SNP (Single Nucleotide Polymorphism) molecular marker related to slow sperm movement after chicken sperm cryopreservation resuscitation, primer and application

Abstract

The invention relates to the technical field of genetic breeding, and particularly discloses an SNP molecular marker related to slow sperm movement after chicken sperm cryopreservation resuscitation, a primer and application, the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, the 93rd site in the SNP molecular marker is an SNP site, and the site has C / T polymorphism. The SNP molecular marker provided by the invention has an SNP site at the 93rd site, the site has C / T polymorphism, and the proportion of slowly moving sperms after cryopreservation resuscitation of CT genotype individual sperms is higher than the proportion of slowly moving sperms after cryopreservation resuscitation of TT genotype individual sperms.

Description

Technical Field

[0001] The invention relates to the technical field of genetic breeding, and in particular to a SNP molecular marker, a primer and an application thereof related to the slow movement of sperm after cryopreservation and thawing of chicken semen. Background Art

[0002] Chicken semen is a carrier of genetic material for male chickens. Through artificial insemination or natural mating, sperm enters the reproductive system of the hen and fertilizes the hen's eggs. In this process, the rooster's excellent genes, such as fast growth rate, good meat quality, high egg production performance, strong disease resistance and many other excellent traits, will be passed on to the next generation with sperm. Accurate genetic selection is achieved by using chicken semen. Therefore, the quality and morphology of semen and other related traits directly affect the genetic selection of chickens. In the process of breed improvement, the role of chicken semen cannot be ignored. By hybridizing rooster semen with excellent traits with hens, the advantages of both can be combined to cultivate a more competitive new breed, among which the quality of semen affects the reproduction rate of hybridization.

[0003] Chicken semen cryopreservation is a common method in breeding practice and germplasm resource preservation. In the work of germplasm resource protection, chicken eggs are difficult to preserve for a long time, and the breakthrough in chicken semen cryopreservation technology provides an important guarantee for the long-term safety protection of chicken germplasm resources. For some rare and endangered chicken breeds, timely collection and cryopreservation of their semen can avoid the loss of excellent genes caused by the extinction of the breed, and lay the foundation for subsequent breed recovery and genetic improvement. In the artificial insemination technology of chickens, the dilution and preservation of semen are important links. By freezing and preserving chicken semen, the use time and scope of semen can be increased, the number of breeding roosters can be reduced, the breeding cost can be reduced, the utilization rate of breeding roosters can be increased, and the resource sharing of excellent breeding roosters can be facilitated. Cryopreserved chicken semen can be taken out and used at any time when needed, without being restricted by time and space, which provides greater flexibility and choice space for poultry breeding. Breeders can choose appropriate frozen semen for artificial insemination according to breeding goals and plans, accelerate the breeding process of excellent breeds, and improve the production performance and quality of poultry.

[0004] In the practice of artificial insemination of chickens, the quality of semen after cryopreservation and thawing is directly related to the reproductive efficiency. Using sperm with good morphology for artificial insemination can reduce the amount of semen required for each insemination. Because these sperm have strong vitality and fertilization ability, they can achieve a higher fertilization rate at a lower sperm concentration. This is very important for the efficient use of semen of excellent breeders, especially for those rare breeds or chickens with high economic value, which can expand the scale of breeding while reducing the cost of semen collection and processing. However, the morphological characteristics of sperm after semen freezing and thawing directly affect its subsequent reproductive rate, so it is very important to carry out genetic selection for related traits after chicken semen freezing and thawing.

[0005] The normal movement speed of chicken sperm is about 30-50 microns / second, while the speed of slow-moving sperm is significantly lower than this range, which may be only 10-20 microns / second, or even lower. Slow-moving sperm may still have fertilization ability, but can still fertilize hens. During natural mating or artificial insemination, these sperm can rely on their own motility to gradually move to the egg to complete fertilization. Especially when the amount of semen of high-quality roosters is limited or the vitality is reduced after cryopreservation, these slow-moving sperm can also provide opportunities for successful fertilization, ensure the fertilization rate of breeding eggs, and contribute to the transmission of excellent genes. In addition, for some rare chicken breeds, when preserving their semen, even if the sperm movement speed is affected, as long as there are slow-moving sperm, they can be reproduced through appropriate breeding techniques (such as in vitro fertilization and other improved technologies), continue the genes of the breed, and prevent the extinction of the breed. Therefore, the development of a molecular marker related to the slow movement trait of chicken sperm is of great significance to chicken breeding. Summary of the invention

[0006] In order to develop a molecular marker related to the slow motility trait of chicken sperm, the present invention provides a SNP molecular marker, primer and application related to the slow motility of sperm after frozen and thawed chicken semen. The SNP molecular marker provided by the present invention has a SNP site at the 93rd position, recorded as g.11231315C / T site, and there is a C / T polymorphism in the site. The proportion of slow-moving sperm in CT genotype individuals after frozen and thawed semen is higher than that in TT genotype individuals after frozen and thawed semen, indicating that the sperm motility of CT genotype individuals after frozen and thawed semen is significantly higher than that of TT genotype individuals, which is of great significance to the sub-breeding of Xiaoshan chicken.

[0007] The present invention provides a SNP molecular marker related to slow sperm movement after frozen and thawed chicken semen. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. The 93rd position in the SNP molecular marker is a SNP site, and the site has a C / T polymorphism.

[0008] The SNP molecular marker related to slow sperm motility after cryopreservation and thawing of chicken semen provided by the present invention has C / T polymorphism at position 93, and the proportion of slow-moving sperm in CT genotype individuals after cryopreservation and thawing of semen is significantly higher than that in TT genotype individuals after cryopreservation and thawing of semen, and can be used for breeding individuals with high sperm motility after cryopreservation and thawing. The molecular marker is closely related to the freezing resistance of chicken sperm, and the sperm functional ability of CT genotype individuals after cryopreservation and thawing of semen is significantly higher than that of TT genotype individuals, which is of great significance to the successive breeding of Xiaoshan chicken.

[0009] The present invention also provides a pair of primers, including a forward primer shown in SEQ ID NO.2 and a reverse primer shown in SEQ ID NO.3, wherein the primers are used to amplify the SNP molecular markers related to the slow movement of sperm after the chicken semen is frozen and thawed.

[0010] The invention also provides a kit containing the primer.

[0011] Furthermore, the kit also includes PCR Mix reagent and double distilled water.

[0012] The present invention also provides an early breeding selection method for sperm after frozen and thawed chicken semen, which performs early breeding based on the genotype of SNP molecular markers associated with slow sperm movement after frozen and thawed chicken semen, and selects chicken g.11231315C / T locus genotype CT individuals as succession breeding individuals.

[0013] Furthermore, the chicken breed is Xiaoshan chicken.

[0014] The present invention also provides an application of the SNP molecular marker related to the slow movement of sperm after freezing and thawing of chicken semen or the primer in genetic breeding of Xiaoshan chicken.

[0015] Furthermore, genomic DNA from the in vitro venous blood of Xiaoshan chicken was extracted as a template, PCR amplification was performed using the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.3, the amplified products were sequenced and analyzed, and individuals with the CT genotype at the g.11231315C / T site were selected as breeding individuals. Continuous subculture and selection were performed to increase the proportion of slow-moving sperm after cryopreservation and thawing of Xiaoshan chicken semen, thereby improving the semen performance of Xiaoshan chicken.

[0016] Furthermore, Xiaoshan chickens were selected at 145 to 155 days of age.

[0017] Furthermore, the PCR amplification program is: pre-denaturation at 97.5°C~98.5°C for 2min~2.5min; denaturation at 97.5°C~98.5°C for 10s~12s; annealing at 59.5°C~60.5°C for 30s~31s; extension at 72°C~72.5°C for 1min~1.5min; 33 cycles; then extension at 72°C~72.5°C for 5min~5.5min; storage at 4°C~6°C.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The SNP molecular marker provided by the present invention has a SNP site at the 93rd position, which is recorded as the g.11231315C / T site. There is a C / T polymorphism in the site, and the proportion of slow-moving sperm in individuals with the CT genotype after cryopreservation and resuscitation of semen is higher than that in individuals with the TT genotype after cryopreservation and resuscitation of semen. Through analysis, it was found that in the purebred Xiaoshan chicken population, the proportion of slow-moving sperm in individuals with the CT genotype at the g.11231315C / T site increased by an average of 12.04% compared with individuals with the TT genotype after cryopreservation and resuscitation of semen. In Xiaoshan chickens, the CT genotype at the g.11231315C / T site can gradually increase the proportion of slow-moving sperm in Xiaoshan chickens after cryopreservation and resuscitation of semen, thereby achieving the purpose of improving the semen performance of Xiaoshan chickens. It is of great significance to the successive breeding of Xiaoshan chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 The distribution of significance thresholds of genome-wide association analysis of sperm slow motility trait after cryopreservation and thawing of Xiaoshan chicken semen. Among them, blue points exceed the chromosome significance level threshold, and red points exceed the genome-wide significance level threshold.

[0022] Figure 2 This is the electrophoresis diagram of the amplified products of the Xiaoshan chicken population.

[0023] Figure 3 This is the peak diagram of DNA sequencing results for different genotypes at the g.11231315C / T site. DETAILED DESCRIPTION

[0024] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0025] Example 1: Development of a SNP molecular marker associated with slow sperm motility after cryopreservation and thawing of semen.

[0026] 1. Source of experimental animals and blood collection

[0027] The experiment selected 102 180-day-old Xiaoshan chickens as the research subjects. Xiaoshan chickens were from the Xiaoshan Chicken Breed Resource Farm in Zhejiang Province. The roosters were raised in three-tiered cages with air conditioning, independent ventilation, nipple drinking water, and were fed on time from 8:00 to 9:00 every morning. At about 150 days of age, 5 mL of blood was collected from the wing vein of the experimental rooster using an EDTA anticoagulant tube for DNA extraction.

[0028] 2. Extraction of Xiaoshan chicken genomic DNA

[0029] Extract DNA using high salt method:

[0030] (1) Digestion: 30 μL of anticoagulated blood was added to a 2 mL centrifuge tube, and 600 μL of lysis buffer was added and mixed. The lysis buffer was a mixture of 50 mM Tris-Cl and 10 mM EDTA, with a pH of 8.0. Then, 30 μL of 10 μg / μL proteinase K was added and mixed. The mixture was placed in a 56°C water bath for digestion for 12 hours.

[0031] (2) Salting out: Add 600 μL of 6M saturated sodium chloride and 600 μL of chloroform to the above mixed solution, shake well for 10 minutes, and centrifuge at 12,000 rpm for 5 minutes.

[0032] (3) Ice precipitation: Take the supernatant and place it in a new 2 mL centrifuge tube. Add 600 μL of 90% ethanol that has been pre-cooled on ice and mix well. Gently shake to allow the white precipitate to precipitate.

[0033] (4) Use a sterile pipette tip to pick up the white precipitate, add 600 μL of 70% ethanol to wash, pour off the ethanol, and dry naturally.

[0034] (5) After the ethanol has completely evaporated, add 500 μl of ddH20.

[0035] (6) Cover the tube and place it at 56°C for 2 hours. Then, store the DNA in a -4°C refrigerator.

[0036] 3. Semen collection and characterization

[0037] Semen was collected from roosters at 180 days of age. Semen was collected using abdominal massage, and semen was collected using sterile cryopreservation tubes. Then diluents and protective agents were added and stored in liquid nitrogen. After 7 days of cryopreservation, the semen was thawed and revived at 4°C. After resuscitation, sperm motility indicators were measured using a sperm analyzer.

[0038] 4. Chicken whole genome SNP genotype detection

[0039] The above individual DNA was genotyped on the chicken genome GRCg6a version "Jingxin No. 1" 55K chip on the Illumina sequencing platform according to the company's standard process. The chip genotype data were quality controlled using Plink (V1.90b) software, and the parameters --geno 0.1 --maf 0.01 --mind 0.1 were used for quality control. 45262 SNPs were obtained. The single trait mixed linear model (LMM) of GEMMA (V0.98.5) software (https: / / github.com / genetics-statistics / GEMMA / releases) was used to perform a genome-wide association analysis on the slow motility trait of sperm after semen cryopreservation and thawing. In this model, SNP was used as a fixed factor and additive effect as a random effect. The significance thresholds at the genome-wide level and chromosome level were 1.10×10 -6 (0.05 / 45262) ​​and 2.21×10 -5 (1 / 45262).

[0040] Finally, we obtained 2 SNPs that were significantly correlated with the slow motility of sperm after cryopreservation and thawing. Figure 1 The P value of the g.11231315C / T site on chromosome 5 of the chicken reference genome GRCg6a was 8.08×10 -7 Exceeding the genome-wide significance threshold. The average proportion of slow-moving sperm in individuals with the CT genotype of this SNP after cryopreservation and thawing of semen was 19.73±6.84%, while the average proportion of slow-moving sperm in individuals with the TT genotype after cryopreservation and thawing of semen was 7.69±3.83%.

[0041] Example 2: SNP site verification and application.

[0042] The above g.11231315C / T site was verified in the Xiaoshan chicken population.

[0043] 1. Extraction of Xiaoshan Chicken Genomic DNA

[0044] Blood samples from 96 purebred Xiaoshan chickens were collected to accurately measure the sperm motility phenotype after sperm cryopreservation and thawing, collected using EDTA anticoagulant tubes and stored in a 4°C refrigerator for later use. Blood genomic DNA was extracted using the above method, diluted to 30 ng / μL after quality and concentration testing, and stored in a -20°C refrigerator until use.

[0045] 2. PCR amplification and sequencing of target fragments

[0046] The following primers were designed using NCBI Primer-BLAST using the reference sequence of chromosome 5 of the chicken GRCg6a reference genome from 11231015 bp to 11231615 bp as a template.

[0047] Forward primer (5'-3'): TTCATGCCCGCAAGGTCAAA (SEQ ID NO. 2).

[0048] Reverse primer (5'-3'): AACCCGACTTTGACCAAAACAAT (SEQ ID NO. 3).

[0049] Using the extracted DNA as a template, PCR amplification was performed according to the designed primers, using a 20uL PCR reaction system: 1μL DNA template, 0.8μL forward primer and reverse primer each, 10μL PCR Mix reagent, and 7.4μL double distilled water. The PCR Mix reagent is produced by Servicebio, the product name is 2×Fast Pfus PCR Master Mix, item number: G3305-05. The PCR amplification program is: pre-denaturation at 98℃ for 2min; denaturation at 98℃ for 10s; annealing at 60℃ for 30s; extension at 72℃ for 1min; 33 cycles; then extension at 72℃ for 5min; storage at 4℃. The PCR product was detected by electrophoresis in 1.2% agarose gel. The size of the amplified target fragment was 264bp. The sequence of the target fragment is shown in SEQ ID NO.1, and the electrophoresis diagram is shown in Figure 2 .

[0050] SEQ ID NO.1:

[0051] TTCATGCCCGCAAGGTCAAAAGGCATGTGTAGCTACTGTGTGACTCTCTGCACCTTGTCATGTAGCTCCCAGTAGTTGCAACTTGTGTATCA C GTTGGACATTGAAGAAAATCCCCCTACTATTTTTAGGAGATACATTGGACGTAGTAAGGTCAATGGGTTGACGTAATTTAAAATTCTATAACTTCCTAAATTAAAATATGTGGTCTAGGTGCAATTAACCCAAATAAGATGCAACATTATTGTTTTGGTCAAAGTCGGGTT.

[0052] The double underline in SEQ ID NO.1 is the g.11231315C / T site, which has C / T polymorphism. The proportion of slow-moving sperm in individuals with CT genotype after cryopreservation and thawing of semen is increased by 12.04% on average compared with individuals with TT genotype. It can be seen that in Xiaoshan chicken, the CT genotype at the g.11231315C / T site can gradually increase the proportion of slow-moving sperm in Xiaoshan chicken semen after cryopreservation and thawing, thereby achieving the purpose of improving the semen performance of Xiaoshan chicken.

[0053] The remaining amplified products were sequenced, and the sequencing results were compared and analyzed with the relevant gene fragment sequences of chicken in GenBank using SnapGene software. The g.11231315C / T site was located at the 93rd position of the sequence, and there was a C / T polymorphism at this site. The genotype of the g.11231315C / T site was determined ( Figure 3 ). Then, R (version 4.3.1) was used to analyze the effect of genotype on phenotype. The analysis model was Y = μ + P + G + e; where: Y is the slow motility phenotype of sperm after Xiaoshan chicken semen was frozen and revived; G represents the genotype fixed effect of SNP; P is the random effect of the column; e is the residual. The significant P value was corrected by 10,000 random samplings.

[0054] Table 1 shows the effect of the g.11231315C / T mutation site on the slow-moving sperm phenotype after semen cryopreservation and thawing in the purebred Xiaoshan chicken population. As shown in Table 1, in the purebred Xiaoshan chicken population, the proportion of slow-moving sperm after semen cryopreservation and thawing in individuals with the CT genotype at the g.11231315C / T site increased by an average of 12.04% compared with individuals with the TT genotype. It can be seen that in Xiaoshan chickens, the CT genotype at the g.11231315C / T site can gradually increase the proportion of slow-moving sperm after semen cryopreservation and thawing in Xiaoshan chickens, thereby achieving the purpose of improving the semen performance of Xiaoshan chickens.

[0055] Table 1g.11231315C / T locus and the association with the slow motility phenotype of sperm after cryopreservation and thawing of Xiaoshan chicken semen

[0056]

[0057] In summary, the SNP molecular markers provided by the present invention can be used to select sperm with a high proportion of slow-moving sperm after cryopreservation and thawing of Xiaoshan chicken semen, thereby improving breeding efficiency.

[0058] Although preferred embodiments of the present invention have been described, additional changes and modifications may occur to these embodiments once those skilled in the art are aware of the basic inventive concepts.

[0059] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A SNP molecular marker associated with slow sperm motility after cryopreservation and thawing of chicken semen, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1. The 93rd position in the SNP molecular marker is a SNP site, and there is a C / T polymorphism at this site.

2. A pair of primers, characterized in that: It comprises a forward primer shown in SEQ ID NO.2 and a reverse primer shown in SEQ ID NO.3, and the primers are used to amplify the SNP molecular marker related to the slow movement of sperm after the chicken semen is frozen and thawed as claimed in claim 1.

3. A kit comprising the primers according to claim 2.

4. The kit according to claim 3, characterized in that Also includes PCR Mix reagent and double distilled water.

5. A method for early breeding selection of sperm after cryopreservation and thawing of chicken semen, characterized in that: Early breeding is carried out based on the genotype of the SNP molecular marker associated with slow sperm motility after the frozen and thawed chicken semen as described in claim 1, and the genotype individuals with the genotype of CT at the chicken g.11231315C / T locus are selected as the succession breeding individuals.

6. The method for early breeding selection of sperm after cryopreservation and thawing of chicken semen according to claim 5, characterized in that: The chicken breed is Xiaoshan chicken.

7. Use of the SNP molecular marker associated with slow sperm motility after cryopreservation and thawing of chicken semen as claimed in claim 1 or the primer as claimed in claim 2 in genetic breeding of Xiaoshan chicken.

8. The use according to claim 7, characterized in that: The genomic DNA of the in vitro venous blood of Xiaoshan chicken was extracted as a template, and PCR amplification was performed with the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.

3. The amplified products were sequenced and analyzed, and the individuals with the CT genotype at the g.11231315C / T locus were selected as breeding individuals. Continuous subgeneration and selection were carried out to increase the proportion of slow-moving sperm in Xiaoshan chicken semen after cryopreservation and thawing, and to improve the semen performance of Xiaoshan chicken.

9. The use according to claim 8, characterized in that: Xiaoshan chickens are selected at 145 to 155 days of age.

10. The use according to claim 8, characterized in that: The PCR amplification program is: pre-denaturation at 97.5℃~98.5℃ for 2min~2.5min; denaturation at 97.5℃~98.5℃ for 10s~12s; annealing at 59.5℃~60.5℃ for 30s~31s; extension at 72℃~72.5℃ for 1min~1.5min; 33 cycles; then extension at 72℃~72.5℃ for 5min~5.5min; storage at 4℃~6℃.

Images