Composition for identifying Takifugu obscurus, Takifugu rubripes and hybrid pufferfish and its application

By designing specific SNP molecular markers and fluorescent PCR methods, the problem of identifying dark-shaped oriental saples, red-fin oriental saples and hybrid saples was solved, and a fast and accurate identification method was achieved. It is suitable for fish of different individuals, ages and genders, and supports the healthy development of the river sap farming industry.

CN119776552BActive Publication Date: 2025-07-25YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510292942.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-13
Publication Date
2025-07-25
Estimated Expiration
2045-03-13

AI Technical Summary

Technical Problem

The existing technology is difficult to quickly and accurately identify dark-patterned oriental snails, red-fin oriental snails and hybrid snails, resulting in hybrid snails being mixed into the breeding parent population and affecting the germplasm of the germplasm, which seriously affects the healthy development of the ripe rapa aquaculture industry.

Method used

A pair of primers and a set of probes were used to design specific SNP molecular markers based on the SH3PX3 sequence characteristics of the nuclear genes of dark-shaped oriental saples, red-fin oriental saples, and hybrid saples, and identify them by fluorescence PCR method, and species were judged using the differences in Ct values of FAM and HEX signal channels.

Benefits of technology

It realizes the rapid, simple and low-cost accurate identification of dark-lined oriental saplings, red-fin oriental saplings and hybrid saplings. It is suitable for fish of different individuals, ages and genders, and provides rapid identification support for hybrid saplings and parents.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119776552B_ABST
    Figure CN119776552B_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for identifying Takifugu obscurus, Takifugu rubripes and hybrid Takifugu, and its application, belonging to the field of molecular biology. The composition includes a pair of primers and a set of probes, and their sequences are shown as SEQ ID NO.1-4. The present invention also provides a kit for identifying Takifugu obscurus, Takifugu rubripes and hybrid Takifugu, and the kit includes the above-mentioned composition. Using the composition, rapid synchronous detection and analysis of Takifugu obscurus, Takifugu rubripes and hybrid Takifugu can be carried out, without being restricted by the individuals, ages, genders, populations, etc. of the three kinds of fish.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and particularly relates to a composition for identifying Takifugu obscurus, Takifugu rubripes and hybrid pufferfish, and its application. Background Art

[0002] Takifugu rubripes and Takifugu obscurus belong to Osteichthyes, Tetraodontiformes, Tetraodontidae, and Takifugu. Both are fish with relatively high nutritional and economic values, and are the main economic varieties of pufferfish in China.

[0003] To meet the needs of the rapid development of the pufferfish industry, breeders use the principle of heterosis to increase production and efficiency. They conduct cross-breeding with Takifugu obscurus as the female parent and Takifugu rubripes as the male parent to obtain the first-generation hybrid pufferfish F1 (hereinafter referred to as hybrid pufferfish) with excellent traits such as high breeding survival rate, fast growth rate, and good muscle quality. The meat quality of the hybrid pufferfish inherits the delicious flavor of the female parent, is softer than the muscle texture of the male parent, and the hybrid pufferfish can be cultured in fresh water, and is also superior to the female parent in terms of body length and growth rate during the seedling stage, effectively reducing the breeding cost while meeting the market demand. However, the morphological characteristics of the hybrid pufferfish are not typical, with both dot-like and strip-like patterns, making it difficult to identify with the naked eye. If the hybrid pufferfish is mixed into the breeding parent population, it will lead to the mixing of pufferfish germplasm and disordered hybridization, which will seriously affect the healthy development of the pufferfish breeding industry. Therefore, it is particularly important to establish a set of methods for quickly and accurately identifying hybrid pufferfish.

[0004] So far, there are few reports on the research of methods for identifying hybrid pufferfish. It has been reported that DNA barcoding based on the mitochondrial COI gene can achieve species identification of most bony fishes, but this method can only identify maternal genetic information and cannot determine the paternal origin. Existing studies have shown that obtaining more genetic information of species through sequence analysis and comparison of certain nuclear genes may help to reveal the parental origin and hybridization phenomenon of hybrid species, but there are thousands of nuclear genes, and it is still unknown which nuclear gene can be used for identification. In the Tetraodontidae family of fish, there is no relevant report. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a composition for identifying Takifugu obscurus, Takifugu rubripes and hybrid pufferfish and its application, which can identify Takifugu obscurus, Takifugu rubripes and hybrid pufferfish, and the method is simple, fast, specific and low-cost.

[0006] The present invention is realized by the following technical solutions:

[0007] A composition for identifying Takifugu obscurus, Takifugu rubripes and hybrid puffers, said composition comprising a pair of primers and a set of probes. The forward primer of the primers: 5′-GAGCCCGCAGCCTTTCT-3′ (SEQ ID NO.1); reverse primer: 5′-ATGTACGTCTTGATGCCCTTGA-3′ (SEQ ID NO.2); the probes are: Probe 1: FAM-TGCTCCAT T GAAGATGCCAC-MGB (SEQ ID NO.3);

[0008] Probe 2: HEX-TGCTCCAT C GAAGATGCCAC-MGB (SEQ ID NO.4).

[0009] The present invention also provides a kit for identifying Takifugu obscurus, Takifugu rubripes and hybrid puffers, said kit comprising the said composition.

[0010] The present invention also provides the application of the composition in identifying Takifugu obscurus, Takifugu rubripes and hybrid puffers.

[0011] Furthermore, the application method is: (1) Extract the genomic DNA of the sample to be tested;

[0012] (2) Using the said genomic DNA as a template, perform fluorescence PCR with the primer set shown in SEQ ID NO.1-2 and the probe set shown in SEQ ID NO.3-4;

[0013] (3) Judge the species of the sample to be tested according to the difference in the amplified Ct values; when there is a Ct value in the FAM signal channel and no Ct value in the HEX signal channel, the sample to be tested is Takifugu obscurus; when the Ct value in the FAM signal channel is 2-5 greater than the Ct value in the HEX channel, the sample to be tested is Takifugu rubripes; when the Ct values in the FAM channel and the HEX channel are close and the difference between the two is less than 2, the sample to be tested is a hybrid puffer.

[0014] The beneficial effects of the present invention compared with the prior art: (1) According to the sequence characteristics of the nuclear gene SH3PX3 of Takifugu obscurus, Takifugu rubripes and hybrid puffers, through analysis and comparison, an SNP molecular marker for identifying Takifugu obscurus, Takifugu rubripes and hybrid puffers is established. The polymorphism of this SNP locus is the base T or C. When the base is T, the corresponding species is Takifugu obscurus; when the base is C, the corresponding species is Takifugu rubripes; when both bases T and C exist, the corresponding species is a hybrid puffer. The corresponding species categories can be directly identified according to the bases of the SNP polymorphism sites;

[0015] (2) The primers and probes developed based on the SNP molecular markers of the present invention can be used for the rapid synchronous detection and analysis of Takifugu obscurus, Takifugu rubripes and hybrid pufferfish, without being restricted by the individuals, ages, genders, populations, etc. of the three fish species. The present invention provides reliable technical support for the rapid and accurate identification of hybrid pufferfish and their parents. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the fluorescence PCR amplification curve of Takifugu obscurus;

[0017] Figure 2 It is the fluorescence PCR amplification curve of Takifugu rubripes;

[0018] Figure 3 It is the fluorescence PCR amplification curve of hybrid pufferfish;

[0019] Figure 4 It is the analysis peak map of the sequencing products of the SH3PX3 gene of Takifugu obscurus, Takifugu rubripes and hybrid pufferfish. DETAILED DESCRIPTION OF THE INVENTION

[0020] The present invention will be further described below in conjunction with the drawings and embodiments.

[0021] The present invention established SNP molecular markers based on the sequence characteristics of the nuclear gene SH3PX3 of Takifugu obscurus, Takifugu rubripes and hybrid pufferfish, and established a convenient and rapid application method, which can be used for the identification of fry of Takifugu obscurus, Takifugu rubripes and hybrid pufferfish.

[0022] Example 1

[0023] (1) Samples and treatment: 30 samples, including 10 samples each of Takifugu obscurus, Takifugu rubripes and hybrid pufferfish whose species have been clearly identified. Among them, the samples of Takifugu obscurus and hybrid pufferfish are from Jiangsu Zhongyang Group Co., Ltd. (Hai'an Base), and the samples of Takifugu rubripes are taken from the offshore of Qingdao, Shandong. 50 mg is taken from each sample, and the genomic DNA of the sample is extracted using a commercial genomic extraction kit and stored for later use.

[0024] (2) Amplification and sequencing of the SH3PX3 gene: A pair of primers was designed according to the SH3PX3 gene of the genus Takifugu, and the genomic DNA of the sample extracted in step (1) was used as a template for PCR amplification. The amplification product was sent to a gene biotechnology company for sequencing.

[0025] (3) Establishment of core SNP molecular markers for identifying Takifugu obscurus, Takifugu rubripes and hybrid pufferfish based on the SH3PX3 gene: As Figure 4As shown in the figure, the sequencing products of the SH3PX3 gene of 30 specimens of Takifugu obscurus, Takifugu rubripes and hybrid pufferfish were analyzed using molecular biology software, and peak map analysis was performed on this locus. Through comparative analysis, it was found that there is a mutation site at the 30th position of the amplified sequence of the SH3PX3 nuclear gene. The polymorphic site at this position is T, corresponding to Takifugu obscurus; the polymorphic site is C, corresponding to Takifugu rubripes; the polymorphic site is T / C, corresponding to the hybrid pufferfish. By viewing with software, Takifugu obscurus with a polymorphic site of T shows a clear and distinct single peak here, Takifugu rubripes with a polymorphic site of C shows a clear and distinct single peak here, and the hybrid pufferfish with a polymorphic site of T / C shows a clear and distinct double peak here. This indicates that this SNP locus is an effective site for differentiating Takifugu obscurus, Takifugu rubripes and hybrid pufferfish. The SH3PX3 nuclear gene sequence in the amplified region of this locus is shown in SEQ ID NO.5-7.

[0026] (3) Application of the SNP locus: To more intuitively demonstrate the unique application of the SNP, the present invention designed a pair of primers and a pair of fluorescent MGB probes based on this SNP locus, and the sequences are shown in SEQ ID NO.1-4:

[0027] Forward primer SEQ ID NO.1: 5′-GAGCCCGCAGCCTTTCT-3′;

[0028] Reverse primer SEQ ID NO.2: 5′-ATGTACGTCTTGATGCCCTTGA-3′;

[0029] Probe 1 SEQ ID NO.3: FAM-TGCTCCATTGAAGATGCCAC-MGB;

[0030] Probe 2 SEQ ID NO.4: HEX-TGCTCCATCGAAGATGCCAC-MGB.

[0031] Using the genomic DNA of Takifugu obscurus, Takifugu rubripes and hybrid pufferfish as templates respectively, fluorescence PCR amplification was performed using the primers and probes shown in SEQ ID NO.2-5.

[0032] The 25 μl reaction system for fluorescence PCR is as follows: The amplification reaction system for fluorescence PCR is 25 μL, containing 12.5 μL of fluorescence PCR Mix premix (purchased from Qingdao Lijian Biotechnology Co., Ltd.), 5 μL of DNA template, 0.5 μL of each primer (20 μM), 0.5 μL of each probe (10 μM), and 5.5 μL of water. The final concentration of the primers shown in SEQ ID NO.2-3 in the reaction system is 20 μM, and the final concentration of the probes shown in SEQ ID NO.4-5 in the reaction system is 10 μM.

[0033] The reaction conditions for fluorescence PCR are as follows: The reaction program for fluorescence PCR includes: 37°C for 2 minutes; 95°C for 2 minutes, 95°C for 15 seconds, 48°C for 30 seconds, for 45 cycles.

[0034] The amplification curves of Takifugu obscurus, Takifugu rubripes and hybrid pufferfish are as Figure 1 , Figure 2 , Figure 3 shown. Good amplification curves can be obtained by amplifying Takifugu obscurus, Takifugu rubripes and hybrid pufferfish respectively using the detection primers and probes of this SNP molecular marker.

[0035] The sequence of the SNP site amplification region of the SH3PX3 gene of Takifugu obscurus (SEQ ID NO.5): GAGCCCGCAGCCTTTCTCCTGCTCCATTGAAGATCCCACAAAACAGACCA AGTTCAAGGGCATCAAGACGTACAT;

[0036] The sequence of the SNP site amplification region of the SH3PX3 gene of Takifugu rubripes (SEQ ID NO.6): GAGCCCGCAGCCTTTCTCCTGCTCCATCGAAGATCCCACAAAACAGACCA AGTTCAAGGGCATCAAGACGTACAT;

[0037] The sequence of the SNP site amplification region of the SH3PX3 gene of hybrid pufferfish (SEQ ID NO.7): GAGCCCGCAGCCTTTCTCCTGCTCCAT(T / C)GAAGATCCCACAAAACAGACCAAGTTCAAGGGCATCAAGACGTACAT.

[0038] (4) Application of the method for establishing SNP molecular markers: The fluorescence PCR amplification results based on SNP molecular markers are shown in Table 1. Obvious amplification signals were observed in the FAM channel when amplifying Takifugu obscurus samples, and 20 ≤ Ct ≤ 35, while there was no effective amplification in the HEX channel; when amplifying Takifugu rubripes samples, both the FAM and HEX channels had effective amplifications, and the Ct value of the FAM channel was 2 - 5 greater than that of the HEX channel; when amplifying hybrid pufferfish samples, both the FAM and HEX channels had effective amplifications, and the Ct values of the FAM channel and the HEX channel were close, with the difference between the two being less than 2. Therefore, the present invention can quickly and accurately identify Takifugu obscurus, Takifugu rubripes and hybrid pufferfish through the fluorescence PCR method based on SNP molecular markers.

[0039] Table 1 Fluorescence PCR amplification results based on SNP molecular markers

[0040]

Claims

1. A composition for identifying Takifugu obscurus, Takifugu rubripes and hybrid pufferfish, characterized in that, The composition comprises a pair of primers and a set of probes, wherein the primers are as shown in SEQ ID NO.1-2; the probes are as shown in SEQ ID NO.3-4.

2. A kit for identifying Takifugu obscurus, Takifugu rubripes and hybrid pufferfish, characterized in that, The kit comprises the composition described in claim 1.

3. Use of the composition described in claim 1 in identifying Takifugu obscurus, Takifugu rubripes and hybrid pufferfish.

4. The application according to claim 3, characterized in that, The method of the use is (1) Extract genomic DNA of the sample to be tested; (2) Using the genomic DNA as a template, perform fluorescence PCR with the primer set shown in SEQ ID NO.1-2 and the probe set shown in SEQ ID NO.3-4. The 5' end of SEQ ID NO.3 is labeled with FAM, and the 5' end of SEQ ID NO.4 is labeled with HEX; (3) Judge the species of the sample to be tested according to the difference in the amplified Ct values; when there is a Ct value in the FAM signal channel and no Ct value in the HEX signal channel, the sample to be tested is Takifugu obscurus; when the Ct value in the FAM signal channel is 2-5 greater than the Ct value in the HEX channel, the sample to be tested is Takifugu rubripes; when the Ct values in the FAM channel and the HEX channel are close, and the difference between the two is less than 2, the sample to be tested is hybrid pufferfish.

Citation Information

Patent Citations

  • Application of COI sequence in quickly identifying tetraodontidae and meat products thereof

    CN109439761A

  • SNP molecular marker combination for identifying species of puffers

    CN110241225A