant enzymes that can remove superoxide anion radicals (O2-) and peroxides in the body and protect organisms from oxidative damage. In the present application, the antioxidant enzyme activities, including CAT and superoxide dismutase (SOD), of the three genotypes under hypoxic stress showed significant differences (P<0.05). The higher levels of SOD and CAT observed in the CC genotype indicate that the organism has adopted a potential adaptive mechanism to protect tissues from hypoxic damage. Under hypoxic conditions, fish regulate their antioxidant systems by increasing the activity of various antioxidant enzymes, thereby reducing or maintaining oxidative stress within a controllable range.

[0093] 5. Observation of gill structure

[0094] The three genotypes were treated with hypoxia using the same method as the market test. The gill tissues of the three genotypes were taken and observed with light microscopy and electron microscopy after HE staining. The gill morphological parameters were measured using Image J software. Ten fields of view were randomly selected in each group for measurement, including 10 gill lamellae and 10 pseudopodia randomly selected from three repeated experiments for each genotype. The measurement was to evaluate the changes in the respiratory area of ​​the gill lamellae and the thickness of the middle layer matrix.

[0095] like Figure 4As shown in A and 4B, under normoxic conditions, there were no significant differences in the gill lamellae area or thickness of the gill lamellae mesenchyme among the three genotypes. After 24 h of hypoxia, the gill lamellae surface area increased and the thickness of the gill lamellae mesenchyme decreased in all three genotypes.

[0096] like Figure 4 As shown in C, under normal oxygen conditions, the gill lamellae of individuals with TT genotype have an area of ​​9957.54 μm 2 , while the gill lamellae of CC genotype individuals had an area of ​​9619.69 μm 2 After 24 h of hypoxia, the gill lamellae of TT genotype individuals increased to 17820.20 μm 2 , while the gill lamellae of CC genotype individuals have an area of ​​12255.14 μm 2 This showed that the gill lamellae area of ​​individuals with TT genotype was significantly larger than that of individuals with CC genotype (P<0.05).

[0097] The thickness of the gill cell mass between two adjacent gill lamellae is the thickness of the gill interstitium. Figure 4 As shown in D, under normal oxygen conditions, the gill interstitial thickness of the TT genotype individuals is 26.93 microns, and the gill interstitial thickness of the CC genotype individuals is 25.31 microns. After 24 hours of hypoxia treatment, the gill interstitial thickness of the TT genotype individuals decreased to 20.66 microns, and the gill interstitial thickness of the CC genotype individuals decreased to 24.41 microns. This shows that the gill interstitial thickness of the CC genotype individuals is significantly smaller than that of the TT genotype individuals. As the surface area of ​​the gill filaments increases, the thickness of the gill interstitial increases accordingly, which increases the area for gas exchange with the surrounding water. After hypoxia treatment, the TT genotype individuals showed more significant structural changes than the CC genotype individuals (P<0.05).

[0098] These results suggest that under hypoxic conditions, individuals with the CC genotype maintained greater structural integrity of antioxidant enzyme activities and displayed a stronger ability to cope with hypoxic stress.

[0099] 6. TUNEL staining of brain tissue cell apoptosis

[0100] The three genotype individuals were subjected to hypoxia treatment using the same method as the above test. Brain tissues of the three genotype individuals were obtained and TUNEL staining was performed using a TUNEL detection kit (G1507-100T, G1501-100T, Servicebio, China). The cells were observed under an optical microscope and a fluorescent microscope. The ImageJ software randomly selected the field of view to measure the number of cells. The apoptotic rates (number of apoptotic brain cells / total number of brain cells) in the slices of the three different genotypes were compared. Each genotype was measured 10 times to detect apoptotic cells in the brain tissue.

[0101] like Figure 5 As shown in the figure, under normal oxygen conditions, there was no significant difference in the number of apoptotic cells in the brains of the three genotypes. However, after 24 hours of hypoxia, the number of apoptotic cells in the brains of individuals with the TT genotype was significantly higher than that of individuals with the TC and CC genotypes (P<0.05), and the number of apoptotic cells in the brain increased significantly. This shows that under the same hypoxic conditions, the TT genotype has an earlier imbalance of homeostasis, which means that it has an earlier oxidative damage, apoptosis and necrosis of neurons caused by hypoxia, which is not conducive to the cultivation of new hypoxia-resistant strains.

[0102] 7. Analysis of expression characteristics of CTSC genes

[0103] Genes within 100 kb upstream and downstream of the significant SNP were scanned, and the location of the SNP in the silver carp genome was used to determine the associated genes. The promoter sequence containing 2,000 base pairs upstream of the start codon of the SNP-associated gene was extracted using TBtools software. Subsequently, the sequence was submitted to the BDGP neural network promoter prediction tool (https: / / fruitfly.org / seq_tools / promoter.html) to identify the core promoter elements.

[0104] like Figure 6 As shown, the CTSC gene is located in the genome of silver carp (Hypophthalmichthys molitrix) (GCA_041475455.1) LG8 chromosome number (CM084784.1) at nucleotides 29637713 to 29646638, containing a complete sequence length of 8926 base pairs (bp), covering 8 exons and an open reading frame (ORF), which encodes a polypeptide consisting of 420 amino acids. The protein encoded by the CTSC gene is a member of the peptidase C1 family and a lysosomal cysteine ​​protease, which plays a key role in the regulation of the activation process of various serine proteases in cells of the immune system.

[0105] like Figure 6 As shown, the core promoter region of the CTSC gene is predicted to be located 605 to 655 base pairs upstream of the start codon ATG, and the single nucleotide polymorphism (SNP) associated with hypoxia tolerance (LG8:29647765, T / C) is located at 1130 nucleotides upstream of the CTSC gene.

[0106] The variation of single nucleotide polymorphisms leads to different numbers of hypoxia-inducible factor 1-α (HIF-1α) binding sites in the CTSC gene. The Jaspar database (https: / / jaspar.elixir.no) was used to predict the hypoxia-inducible factor (HIF) binding sites in the promoter region of SNP-related genes, and the relative profile score threshold (RPST) parameter was set to 80%.

[0107] like Figure 6 As shown, three HIF-1α binding sites (ACGTG) were consistently observed in all three genotypes. In addition, a unique HIF-1α binding site (CGTG) was identified in individuals with the T allele at LG8:29647765. Therefore, this binding site sequence (CGTG) is only present in the TT and TC genotypes. These findings imply that the differential expression of the CTSC gene in the CC genotype under hypoxic stress compared with the TT and TC genotypes may be due to changes in HIF-1α regulation. The 2000bp sequence upstream of the CTSC gene sequence and the HIF-1α binding site are shown below.

[0108] The 2000 bp sequence upstream of the CTSC gene promoter is as follows (SEQ ID NO: 23):

[0109] ACCCTGCAAAAAATCTACAGAGAGTTGTCACGTTCTTTTTTACATTTTCATTTCAATAAACTTTGTAATAAGAACAAAATGTTGTGTTGTTTTTGCATAAAATGGTAACACAAGAGCAGTGGTCTAAGGGGCCGTTTATATGACAGTTTTCAGCTAAAGACGGAAA ACTTTTATGCGTTTTGGACGTTCATTTACACAACAGCAGCACTGTGGGGGCCTCAAGATGTAAATTTTTGAAAACTGGTTTCAAAGTGCACGTTTTTGAAAACAAATAGTTATCGTCTGTGTAAACTACAAAAAAGCAAATTTCTGAAAATGGTGACGCGCATATT ACGTG(Hif-1α binding site) TTCAGTCTATAGGCCTACATGTTTTTTTACAAAGCGACATCGCCATCTACTGGCCTGGCAGCAGAATACAGCGTTTTTAATCATTTTTGCGGATCCGTGTGAACGGGGATCTTATGACAATGTTGTCGCCTGTACGCGAAAAACGCAAAGGAAAGACTTTTCTGTTTTTAGTATATAGTTGTCATGTAAATGTACCTTTAAAGCTGCAGTCTGTAAGTTTTGCCTCTTTGTCGCCATCTCTGTTTGAAACCTAGAATTGCAGAATTATCATCTTT ACGTG (Hif-1α binding site) AGTTACTCAGCGTGGATGAATCTAATGTTTGCTGTCAGTCATCACATCAGTGTGGATACTGTACTTCAGAATCACAGATTGTAGTCTTGGAAGTATGACCAAAATAAGAATTTTCACTGGAAAATTTCATCTGAACAAACAACATGTCTGCCACTTTTGTTCTGATCAACTGAGAGAAAAGGCATTACAATAAATCGCGGTGTCAGTTGTGATTAAATCTAACAATCACTTAGCTCGGATCATGTCAAAC CG

C / T

[0110] The underlined part is the Hif-1α binding site (LG8: 29647655-29647660; LG8: 29648023-29648028; LG8: 29648303-29648308), and the bold part is the core promoter region of the CTSC gene (LG8: 29647339-29647389).

[0111] 7. Detection of CTSC gene expression in in vivo tissues

[0112] CTSC is a class of proteolytic enzymes that are widely present in the lysosomes of many microorganisms and play a vital role in various physiological activities in the body. As one of the most important proteolytic enzymes, the tissue-specific expression of CTSC has been widely studied in mammals and other aquatic species. CTSC is abundant in the liver, spleen and kidney of mice, but its content in the heart and brain is extremely low.

[0113] The three genotypes were treated with hypoxia using the same method as the above test. The heart, brain, liver and gills of the three genotypes were taken at 0h (Hy_N0h), 6h (Hy_N6h), 12h (Hy_N12h) and 24h (Hy_N24h). Total RNA was extracted using Trizol, and the total RNA of each sample was reverse transcribed into cDNA using the PrimeScriptTM RT Kit. QuantStudioTM 6Flex Real-time Fluorescence Quantitative PCR System was used for qRT-PCR to detect the relative expression of the CTSC gene. The relative expression was measured using 2 -ΔΔCt The data were analyzed statistically to determine their significance. The samples were tested three times, and the gene expression was normalized using 40S ribosomal RNA as an internal reference. Each genotype was tested three times in parallel.

[0114] like Figure 7 As shown in A, under normoxic conditions, no significant difference was observed in the expression of CTSC gene in the heart, brain, liver and gill tissues of individuals with TT, TC and CC genotypes. After 24 hours of hypoxia, the expression of CTSC gene in the heart increased. It is worth noting that the expression level of TT genotype was significantly higher than that of CC genotype (P<0.05).

[0115] like Figure 7 As shown in B, the expression of CTSC gene in the brain of individuals with TT genotype is increased, while that of TC and CC genotypes remains basically unchanged.

[0116] like Figure 7As shown in C, the expression of CTSC gene in the liver was downregulated, and the expression of CC genotype individuals was significantly lower than that of other genotypes (P<0.05).

[0117] like Figure 7 As shown in D, the expression of CTSC gene in the gills of individuals with TT genotype and TC genotype was upregulated, while no significant change was detected in individuals with CC genotype. The expression levels of TT and TC genotypes were significantly higher than that of CC genotype (P<0.05).

[0118] Overall, under hypoxic stress, the expression of CTSC genes was upregulated in the brain, heart, and gill tissues of individuals with TT and TC genotypes, while the expression of CTSC genes was downregulated in the liver. In addition, after hypoxic stress, the expression level of CTSC genes in individuals with CC genotype was only upregulated in the heart, and the increase was much lower than that observed in the TT genotype. In contrast, the expression levels in the brain and gills remained unchanged compared with the normoxic state. It is worth noting that the expression level in the liver decreased significantly, and its rate of decrease was significantly higher than that of the TT genotype. These results speculate that the downregulation of CTSC genes can give organisms an adaptive advantage in adapting to hypoxic conditions. Based on the above results, it is speculated that the enhanced tolerance of the CC genotype to hypoxia may be due to the lower expression level of its CTSC genes than the other two genotypes.

[0119] 9. Analysis of liver immune-related gene expression after hypoxia

[0120] The three genotypes were treated with hypoxia using the same method as the above test. The liver tissues of the three genotypes were taken and total RNA was extracted using Trizol. The total RNA of each sample was reverse transcribed into cDNA using the PrimeScriptTM RT kit. QuantStudioTM 6Flex Real-time Fluorescence Quantitative PCR System was used for qRT-PCR to detect the relative expression levels of Cu / Zn-SOD, CAT, GOT1 and LYZ genes. The relative expression levels were measured using 2 -ΔΔCt The data were analyzed statistically to determine their significance. The samples were tested three times, and the gene expression was normalized using 40S ribosomal RNA as an internal reference. Each genotype was tested three times in parallel.

[0121] Table 3 Primer sequences

[0122]

[0123] Hypoxia causes fish to produce excessive reactive oxygen species (ROS), which can induce cell damage, impair the immune system, and activate cellular inflammation. To test whether changes in single nucleotide polymorphisms (SNPs) on the CTSC promoter affect the ability of fish to mount an immune response.

[0124] like Figure 8 As shown in CD, under normoxia, there was no difference in the expression of GOT1 and LYZ genes among the three genotypes. After hypoxia, the expression of GOT1 gene decreased, and there was a significant difference between the TT genotype and the CC genotype (P<0.05). Figure 8 As shown in D, the expression of LYZ gene in the liver of individuals with TT genotype increased dramatically and was significantly higher than that of individuals with CC genotype.

[0125] Through the above tests, it was found that since individuals with the CC genotype have stronger antioxidant capacity, the immune damage of the CC genotype is weaker under hypoxic conditions.

[0126] Hypoxia disrupts the balance of ROS generation and catabolism in Changfeng silver carp, leading to oxidative damage, which further increases susceptibility to various physiological and metabolic diseases. The CC genotype has a stronger antioxidant capacity, so it suffers less immune damage under hypoxic conditions.

[0127] This application analyzes the mRNA expression of immune-related genes GOT1 and LYZ under three genotypes to understand the effect of hypoxia on immune regulation ( Figure 8 CD). GOT1 is mainly present in the liver. When the liver is damaged or affected by external stress factors, the content of GOT1 in the liver will decrease. The present application found that after hypoxia treatment, the expression of GOT1 in the TT genotype decreased significantly faster than that in the CC genotype ( Figure 8 C). This phenomenon indicates that after hypoxia, the liver damage of TT genotype is greater than that of CC genotype. After hypoxia, the expression of LYZ of CC genotype decreases significantly faster than that of CC genotype ( Figure 7 D) The results showed that the CC genotype has a stronger antioxidant capacity, so under hypoxic conditions, the CC genotype has less immune damage.

[0128] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. Molecular markers associated with hypoxia tolerance in silver carp include a nucleotide sequence formed by the presence of C and T single nucleotide polymorphisms at position 29647765 of chromosome CM084784.1, LG8, GCA_041475455.1 of the silver carp (Hypophthalmichthysmolitrix) genome.

2. A nucleic acid, such as the nucleotide sequence shown in SEQ ID NO: 23 and / or SEQ ID NO:

24.

3. A primer pair for detecting the molecular marker according to claim 1, wherein the nucleotide sequences of the primer pair are shown in SEQ ID NO: 1 and SEQ ID NO:

2.

4. A method for detecting the molecular marker according to claim 1, the method comprising: Extracting genomic DNA of silver carp to be tested; Performing PCR amplification on the genomic DNA of the silver carp to be tested, so as to obtain a PCR amplification product; Sequencing the PCR amplification product to obtain a sequencing result; Based on the sequencing results, the genotype of the nucleotide at position 29647765 of chromosome CM084784.1 of LG8 of the silver carp genome GCA_041475455.1 was determined.

5. A method for breeding a hypoxia-tolerant silver carp strain, the method comprising: Detecting the genotype of the nucleotide at position 29647765 of chromosome CM084784.1 of LG8 of silver carp genome GCA_041475455.1, wherein the genotype includes TT genotype, TC genotype and CC genotype; Individuals with CC genotype were selected as breeding silver carp, or individuals with T at position 29647765 of chromosome CM084784.1, GCA_041475455.1, LG8 of the silver carp genome were selected as breeding silver carp.

6. The molecular marker according to claim 1, the nucleic acid according to claim 2, and the primer pair according to claim 3, wherein the molecular marker comprises a nucleotide sequence formed by the presence of C and T single nucleotide polymorphisms at position 29647765 of chromosome number CM084784.1 of silver carp genome LG8; the application is selected from at least one of the following: Detection of single nucleotide polymorphism at position 29647765 of chromosome CM084784.1 on LG8 of silver carp genome The genotype of nucleotide 29647765 of chromosome number CM084784.1 on LG8 of silver carp genome was detected; Testing the hypoxia resistance of silver carp; Breeding silver carp strains tolerant to hypoxia; Improve the survival rate of hypoxia-tolerant silver carp; Improve the venous hemoglobin concentration of hypoxia-tolerant silver carp; Improve the antioxidant enzyme activity of silver carp; Improve the structural integrity of the gills of hypoxia-tolerant silver carp; Reduce neuronal damage in hypoxia-tolerant silver carp; Reduce the number of apoptotic cells in the brain of hypoxia-tolerant silver carp; Reduce the expression of CTSC gene in hypoxia-tolerant silver carp; Improve the antioxidant properties of silver carp; Reduce damage to hypoxia-tolerant silver carp.

7. The nucleotide sequence of the gene associated with hypoxia tolerance in silver carp is shown in nucleotides 29637713 to 29646638 of chromosome CM084784.1 of LG8 in the silver carp genome GCA_041475455.

1.

8. Application of CTSC gene, the nucleotide sequence of which is shown in the nucleotides 29637713 to 29646638 of chromosome number CM084784.1, GCA_041475455.1, LG8 of silver carp genome, and the application is selected from at least one of the following: Screening for hypoxia-tolerant silver carp strains; Down-regulating CTSC gene expression, including knocking out or deleting HIF-1α binding sites; Testing the hypoxia resistance of silver carp; Breeding silver carp strains tolerant to hypoxia; Improve the survival rate of hypoxia-tolerant silver carp; Improve the venous hemoglobin concentration of hypoxia-tolerant silver carp; Improve the antioxidant enzyme activity of silver carp; Improve the structural integrity of the gills of hypoxia-tolerant silver carp; Reduce neuronal damage in hypoxia-tolerant silver carp; Reduce the number of apoptotic cells in the brain of hypoxia-tolerant silver carp; Improve the antioxidant properties of silver carp; Reduce damage to hypoxia-tolerant silver carp.

Images