Application of OTUD7B as target to preparation of product for diagnosing and / or preventing and treating aortic dissection

Abstract

The invention provides application of OTUD7B serving as a target spot in preparation of products for diagnosing and / or preventing and treating aortic dissection, and belongs to the technical field of disease diagnosis and treatment. Results show that compared with healthy people, the expression of the OTUD7B in BAPN-induced aortic dissection model mice and patients with the aortic dissection is remarkably up-regulated, that is, the expression of the OTUD7B can be used for diagnosing the aortic dissection by detecting the expression of the OTUD7B. A blood vessel fibroblast knock-down OTUD7B mouse is not easy to degrade aortic dissection and elastic fibers under the induction of BAPN, and a blood vessel fibroblast high-expression OTUD7B mouse is easier to degrade aortic dissection and elastic fibers under the induction of BAPN, so that the OTUD7B inhibitor can be used for preventing and / or treating the aortic dissection. Therefore, the OTUD7B provides a target spot for diagnosing and / or preventing and treating the aortic dissection.

Description

Technical Field

[0001] The present invention belongs to the technical field of disease diagnosis and treatment, and in particular relates to an application of OTUD7B as a target in the preparation of a product for diagnosing and / or preventing and treating aortic dissection. Background Art

[0002] Cardiovascular disease is a circulatory system disease induced by multiple factors. Due to its complex pathogenesis, limited treatment and prognosis, the morbidity and mortality of cardiovascular disease have remained high and have become the primary threat to human health. Vascular damage is the main pathological form of cardiovascular disease, and the vascular damage caused by aortic dissection is particularly serious. Aortic dissection can occur at any age and is one of the most common, complex and dangerous aortic diseases in clinical practice. Once ruptured and bleeding occurs, the patient fails to receive timely diagnosis and treatment, and the mortality rate is extremely high. At present, there is still a lack of drugs that can effectively limit the progression of aortic dissection in clinical practice, and the only means of treating aortic dissection is still surgical intervention. Therefore, exploring the molecular mechanism of aortic dissection is of great significance for developing new therapeutic targets or strategies to prevent aortic dissection and reduce the mortality rate of cardiovascular disease.

[0003] The aorta is a highly complex structure that contains many different types of cells that perform diverse functions to maintain the stability of the aorta. Recent studies have found that multiple cell types in the aortic wall may play a role in regulating the occurrence and development of aortic dissection, but their exact mechanisms remain unclear. In past studies, it was believed that the degenerative changes of smooth muscle cells in the tunica media, the gradual loss of contractile function of smooth muscle cells, and the degradation of the extracellular matrix were the main pathogenic mechanisms of aortic dissection. However, more and more studies have found that other cell types in the arterial wall, including endothelial cells, inflammatory cells, and especially macrophages, are involved in smooth muscle cell remodeling, extracellular matrix reconstruction, and tissue repair. At different stages of aortic injury, repair, and remodeling, these cells and extracellular components that make up the aortic wall collaborate to adapt to the changing external environment. Using multi-omics methods, such as single-cell sequencing and single-cell spatial omics, to analyze proteins involved in the progression of aortic dissection, further explore cell transformation, communication between cell populations, and key transcription factors in the vascular wall, is of great significance for discovering new drug targets for aortic dissection.

[0004] Aortic dissection progresses rapidly, and its clinical diagnosis is usually limited. Currently, there is no convenient and rapid detection method available. Patients usually undergo imaging examinations such as ultrasound or computed tomography (CT) to obtain a confirmed diagnosis only after experiencing symptoms such as abdominal pain or chest and back pain. Ultrasound imaging is a non-invasive, harmless, and affordable method that can be used for the diagnosis and monitoring of dissection. CT helps detect aneurysms that may accompany dissection, providing important information and intervention plans for surgical intervention. However, these two methods can usually only detect problems in the late stage after the patient develops symptoms, so there is still a lack of biomarkers for early dissection for diagnosis. In addition to traditional imaging techniques, functional imaging PET based on fluorodeoxyglucose F18 (18F-FDG) tracers can also be used to evaluate arterial dissection. However, due to the non-specificity of the tracer, the diagnostic application of PET imaging in aortic dissection remains challenging. In recent years, researchers have begun to focus on metabolic-related changes in the development of aortic dissection. A variety of metabolites related to aortic dissection have been discovered, including amino acids, succinate, lipid metabolites, and phosphatidylcholine metabolites, but the specific functions and mechanisms of these metabolites need to be further verified. Discovering new metabolic markers through metabolomics methods, developing targeted molecular probe technology and more sensitive detection methods may help achieve early detection, early diagnosis and early treatment of aortic dissection, which is of great clinical significance.

[0005] Aortic dissection is a highly dangerous disease with a high mortality rate. Its pathogenesis is still unclear, which has brought a heavy burden to patients, their families and society. Improving the efficiency of diagnosis and treatment and gaining a deeper understanding of the pathogenesis are the core challenges of aortic dissection research. Therefore, there is an urgent need for large-scale studies to explore the pathogenesis of aortic dissection from different angles in order to provide strategies for the development of treatment options that can be used for human treatment in the future.

[0006] OTUD7B (OTU Deubiquitinase 7B) is a deubiquitinase. OTUD7B is reported to regulate cell cycle, tumorigenesis, neural progenitor differentiation, inflammatory response, mucosal immunity and diseases associated with the non-classical NF-kB pathway by catalyzing the deubiquitination of substrates including CyclinB, AuroraA, epidermal growth factor receptor (EGFR), GβL, Sox2, Zap70 and TRAF3. Genomic amplification of OTUD7B is frequently found in human cancers. However, the role of this deubiquitinase in the occurrence of aortic dissection is unknown. Summary of the invention

[0007] In view of this, the object of the present invention is to provide an application of OTUD7B as a target in the preparation of a product for diagnosing and / or preventing and treating aortic dissection.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides an application of a reagent for detecting OTUD7B expression in preparing a product for diagnosing aortic dissection.

[0010] Preferably, the reagent for detecting OTUD7B expression comprises an antibody for detecting OTUD7B or a primer pair for detecting OTUD7B.

[0011] Preferably, the sequences of the primer pair for detecting OTUD7B are shown as SEQ ID NO.1 and SEQ ID NO.2.

[0012] The present invention provides use of an OTUD7B inhibitor in preparing a drug for preventing and / or treating OTUD7B.

[0013] Preferably, the OTUD7B inhibitor comprises one or both of an agent that reduces OTUD7B expression and a regulator that reduces OTUD7B production.

[0014] Preferably, the reagent for reducing OTUD7B expression includes a reagent for knocking down or silencing OTUD7B; the regulator for reducing OTUD7B product includes an OTUD7B antibody or a protease for degrading OTUD7B product.

[0015] Preferably, the reagent for knocking down or silencing OTUD7B comprises siRNA, shRNA or miRNA.

[0016] Preferably, the sequence of the shRNA is shown as SEQ ID NO.3 and SEQ ID NO.4.

[0017] The present invention provides a drug for treating aortic dissection, comprising shRNA as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0018] The present invention provides a system for diagnosing aortic dissection, comprising a data processing device and a detection device, wherein the detection device is used to detect the expression level of OTUD7B in a test sample and a healthy sample; the data processing device comprises a conclusion output module, and if the expression level of OTUD7B in the test sample is significantly increased compared with the expression level of OTUD7B in the healthy sample, the test sample is diagnosed as suffering from aortic dissection.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention provides an application of OTUD7B as a target in the preparation of a product for diagnosing and / or preventing aortic dissection. The study found that compared with healthy people, OTUD7B was significantly upregulated in BAPN-induced aortic dissection model mice and patients with aortic dissection, that is, the detection of OTUD7B expression can be used to diagnose aortic dissection. Mice with OTUD7B knockdown in vascular fibroblasts are less likely to have aortic dissection and elastic fiber degradation under BAPN induction, and mice with high expression of OTUD7B in vascular fibroblasts are more likely to have aortic dissection and elastic fiber degradation under BAPN induction, indicating that OTUD7B inhibitors can be used to prevent and / or treat aortic dissection. In addition, the study also found that OTUD7B promotes vascular extracellular matrix degradation by regulating the inflammatory phenotype of vascular smooth muscle, and knocking down OTUD7B improves this phenomenon. Therefore, OTUD7B provides a new target for diagnosing and / or preventing aortic dissection. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The volcano plot of differentially expressed genes in the ascending aorta vascular tissue of patients with aortic dissection and healthy blood vessels. Log2(FC)≥1 or ≤-1, P.adjust<0.05 are significantly differentially expressed genes, among which red is the gene that is up-regulated in the vascular tissue of patients with aortic dissection compared with healthy blood vessels, and blue is the gene that is down-regulated in the vascular tissue of patients with aortic dissection compared with healthy blood vessels;

[0022] Figure 2 The results of OTUD7B upregulation in single-cell sequencing data of patients with aortic aneurysm and dissection, A is the UMAP clustering diagram of single-cell blood vessels of patients with aortic aneurysm and dissection in GSE155468; B is the result that OTUD7B is mainly expressed in fibroblasts; C is the result that the expression content of OTUD7B in fibroblasts of blood vessels of patients with aortic aneurysm and dissection (n=3) is significantly increased compared with that in healthy blood vessels (n=8);

[0023] Figure 3The results of up-regulation of OTUD7B expression in fibroblasts of patients with aortic dissection, A is the result of increased OTUD7B mRNA level in vascular tissue of patients with aortic dissection (Dissection) compared with healthy vascular tissue; B is the result of increased OTUD7B protein expression level in vascular tissue of patients with aortic dissection (Dissection) compared with healthy vascular tissue; C is a representative image of immunofluorescence staining of OTUD7B (red), COL1A2 (green) and DAPI (blue) in cross-section of healthy blood vessels (Healthy) and human aortic dissection (Dissection) vascular tissue, the scale bar is 20μm, where A represents the adventitia and M represents the media; D is the statistical results of immunofluorescence staining of healthy blood vessels (Healthy) and human aortic dissection (Dissection) vascular tissue;

[0024] Figure 4 The results of increased OTUD7B expression in fibroblasts in the vascular tissue of the mouse aortic dissection model, A shows aortic dissection in mice after BAPN treatment; B shows the mRNA level of OTUD7B in the vascular tissue of the control group (Water) and aortic dissection (BAPN) mice; C shows the protein level of OTUD7B in the vascular tissue of the control group (Water) and aortic dissection (BAPN) mice; D shows a representative immunofluorescence staining of OTUD7B (red), COL1A2 (green) and DAPI (blue) in the cross section of vascular tissue, the scale bar is 20 μm, A represents the adventitia, and M represents the media; E shows the statistical results of immunofluorescence staining of OTUD7B (red), COL1A2 (green) and DAPI (blue) in the cross section of vascular tissue;

[0025] Figure 5 Construction and identification of mice with specific high expression of OTUD7B in fibroblasts. A is a schematic diagram of the construction of mice with high expression of OTUD7B in fibroblasts (AAV-OTUD7B); B is the vascular morphology of control (AAV-Control) and AAV-OTUD7B mice, with a scale bar of 2 mm; C is the detection of OTUD7B expression in fibroblasts of AAV-COL1A2-Control and AAV-COL1A2-OTUD7B mice, representative images of immunofluorescence staining of OTUD7B (red) and DAPI (blue) in cross-sections of vascular tissues, and statistical results, with a scale bar of 40 μm;

[0026] Figure 6The results show that high expression of OTUD7B in fibroblasts significantly increases the formation of aortic dissection. A is a schematic diagram of the aortic dissection model experiment of AAV-Control and AAV-OTUD7B mice; B is a comparison of vascular dissection formation between mice with high expression of OTUD7B in fibroblasts (AAV-OTUD7B) and control group (AAV-Control) mice, with a scale bar of 2 mm; C is a comparison of the proportion of dissection formation between mice with high expression of OTUD7B in fibroblasts (AAV-OTUD7B) and control group (AAV-Control) mice; D is a comparison of elastic membrane rupture between mice with high expression of OTUD7B in fibroblasts (AAV-OTUD7B) and control group (AAV-Control) mice, with a scale bar of 100 μm;

[0027] Figure 7 The results of fibroblasts overexpressing OTUD7B lead to increased inflammation in smooth muscle cells. A is a schematic diagram of the method of culturing smooth muscle cells with fibroblast-conditioned medium; B is the mRNA levels of smooth muscle cell-related inflammatory factors Mcp-1, Il-6 and Nos2 after fibroblasts overexpress OTUD7B;

[0028] Figure 8 To show the results of knocking down OTUD7B to inhibit the occurrence of aortic dissection, A is the comparison of OTUD7B expression in the blood vessels of mice constructed from different groups; B is the overall vascular map of aortic dissection in BAPN-induced control and OTUD7B knockdown mice; C is the aortic dissection formation ratio of the control group and OTUD7B knockdown mice; D is the elastic membrane staining and quantitative results of the control group and OTUD7B knockdown mice; E is the comparison of inflammatory factors and matrix metalloproteinase mRNA levels in the control group and OTUD7B knockdown mice;

[0029] Fig. 9 The differentially expressed genes and KEGG pathway analysis after knocking down OTUD7B in smooth muscle cells. A is a heat map of differentially expressed genes showing that SLC25A1 is downregulated in smooth muscle cells with low OTUD7B expression; B is a GO functional annotation analysis showing that 14.5% of the differentially expressed genes are involved in metabolism-related pathways; C is a KEGG analysis showing the results of TCA cycle interference;

[0030] Fig.10 Overexpression of OTUD7B upregulates SLC25A1 expression, and knockdown of OTUD7B reduces SLC25A1 expression. A: OTUD7B was knocked down in fibroblasts, and the mRNA level of SLC25A1 was downregulated; B: Overexpression of OTUD7B in fibroblasts resulted in upregulation of SLC25A1 mRNA level; C: Mitochondrial dysfunction after overexpression of OTUD7B in fibroblasts. DETAILED DESCRIPTION

[0031] The present invention provides an application of a reagent for detecting OTUD7B expression in preparing a product for diagnosing aortic dissection.

[0032] In the present invention, the reagent for detecting OTUD7B expression includes an antibody for detecting OTUD7B or a primer pair for detecting OTUD7B. The method for detecting OTUD7B expression can be a Western Blot or QPCR method. The sequence of the primer pair for detecting OTUD7B is shown in SEQ ID NO.1 and SEQ ID NO.2. The present invention obtains the GSE155468 data set through the GEO database and the RNA transcriptome sequencing of the blood vessels of patients with aortic dissection, and finds that the expression content of OTUD7B in the blood vessels of aortic dissection is significantly increased. The expression of OTUD7B in the blood vessels of clinical patients with aortic dissection and aortic dissection mouse models is further detected. The results show that compared with the control group, the OTUD7B in the blood vessels of patients with aortic dissection and aortic dissection mice is significantly increased. On the other hand, fibroblasts with high expression of OTUD7B are also constructed. It is found that fibroblasts with high expression of OTUD7B aggravate the formation of aortic dissection. The above results show that OTUD7B can be used as a detection target for diagnosing aortic dissection or assessing the risk of aortic dissection.

[0033] The present invention provides use of an OTUD7B inhibitor in preparing a drug for preventing and / or treating OTUD7B.

[0034] In the present invention, the OTUD7B inhibitor includes one or both of an agent that reduces OTUD7B expression and a regulator that reduces OTUD7B products. The agent that reduces OTUD7B expression includes an agent that knocks down or silences OTUD7B; the regulator that reduces OTUD7B products includes an OTUD7B antibody or a protease that degrades OTUD7B products. The agent that knocks down or silences OTUD7B includes siRNA, shRNA or miRNA. The sequence of the shRNA is shown in SEQ ID NO.3 and SEQ ID NO.4. The present invention uses shRNA to construct OTUD7B knockdown mice. As a result, it is found that the formation of aortic dissection is weakened and the mortality rate is reduced in OTUD7B knockdown mice. Therefore, the OTUD7B inhibitor can be used to prevent and / or treat aortic dissection.

[0035] The present invention provides a drug for treating aortic dissection, comprising shRNA as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0036] In the present invention, the shRNA can reduce the risk of aortic dissection, thereby achieving the purpose of treating aortic dissection. In the present invention, the drug also includes a pharmaceutically acceptable excipient. The present invention has found that the shRNA shown in SEQ ID NO.3 and SEQ ID NO.4 as the only active ingredient can be used to prevent and treat aortic dissection.

[0037] The present invention provides a system for diagnosing aortic dissection, comprising a data processing device and a detection device, wherein the detection device is used to detect the expression level of OTUD7B in a test sample and a healthy sample; the data processing device comprises a conclusion output module, and if the expression level of OTUD7B in the test sample is significantly increased compared with the expression level of OTUD7B in the healthy sample, the test sample is diagnosed as suffering from aortic dissection.

[0038] In the present invention, the data processing device further includes a data input module, a data recording module and a data comparison module; the data input module is configured to input the OTUD7B expression value of the sample to be tested and the healthy sample; the data recording module is configured to store the OTUD7B expression value of the sample to be tested and the OTUD7B expression value of the healthy sample; the data comparison module is configured to receive the OTUD7B expression value of the sample to be tested and the OTUD7B expression value of the healthy sample sent by the data input module, and compare the OTUD7B expression value of the healthy sample with the OTUD7B expression value of the sample to be tested from the data recording module; the conclusion output module is configured to receive the comparison result sent by the data comparison module, and judge the comparison result according to a predetermined judgment condition. The predetermined judgment condition is that if the expression amount of OTUD7B of the sample to be tested is significantly increased compared with the expression amount of OTUD7B of the healthy sample, the sample to be tested is diagnosed as suffering from aortic dissection.

[0039] In the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0040] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0041] In the following examples, BPAN with a concentration of 0.5% was prepared by mixing 5 g of BAPN with 1 L of water.

[0042] Example 1

[0043] (1) OTUD7B expression level is upregulated in vascular RNA transcriptome sequencing of patients with aortic dissection

[0044] Study subjects: 18 patients with aortic dissection, male to female ratio of 7:2, age 55.4±10.13 years old, inclusion criteria for aortic dissection: clinical diagnosis of aortic dissection upon admission, exclusion criteria: vascular diseases due to genetic reasons, such as Marfan syndrome. 12 healthy subjects, male to female ratio of 5:1, age 51.67±6.46 years old.

[0045] In order to study the changes of OTUD7B in aortic dissection, ascending aorta vascular tissues of patients with aortic dissection and blood vessels of healthy subjects were collected, RNA transcriptome sequencing was performed, differentially expressed genes were screened, and the expression content of OTUD7B was analyzed.

[0046] Figure 1 The results showed that compared with healthy people, the expression level of OTUD7B was significantly increased in the vascular tissue of patients with aortic dissection.

[0047] (2) In GSE155468, OTUD7B is highly expressed mainly in fibroblasts

[0048] The single-cell sequencing data of aortic aneurysm and dissection were screened in the GEO database to obtain the GSE155468 dataset. First, the dataset was reanalyzed using Seurat, and 11 cell populations including fibroblasts, smooth muscle cells, and macrophages were obtained after cell clustering (see Figure 2 A). The expression level of OTUD7B in each cell population was analyzed.

[0049] Figure 2 The results showed that OTUD7B was mainly expressed in fibroblasts (see Figure 2 In B), the expression of OTUD7B was significantly increased in fibroblasts of aortic dissection vessels (see Figure 2 C).

[0050] (3) OTUD7B expression level is upregulated in blood vessels of patients with aortic dissection

[0051] To further confirm the relationship between OTUD7B and aortic dissection, total protein and RNA were collected and extracted from vascular tissues of clinical patients with aortic dissection and healthy subjects. The mRNA and protein levels of OTUD7B in vascular tissues of patients with aortic dissection and healthy subjects were measured by real-time fluorescence quantitative PCR. The specific steps are as follows:

[0052] The basic principle of real-time fluorescence quantitative PCR is to use the property of DNA polymerase to synthesize new DNA chains during the PCR process, combined with a fluorescently labeled probe or dye, to measure the progress of the PCR reaction by real-time monitoring of the increase in fluorescence signals. At the beginning of the PCR reaction, primers complementary to specific regions of the OTUD7B sequence bind to both ends of the DNA template sequence from the patient's blood vessels. The forward primer is 5'-TGTCCGATTGGCCAGTATAA-3' (SEQ ID NO.1). The reverse primer is 5'-ACAGTGGGATCCACTTCACA-3' (SEQ ID NO.2).

[0053] In real-time fluorescence quantitative PCR, a fluorescently labeled probe is also added. When the probe binds to the target DNA, it is cut by DNA polymerase, releasing the fluorescent molecule, resulting in an increase in the fluorescent signal. The intensity of this fluorescent signal is proportional to the amount of target DNA in the PCR reaction.

[0054] The PCR reaction system was 20 μL: 10 μL 2×SYBR Green qPCRMix, 6 μL enzyme-free water, 1 μL 2 μM forward primer, 1 μL 2 μM reverse primer, and 2 μL cDNA template;

[0055] The internal reference reaction system was 20 μL: 10 μL Mastermix, 6 μL enzyme-free water, 1 μL 2 μM internal reference 18s forward primer, 1 μL 2 μM internal reference 18s reverse primer, and 2 μL cDNA template;

[0056] The forward primer of the internal reference 18s is: 5'-AAACGGCTACCACATCCAAG-3' (SEQ ID NO.5), and the reverse primer is: 5'-CCTCCAATGGATCCTCGTTA-3' (SEQ ID NO.6).

[0057] The PCR reaction program was: 95°C for 10 min; 95°C for 10 s, 65°C for 30 s, and 40 cycles.

[0058] The fluorescence signal was read at the end of each cycle.

[0059] The cycle value at which the fluorescence signal is obtained is recorded as the Ct value.

[0060] Adoption 2 -[Ct(内参18S)-Ct(OUD7B)] The relative content of the target gene in the sample was calculated.

[0061] The diseased vessels came from patients with aortic dissection who underwent vascular replacement, and the healthy tissues came from heart and liver transplant recipients, patients who received TAVI / TAVR (Transcatheter aortic valve implantation / replacement) or patients who died of non-vascular diseases, all of whom had obtained informed consent. The samples were carefully transported under dry ice to ensure that the quality of the specimens was suitable for subsequent experiments.

[0062] Among them, there were 18 cases of patients with aortic dissection, including 14 males and 4 females, aged 55.44±10.13 years old. The inclusion criteria for aortic dissection disease were: clinical admission diagnosis of aortic dissection. Exclusion criteria were: vascular diseases caused by genetic reasons, such as Marfan syndrome. There were 12 healthy people, including 10 males and 2 females, aged 51.67±6.46 years old.

[0063] Figure 3 The results showed that compared with healthy blood vessels, the mRNA expression of OTUD7B in the vascular tissue of patients with aortic dissection was significantly increased (see Figure 3 A) and protein levels (see Figure 3 B) were significantly increased, indicating that OTUD7B may be involved in the occurrence and development of aortic dissection.

[0064] To further confirm the main cell type expressing OTUD7B, immunofluorescence staining experiments were performed.

[0065] Figure 3 The results in C to D showed that OTUD7B was highly expressed in fibroblasts of vascular tissue of patients with aortic dissection compared with healthy blood vessels.

[0066] (4) OTUD7B expression level is upregulated in blood vessels of aortic dissection mouse model

[0067] Subsequently, an aortic dissection mouse model was established. Wild-type C57 mice aged 3 weeks were randomly divided into two groups: a control group and a BAPN-treated group, with 10 mice in each group. The BAPN-treated group was fed with 0.5% BPAN (β-Aminopropionitrile) in drinking water for 4 weeks, and the control group was fed with water for 4 weeks and then killed after 4 weeks. The whole aortic tissue was obtained, and aortic sections were made after partial fixation, and the expression of OTUD7B protein was detected by immunofluorescence staining. After the remaining aortic tissue was quickly frozen in liquid nitrogen, a part was used to extract RNA, and QPCR was used to detect the mRNA expression of OTUD7B using primers F: TGTCCGATTGGCCAGTATAA (SEQ ID NO.1) and R: ACAGTGGGATCCACTTCACA (SEQ ID NO.2); a part was used to extract protein, and Western Blot was used to detect the expression of OTUD7B protein.

[0068] The results showed that aortic dissection occurred after BAPN treatment (see Figure 4 The expression of OTUD7B in the BAPN-treated group was significantly increased compared with that in the control group (see Figure 4 B~C).

[0069] At the same time, the cross-sections of vascular tissues in the control group and the BAPN-treated group were subjected to immunofluorescence staining, and it was found that the fluorescence intensity of OTUD7B in the Clo1a2-positive cells in the BAPN-treated group was significantly increased (see Figure 4 D~E).

[0070] (5) Construction of mice with high OTUD7B expression in fibroblasts

[0071] A mouse with high expression of OTUD7B in fibroblasts was constructed. The overexpression plasmid pAd-track-OTUD7B (the sequence of OTUD7B is shown in NCBI's Gene ID: 229603, commissioned by Hanbio Biotech (Shanghai) Co., Ltd. to construct and synthesize) or pAd-track (purchased from Hanbio Biotech (Shanghai) Co., Ltd.) was transformed into BJ5183 Escherichia coli to cause recombination, and then a single clone was picked. After successful restriction digestion identification, it was transformed into Escherichia coli DH5A, amplified by bacterial liquid, and after plasmid extraction, it was linearized with restriction endonuclease PAC1. The linearized plasmid was transfected into 293A cells to construct a fibroblast-specific promoter (COL1A2) to drive the expression of OTUD7B. Adeno-associated virus (AAV2 / 9-COL1A2-OTUD7B-Flag) or AAV-COL1A2-control, the AAV2 / 9-COL1A2-OTUD7B-Flag) or AAV-COL1A2-control is injected into the tail vein, the injection volume is 10 to the 12th power vg / mouse, the OTUD7B gene can be overexpressed, and fibroblasts high-expressing OTUD7B mice (AAV-OTUD7B) and control mice (AAV-control) are obtained respectively.

[0072] After 3 weeks, the blood vessels were isolated and removed (see Figure 5 A in the figure), and the blood vessels appear normal (see Figure 5 B), the expression of OTUD7B in the mouse vascular adventitia was detected by immunofluorescence staining. The results of immunofluorescence staining showed that OTUD7B was highly expressed in the mouse vascular adventitia (see Figure 5 C), indicating that mice with high expression of OTUD7B in fibroblasts were successfully constructed.

[0073] (6) Overexpression of OTUD7B promotes BAPN-induced aortic dissection in mice

[0074] Referring to the method of step (5), control mice (AAV-control) and fibroblast high expression OTUD7B mice (AAV-OTUD7B) were constructed, with 8 mice in each group. One week after the virus was injected into the tail vein, AAV-control mice and AAV-OTUD7B mice were fed with 0.5% BPAN (β-Aminopropionitrile) in drinking water for 4 weeks, and the vascular phenotype of the two groups of mice was analyzed. The specific experimental schematic diagram is shown in Figure 6 A in.

[0075] The results showed that the blood vessels of AAV-OTUD7B mice had more severe aortic dissection than those of AAV-control mice, suggesting that high expression of OTUD7B in fibroblasts aggravates the formation of aortic dissection (see Figure 6 (B).

[0076] The mortality rate of mice was counted during the BAPN induction process, and the results showed that AAV-OTUD7B mice had a higher incidence of dissection compared with AAV-control mice (see Figure 6 C), the elastic membrane breaks more (see Figure 6 D).

[0077] (7) Overexpression of OTUD7B in fibroblasts leads to increased inflammation in smooth muscle cells

[0078] The effect of overexpression of OTUD7B in fibroblasts on inflammation of smooth muscle cells was detected on cells. The pCDH-Otud7b treatment group was constructed by inserting OTUD7B into the lentiviral pCDH vector (the sequence of OTUD7B can be found in NCBI's Gene ID: 229603 ， Hanheng Biotech (Shanghai) Co., Ltd. was commissioned to construct and synthesize) to obtain pCDH-Otud7b. The viral packaging plasmid PxpAx2:PMD2g:pCDH-Otud7b was transfected into 293 cells at a ratio of 4:3:1. After 48 hours, the supernatant was collected to obtain the pCDH-OTUD7B high-expression lentivirus, which was added to fibroblasts to overexpress OTUD7B. After 48 hours of culture, the culture medium was collected and added to smooth muscle cells (see Figure 7 A in the figure). In the control group, the virus packaging plasmid PxpAx2:PMD2g:pCDH was transfected into 293 cells at a ratio of 4:3:1. After 48 hours, the supernatant was collected and added to fibroblasts. After 48 hours of culture, the culture medium was collected and added to smooth muscle cells. Each group was repeated 5 times. The expression of proinflammatory factors MCP-1, IL-6, and NOS2 in smooth muscle cells of the control group and pCDH-Otud7b treatment group was detected by optical quantitative PCR.

[0079] Compared with the control group, the expression of pro-inflammatory factors MCP-1, IL-6, and NOS2 in smooth muscle cells increased after they were cultured in fibroblast medium with high expression of OTUD7B (see Figure 7 B), indicating that OTUD7B in fibroblasts promotes inflammatory damage to smooth muscle cells.

[0080] (8) OTUD7B knockdown inhibits BAPN-induced aortic dissection in mice

[0081] In order to verify the effect of OTUD7B on aortic dissection in vivo, OTUD7B knockdown mice were constructed. The knockdown plasmid pAd-track-OTUD7B-shRNA was transformed into BJ5183 E. coli to allow recombination, and then a single clone was picked. After successful restriction digestion identification, it was transformed into E. coli DH5A, amplified by bacterial liquid, and the plasmid was extracted and linearized with restriction endonuclease PAC1. The linearized plasmid was transfected into 293A cells to obtain adeno-associated virus for OTUD7B knockdown shRNA. Then, 3-week-old WT mice were selected and injected with adeno-associated virus for OTUD7B knockdown shRNA through the tail vein. The injection volume per day was: 10 11 vg / mouse, injected once in total, and OTUD7B knockdown mice (Otud7b-si group) were obtained 7 days after tail vein injection.

[0082] OTUD7B knockdown shRNA constructed with shRNA sequences:

[0083] OTUD7B-shRNA-F:5'

[0084] -CCGGGAGCACTATGAGGATCGCAATCTCGAGATTGCGATCCTCATAGTGCT CTTTTTG-3'(SEQID NO.3);

[0085] OTUD7B-shRNA-R:5'

[0086] -AATTCAAAAAGAGCACTATGAGGATCGCAATCTCGAGATTGCGATCCTCAT AGTGCTC-3' (SEQ ID NO. 4).

[0087] Among them, pAd-track-OTUD7B-shRNA was constructed by using the above-mentioned shRNA sequence and commissioned by Hanheng Biotechnology (Shanghai) Co., Ltd.

[0088] The control group (NC) was a virus that did not contain shRNA sequences.

[0089] After feeding Otud7b-si mice and NC mice with 0.5% BPAN (β-Aminopropionitrile) in drinking water for 4 weeks, the mortality rates were counted. The expression of OTUD7B protein was detected by Western Blot.

[0090] Figure 8 The results in A showed that compared with NC, the expression level of OTUD7B in the blood vessels of Otud7b-si group mice was significantly decreased, so the present invention successfully constructed OTUD7B knockdown mice.

[0091] After the whole aortic tissue was removed, photos were taken under a stereomicroscope to compare the changes in aortic vascular morphology and the severity of dissection.

[0092] Figure 8 The results in B showed that aortic dissection was attenuated in OTUD7B knockdown mice compared with the control group.

[0093] Figure 8 The results in C show that the proportion of interlayer formation was reduced in OTUD7B knockdown mice compared with the control group.

[0094] The ascending aorta was fixed, embedded in paraffin and sliced, and HE and EVG staining were performed on each group to compare whether there was any difference in vascular elastic fiber rupture.

[0095] The results showed that compared with the control group, the degradation of extracellular elastic fibers in OTUD7B knockdown mice was significantly reduced (see Figure 8 D).

[0096] Subsequently, the liquid nitrogen-frozen aortic tissues of each group were taken out to detect the mRNA and protein levels of inflammatory factors.

[0097] The results showed that compared with the control group, OTUD7B knockdown mice had attenuated vascular inflammation and decreased expression of extracellular matrix metalloproteinases (see Figure 8 E).

[0098] (9) OTUD7B promotes aortic dissection by affecting mitochondrial function of cells

[0099] In order to further explore the mechanism by which OTUD7B is involved in the occurrence and development of aortic dissection, the existing transcriptome sequencing data of smooth muscle cells with OTUD7B knockdown were re-analyzed, and the control group was smooth muscle cells that had not undergone any gene editing.

[0100] The results showed that compared with the control group, 14.5% of the differentially expressed genes regulated metabolic processes after OTUD7B was low expressed (see Fig. 9 A, B in it).

[0101] KEGG signaling pathway analysis showed that low expression of OTUD7B disrupted smooth muscle cell glycolysis, metabolic pathways, FcγR signaling pathway (fc gamma R-mediated phagocytosis), tricarboxylic acid cycle (pitrate cycle), pyruvate metabolism, etc. (see Fig. 9C), indicating that smooth muscle cells with low OTUD7B expression have disorders in multiple biological processes such as citrate transport and tricarboxylic acid cycle. OTUD7B may participate in regulating the formation of aortic dissection by affecting the mitochondrial function of cells.

[0102] (10) OTUD7B reduces the level of inflammation in vascular smooth muscle cells via citrate transporter

[0103] In fibroblasts with low OTUD7B expression (obtained by adding the above-constructed adeno-associated virus for knocking down OTUD7B shRNA to cultured fibroblasts) and fibroblasts with high OTUD7B expression (obtained by adding the above-constructed pCDH-OTUD7B high-expression lentivirus to cultured fibroblasts), the mRNA level of citrate transporter SLC25A1 was detected in 5 parallels in each group, with the control virus (i.e., not containing the siRNA sequence or the pCDH vector not carrying OTUD7B) added as the control group (NC).

[0104] The results showed that the mRNA level of citrate transporter SLC25A1 was significantly downregulated in fibroblasts with low expression of OTUD7B compared with the control group (see Fig.10 Middle A), fibroblasts highly expressed OTUD7B, which significantly upregulated the mRNA level of SLC25A1 (see Fig.10 B), leading to mitochondrial dysfunction (see Fig.10 C).

[0105] In summary, the present invention found that overexpression of OTUD7B promotes the occurrence of aortic dissection, knocking down OTUD7B inhibits the occurrence of aortic dissection, and detecting OTUD7B can be used to diagnose aortic dissection. Mechanistically, overexpression of OTUD7B promotes inflammation of vascular smooth muscle cells and expression of matrix metalloproteinases by promoting the expression of citrate transporter SLC25A1, thereby promoting the occurrence of aortic dissection.

[0106] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting OTUD7B expression in the preparation of a product for diagnosing aortic dissection.

2. The use according to claim 1, characterized in that: The reagent for detecting OTUD7B expression includes an antibody for detecting OTUD7B or a primer pair for detecting OTUD7B.

3. The use according to claim 2, characterized in that: The sequences of the primer pair for detecting OTUD7B are shown in SEQ ID NO.1 and SEQ ID NO.

2.

4. Use of an OTUD7B inhibitor in the preparation of a drug for preventing and / or treating OTUD7B.

5. The use according to claim 4, characterized in that: The OTUD7B inhibitor includes one or both of an agent that reduces OTUD7B expression and a regulator that reduces OTUD7B production.

6. The use according to claim 5, characterized in that: The reagent for reducing OTUD7B expression includes a reagent for knocking down or silencing OTUD7B; the regulator for reducing OTUD7B product includes an OTUD7B antibody or a protease for degrading OTUD7B product.

7. The use according to claim 6, characterized in that: The reagent for knocking down or silencing OTUD7B includes siRNA, shRNA or miRNA.

8. The use according to claim 7, characterized in that: The sequences of the shRNA are shown in SEQ ID NO.3 and SEQ ID NO.

4.

9. A drug for treating aortic dissection, characterized in that: Includes shRNAs as shown in SEQ ID NO.3 and SEQ ID NO.

4.

10. A system for diagnosing aortic dissection, characterized in that: The method comprises a data processing device and a detection device, wherein the detection device is used to detect the expression level of OTUD7B in the sample to be tested and the healthy sample; the data processing device comprises a conclusion output module, and if the expression level of OTUD7B in the sample to be tested is significantly increased compared with the expression level of OTUD7B in the healthy sample, the sample to be tested is diagnosed as suffering from aortic dissection.

Images