Molecular marker related to Chinese and wei goat fur character and application of molecular marker

Abstract

The invention belongs to the technical field of genetic breeding, and particularly relates to a molecular marker related to the Chinese and defense goat fur character and application of the molecular marker, the Chinese and defense goat fur character is the hair strand bending length or the proportion of spica in the hair strand, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, and C-T mutation occurs at the 102bp position of the sequence shown as SEQ ID NO.1. The molecular marker can be used for breeding the Zhongwei goat variety with long curving length of goat feathers and large proportion of spica in the feathers.

Description

Technical Field

[0001] The invention relates to the technical field of genetic breeding, and in particular to a molecular marker related to the fur traits of Zhongwei goats and an application thereof. Background Art

[0002] Zhongwei goats are the only goat breed in the world that can produce white fur. In recent years, due to changes in the needs of the livestock and poultry industry and changes in feeding conditions, the current core population of Zhongwei goats is seriously insufficient. Problems such as too few sheep in the core production areas, low reproduction rates, and degradation of excellent germplasm traits have become difficulties in the protection of the germplasm resources of this breed. Zhongwei goats are not only famous for their high-quality cashmere, but their fur also has certain economic value. Fur refers to the fur obtained from Zhongwei goats around 40 days old. This fur is white, shiny like jade, neatly curved, and has beautiful spikes. It is valued for its unique texture and characteristics. Therefore, improving the fur quality of Zhongwei goats and cultivating Zhongwei goats with excellent fur quality is one of the urgent problems to be solved in the current Zhongwei goat conservation work.

[0003] The bend length of the hair strand and the proportion of the inflorescence to the hair strand are important indicators of the fur traits of Zhongwei goats. It is very necessary to explore the molecular markers that affect the bend length of the hair strand and the proportion of the inflorescence to the hair strand at the genome level. Summary of the invention

[0004] To solve the above technical problems, the present invention provides a molecular marker related to the fur traits of Zhongwei goats, which can be used to select Zhongwei goat varieties with long bend length of goat hair strands and / or a large proportion of tassels to hair strands.

[0005] The specific technical solutions provided by the present invention are as follows: In a first aspect, the present invention provides a molecular marker related to the fur trait of Zhongwei goats, wherein the fur trait of Zhongwei goats is the curvature length of hair strands or the proportion of tassels to hair strands, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a mutation from C to T occurs at the 102 bp of the sequence shown in SEQ ID NO.1. The mutation site is located at position 11504759 on chromosome 3 of the goat genome.

[0006] The second aspect of the present invention provides an application of the molecular markers related to the fur traits of Zhongwei goats in identifying the bending length of the hair strands of Zhongwei goats.

[0007] As a preferred embodiment of the present invention, the method for identifying the bending length of Zhongwei goat wool strands comprises: The base at the 102 bp position of the molecular marker of the goat to be tested is detected. When the base at the 102 bp position is T, the curvature length of the goat's hair strand is greater than the curvature length of the goat's hair strand when the base at the 102 bp position is C.

[0008] The third aspect of the present invention provides an application of the molecular markers related to the fur traits of Zhongwei goats in identifying the proportion of indusia in the hair strands of Zhongwei goats.

[0009] As a preferred embodiment of the present invention, the method for identifying the proportion of flower spikes in the hair strands of Zhongwei goats comprises the following steps: The base at the 102 bp position of the molecular marker of the goat to be tested is detected. When the base at the 102 bp position is T, the ratio of the inflorescence to the hair strand of the goat is greater than when the base at the 102 bp position is C.

[0010] The fourth aspect of the present invention provides an application of the molecular markers related to the fur traits of Zhongwei goats in the genetic breeding of Zhongwei goats.

[0011] As a preferred embodiment of the present invention, the genetic breeding is to select and breed Zhongwei goats with long hair strand bending length and / or large proportion of tassels to hair strands.

[0012] As a preferred embodiment of the present invention, the genotype of goats at the 102 bp position of the molecular marker is detected, and individuals with the TT genotype are selected as parents to increase the curvature length of the hair strands of the offspring.

[0013] As a preferred embodiment of the present invention, the genotype of goats at the 102 bp of the molecular marker is detected, and individuals with the TT genotype are selected as parents to increase the proportion of flower spikes to hair strands in the offspring.

[0014] As a preferred embodiment of the present invention, the genotype of goats at the 102 bp position of the molecular marker is detected, and individuals with the TT genotype are selected as parents to increase the hair strand bending length and the proportion of the flower spike to the hair strand of the offspring.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a SNP site affecting the curvature length of hair strands and the proportion of flower spikes to hair strands of Zhongwei goats and a molecular marker comprising the site. By selecting an individual with a TT genotype at the SNP site and using it as a father or a mother, the curvature length of hair strands and the proportion of flower spikes to hair strands of offspring can be increased. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 For the principal component analysis graph, the first three explained variance percentages, PC1, PC2, and PC3, are used as the X, Y, and Z axes; Figure 2 This is the distribution diagram of SNPs in the 1Mb window of chromosome after quality control. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size; Figure 3Manhattan Plots (A) and QQ-plots (B) show the GWAS results of the hair femoral bend length of Zhongwei goats, and the genome-wide significant SNPs are shown in red; Figure 4 Manhattan Plots (A) and QQ-plots (B) show the GWAS results of the ratio of tassel to hair strand in Zhongwei goats, and genome-wide significant SNPs are shown in red. DETAILED DESCRIPTION

[0017] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified.

[0018] Zhongwei goats are the only goat breed in the world that can produce white fur. Zhongwei goats are not only famous for their high-quality cashmere, but their fur also has a certain economic value. Therefore, improving the fur quality of Zhongwei goats and breeding Zhongwei goats with excellent fur quality is one of the urgent issues to be solved in Zhongwei goat conservation work.

[0019] The bend length of the hair strand and the proportion of the inflorescence to the hair strand are important indicators of the fur traits of Zhongwei goats. It is very necessary to explore the molecular markers that affect the bend length of the hair strand and the proportion of the inflorescence to the hair strand at the genome level.

[0020] The present invention provides a molecular marker related to the fur trait of Zhongwei goat, wherein the fur trait of Zhongwei goat is the curvature length of hair strand or the proportion of flower spike to hair strand, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a mutation from C to T occurs at the 102 bp of the sequence shown in SEQ ID NO.1. The mutation site is located at the 11504759th position on chromosome 3 of the goat genome. By using the molecular marker and selecting an individual with TT genotype as a father or a mother, the curvature length of hair strand and the proportion of flower spike to hair strand of offspring can be increased.

[0021] Example 1 Source of experimental animals and phenotypes: The experimental goats in this study were all from the Zhongwei goat breeding farm in Ningxia Hui Autonomous Region. The phenotypic records of the hair strand bending length and the proportion of tassels to hair strands were measured in 2022, and the results are shown in Table 1. Ear tissue samples were collected from 367 Zhongwei goats, and all samples were immediately stored in liquid nitrogen after collection and transported to the laboratory for long-term storage at -80°C.

[0022] Table 1 Description of the characteristics of the hair strand bending length and the proportion of spikes in the hair strand of Zhongwei goats

[0023] 1. Genomic DNA extraction and quality inspection The phenol-chloroform method was used to extract DNA from ear tissue samples. A spectrophotometer (NanoDrop 2000) was used to measure DNA concentration, the absorption wavelength ratio of the highest absorption peaks of nucleic acids, proteins and phenolic substances (260nm / 280nm), and the absorption wavelength ratio of the highest absorption peak of carbohydrates (260nm / 230nm). 1% agarose gel was used to evaluate DNA quality.

[0024] 2. Library construction and sequencing After the qualified genomic DNA samples were processed, the genomic DNA was randomly sheared into 350 bp fragments using a Covaris ultrasonic crusher. The DNA fragments were repaired at the end, polyA was added, sequencing adapters were added, purified, and PCR amplified to complete the entire library preparation. After the library construction was completed, Qubit2.0 was used for preliminary quantification, and the effective concentration of the library was accurately quantified using the qPCR method to ensure the quality of the library. After the library quality test was qualified, the sequencing was performed using the BGI-T7 sequencing platform, and the sequencing mode was PE150 mode.

[0025] 3. Identification, screening and annotation of variant sites Fastp software version V0.20.0 was used to filter the Raw reads data into Clean reads data, and a genome index was established for the reference genome. The quality-controlled Clean reads data were aligned with the goat reference genome ARS1, GCF_001704415.1 using Burrows-Wheeler Aligner software version V0.7.17. The aligned sam files were converted into bam files and sorted using SAMtools software version V1.8-20. The MarkDuplicates program in GenomeAnalysis Toolkit software version V3.8 was used to remove duplicate data from the sorted bam files to obtain the final bam files. The final bam files were indexed, and the HaplotypeCaller module in the GATK software was used to detect SNP variations. After obtaining the vcf file, the VariantFiltration module was used for filtering. The ANNOVAR software package is used to perform functional annotation on the detected gene variants. Based on the position of the variant site on the reference genome and the gene position information on the reference genome, the region where the variant site occurs in the genome, including intergenic regions, intronic regions or CDS regions, and the impact of the variant can be obtained.

[0026] 4. Data quality control and population stratification correction The obtained genotyping data were quality controlled using Plink V1.90 software, and individuals with genotype detection rate < 98%, SNPs with detection rate < 98%, SNPs with minimum allele frequency < 5%, and Hardy-Weinberg equilibrium test P value < 10 were excluded. -6 The first three principal components were calculated using the "-pca 3" parameter of Plink V1.90 software. The PCA graph was drawn using R language V3.6.0. The results are shown in the figure. Figure 1 As shown, there was no group stratification in the experimental samples, and there was no need to correct the group stratification phenomenon of Zhongwei goats.

[0027] A total of 32,219,876 SNPs were involved in quality control and filtered by SNP detection rate, Hardy-Weinberg equilibrium, minimum allele frequency, and individual detection rate. The filtering conditions were -geno 0.02, -maf 0.05, and -hwe 1e -6 , -mind 0.1. A total of 15,817,002 SNPs were obtained for subsequent analysis, and these sites were evenly distributed on the 29 pairs of autosomes of goats, such as Figure 2 shown.

[0028] 5. Genome-wide association analysis The fastGWA-mlm model in GCTA V1.94.0beta software was used to perform association analysis between SNP and hair strand bending length traits.

[0029] The Logistic regression model in GCTA V1.94.0beta software was used to perform association analysis between SNP and the proportion of inflorescence to hair strand.

[0030] The Bonferroni correction method was used to determine the significance threshold of the GWAS. The genomic expansion factor λ of the test statistic was calculated by the slope of the linear regression between the observed quantile and the theoretical quantile in R language V3.6.0. The λ value for the strand bend length trait was calculated to be 1.057, and the λ value for the ratio of spike to strand was 1.14, indicating no genomic expansion. Based on the resequencing data of 367 midges, 58 significant SNP loci associated with the strand bend length trait were detected, which were located on chromosomes 3, 6, 7, 8, 9, 10, 13, 16, 17, 18, and 28, as shown in Table 2, Supplementary Table 2 and Figure 3 Eight significant SNP loci related to the ratio of flower spike to hair strand were detected, and these loci were located on chromosomes 3, 6, 11, 16, 25, and 26, as shown in Table 3 and Figure 4 shown.

[0031] Table 2 Significant SNP loci associated with hair strand length traits

[0032] Supplementary Table 2 Significant SNP loci associated with hair strand length traits

[0033] Table 3 Significant SNP loci associated with the ratio of inflorescence to hair strand

[0034] VI. SNPs affecting the bend length of the hair strand and the proportion of spikelets to hair strands in Zhongwei goats Further study of SNPs that reached the genome-wide significance level revealed that the C→T mutation at position 11504759 on chromosome 3 of the Zhongwei goat genome can significantly affect the hair strand bend length and the proportion of tassels to hair strands of Zhongwei goats.

[0035] The association analysis between the SNP locus at 11504759 on chromosome 3 of the Zhongwei goat genome and the hair strand bending length and the proportion of flower spikes to hair strands is shown in Table 4: Table 4 Polymorphism at position 11504759 on chromosome 3 of Zhongwei goat genome

[0036] Note: Different letters indicate significant differences ( P <0.05, the same letter indicates no significant difference ( P >0.05). The ratio of flower spikes to hair strands is a binary trait, recorded as 1 or 2, and the ratio is greater than or equal to 0.6 and recorded as 1, and less than 0.6 and recorded as 2; 1 is a better phenotype, and the closer the value is to 1, the better the phenotype individual is.

[0037] As shown in Table 4, for individuals with genotype TT, the hair strand bending length is the longest and the proportion of flower spike to hair strand is the largest.

[0038] The nucleotide sequence of the molecular marker containing the SNP site is shown in SEQ ID NO.1: AGTTCAGTCGCTCAGTCGTGTCTGACTCTTTGCCACCCCATGAATTGCAGCACGCCAGGCCTCCCTGTCCATCACCAACTCCCGGAGTTCACTCAAACTCASGTCCATCAAGTCAGTGATGCCATCCAGCCATCTCATCCTCTGTCGTCCCCTTCTCCTCCTGCTCCCAATCCCTCCCAGCATCAGAATCTTTTCCAATGAGG, where S is base C or T.

[0039] In the whole genome association analysis, the SNP molecular marker at position 11504759 on chromosome 3 of the genome of 367 Zhongwei goats reached the genome-wide significant level, indicating that the marker was significantly correlated with the hair strand bend length and the ratio of tassel to hair strand of Zhongwei goats. When the marker mutated to T, it was beneficial for Zhongwei goats to have longer hair strand bend length and larger ratio of tassel to hair strand, see Table 5.

[0040] Table 5 SNP gene frequency and genotype frequency at position 11504759 on chromosome 3 of Zhongwei goat genome

[0041] It can be seen from Table 5 combined with Table 4 that the C→T mutation at position 11504759 on chromosome 3 of the Zhongwei goat genome can be used to select Zhongwei goats with long hair strand bend length and a large proportion of tassels to hair strands, and by selecting individuals with TT genotype as the father or mother, the hair strand bend length and the proportion of tassels to hair strands of the offspring of Zhongwei goats can be improved.

[0042] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0043] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0044] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A molecular marker related to the fur traits of Zhongwei goats, characterized in that: The fur trait of Zhongwei goat is the curvature length of the hair strand or the proportion of the tassel to the hair strand. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. A mutation from C to T occurs at the 102 bp of the sequence shown in SEQ ID NO.

1.

2. Use of the molecular marker related to the fur traits of Zhongwei goats as described in claim 1 in identifying the bending length of Zhongwei goat wool strands.

3. The use according to claim 2, characterized in that: The method for determining the bending length of Zhongwei goat wool strands includes the following steps: The base at the 102 bp position of the molecular marker of the goat to be tested is detected. When the base at the 102 bp position is T, the curvature length of the goat's hair strand is greater than the curvature length of the goat's hair strand when the base at the 102 bp position is C.

4. Use of the molecular markers related to the fur traits of Zhongwei goats according to claim 1 in identifying the proportion of inflorescence to hair strands of Zhongwei goats.

5. The use according to claim 4, characterized in that: The method for identifying the proportion of flower spikes to hair strands of Zhongwei goats comprises the following steps: The base at the 102 bp position of the molecular marker of the goat to be tested is detected. When the base at the 102 bp position is T, the ratio of the inflorescence to the hair strand of the goat is greater than when the base at the 102 bp position is C.

6. Application of the molecular markers related to the fur traits of Zhongwei goats as described in claim 1 in genetic breeding of Zhongwei goats.

7. The use according to claim 6, characterized in that: The genetic breeding is to select and breed Zhongwei goats with long hair strand bend length and / or large proportion of flower spikes to hair strands.

8. The use according to claim 7, characterized in that: The genotype of the goat at the 102 bp position of the molecular marker is detected, and individuals with the TT genotype are selected as parents to increase the curvature length of the hair strands and / or the proportion of the flower spike to the hair strands of the offspring.

Images