Composition for regulating miRNA expression quantity to achieve skin anti-aging and soothing effects and application thereof

Abstract

The invention discloses a composition for regulating miRNA (micro Ribonucleic Acid) expression quantity to achieve skin anti-aging and soothing effects and application of the composition. The invention relates to an anti-aging and soothing composition, which consists of the following components in percentage by weight: 50 to 90 percent of solvent, 1 to 20 percent of transdermal absorption enhancer and 10 to 25 percent of active ingredient A, or 50-90% of a solvent and 10-25% of an active component A; the invention relates to a group of compositions containing saccharomycetes polypeptides, a sea-buckthorn kernel extract and a nannochloropsis oculata extract, and the contents of miR-365b-5p, miR-641 and miR-3614-5p are regulated, so that the expression of genes such as ATP5F1E (ATP synthase), PTGS2 (cyclooxygenase), ITGA2 (integrin alpha2), COL1 (type I collagen), IL-15 and the like is regulated, and the anti-aging and soothing effects are realized. The invention further discloses application of the composition containing the saccharomycetes polypeptide, the sea-buckthorn kernel extract and the nannochloropsis oculata extract.

Description

Technical Field

[0001] The present invention relates to the technical field of cosmetic application, and in particular to a composition and its application that can regulate three miRNAs, namely miR-365b-5p, miR-641 and miR-3614-5p, thereby down-regulating the expression of genes such as PTGS2 and IL-17 and up-regulating the expression of genes such as ATP5F1E, ITGA2 and COL1, so as to achieve soothing and anti-aging effects. Background Art

[0002] In the cosmetics field, anti-aging has always been the most pressing and demanding issue for consumers. In modern society, the fast pace, high pressure, unhealthy diet and other factors have accelerated the aging of the skin, and wrinkles, sagging skin, decreased elasticity and other aging characteristics have become younger, which has also led to an increasing demand for cosmetics with anti-aging effects. At present, most anti-aging products achieve anti-aging effects through anti-oxidation, anti-glycation, and collagen supplementation / promotion. Most of their specific targets and pathways are not very clear, and they are gradually unable to meet the growing needs of consumers.

[0003] With the development and progress of genomics, epigenetics and detection methods (such as qRT-PCR), the research on anti-aging targets has also been detailed to the molecular level. microRNA, also known as microRNA or miRNA, is a non-coding single-stranded RNA that participates in post-transcriptional gene expression regulation in animals and plants. miRNA can regulate the target mRNA by destroying the stability of the target mRNA and inhibiting the translation of the target mRNA. In epigenetics, the regulation of epigenetics by miRNA can be simply understood as: miRNA will inhibit the expression of target mRNA, and then inhibit the expression of related proteins. In other words: high expression of miRNA corresponds to the expression of low-related proteins, and low expression of miRNA corresponds to the expression of high-related proteins. And miRNA is one of the ways to finely regulate gene expression, regulating one-third of human genes. Among them, inflammatory factors and collagen related to aging are the result of gene expression.

[0004] Currently, there are no products or functional compositions on the market that can achieve fine-tuned regulation of skin aging, barrier control, etc. by regulating one or several specific miRNAs. Summary of the invention

[0005] In view of the shortcomings of the prior art, the first purpose of the present invention is to provide a composition comprising yeast polypeptides, Hippophae Rhamnoides kernel extract, and Nannocholoropsis OCULATA extract, which regulates the content of miR-365b-5p, miR-641, and miR-3614-5p, thereby regulating the expression of genes such as ATP5F1E (ATP synthase), PTGS2 (cyclooxygenase), ITGA2 (integrin α2), COL1 (type I collagen), and IL-15, thereby achieving anti-aging and soothing effects.

[0006] The second object of the present invention is to provide an application of a composition comprising yeast polypeptides, Hippophae rhamnoides kernel extract and Nannochloropsis oculata extract.

[0007] In order to achieve the above first purpose, the following technical solution is provided:

[0008] An anti-aging and soothing composition, which is composed of 50-90% solvent, 1-20% transdermal absorption enhancer, and 10-25% active ingredient A according to weight percentage;

[0009] Or the solvent is 50-90%, and the active ingredient A is 10-25%. Even without the transdermal absorption enhancer, the active ingredient A has the corresponding effect of regulating miRNA. The transdermal absorption enhancer can further promote the active ingredient A to enter the skin more and faster.

[0010] The active ingredient A is selected from at least two or more of yeast polypeptides, Hippophae rhamnoides kernel extracts, and Nannochloropsis oculata extracts.

[0011] The preparation method of the yeast polypeptides comprises the following steps:

[0012] Step 1: placing the fermented saccharomyces cerevisiae suspension in a stirring pot, adding β-glucanase for stirring and enzymolysis;

[0013] Step 2: Heat the materials in the stirring pot to 90-100°C and stir to inactivate the enzyme for 30-60 minutes;

[0014] Step 3: Turn on the cooling device to 25-50°C, transfer the material into the centrifugal device, and collect the supernatant after centrifugation;

[0015] Step 4: Filter the material through 800 mesh to obtain yeast polypeptides.

[0016] The preparation method of the Hippophae rhamnoides kernel extract comprises the following steps:

[0017] Step 1: Material selection and cleaning: Select sea buckthorn seeds as raw materials, clean and pre-treat them into powder;

[0018] Step 2: Extraction: Add sea buckthorn seed powder into a stirring pot, then add 99% alcohol with a mass 9 times that of sea buckthorn seed powder into the stirring pot, stir for 10-30 minutes, then transfer the material into an ultrasonic equipment pot, ultrasonically treat for 5 minutes to 30 minutes, and the ultrasonic frequency is 22kHz to 26kHz to complete the extraction operation;

[0019] Step 3: impurity removal: transfer the material from the ultrasonic equipment pot to the stirring pot, add deionized water with a mass of 99% alcohol, stir and heat to 70-90°C, keep warm and stir for 30 minutes, then cool to 25-45°C, filter the material with 800 mesh, and obtain Hippophae rhamnoides kernel extract.

[0020] The preparation method of the Nannochloropsis oculata extract comprises the following steps:

[0021] Step 1: Material selection and cleaning: Select Nannochloropsis oculata as raw material, clean it, and pre-treat it into powder;

[0022] Step 2: Extraction: add deionized water into a stirring pot, heat it to 70°C-90°C while stirring, keep it warm for 20min-40min, then cool it to 25-50°C, add the eye-shaped veined Nannochloropsis oculata powder into the stirring pot, stir for 10-30min, then transfer the material into the pot of an ultrasonic device, perform ultrasonic treatment for 5min-30min, the ultrasonic frequency is 18kHz-22kHz, filter the material with 800 mesh, and obtain the eye-shaped veined Nannochloropsis oculata (NANNOCHLOROPSIS OCULATA) extract.

[0023] Preferably, the anti-aging and soothing composition is composed of: 55-85% solvent, 1-18% transdermal absorption enhancer, and 10-20% active ingredient A according to weight percentage.

[0024] Preferably, the anti-aging and soothing composition is composed of: 58-75% solvent, 8-15% transdermal absorption enhancer, and 11-20% active ingredient A according to weight percentage.

[0025] Preferably, the solvent is selected from at least two or more of 1,3-propylene glycol, 1,3-butylene glycol, and 1,2-hexanediol;

[0026] The transdermal absorption enhancer is selected from one or more of bis-diethoxydiglycol cycloalkane 1,4-dicarboxylate, 1,2-pentanediol and tetrahydropiperine.

[0027] Furthermore, to achieve the above first objective, the present invention provides the following technical solutions:

[0028] A method for preparing an anti-aging and soothing composition, the steps of the preparation method are:

[0029] 1) Add active ingredient A to the solvent, and mix and stir until there is no insoluble matter;

[0030] 2) adding a transdermal absorption enhancer to the mixture of step 1) and stirring the mixture to obtain an anti-aging and soothing composition.

[0031] The operations of steps 1) and 2) are all carried out at room temperature.

[0032] By adopting the above technical scheme, the anti-aging and soothing composition can be produced at room temperature by producing at normal temperature, which is simple and fast to operate, supports cold preparation process and reduces energy consumption.

[0033] The anti-aging and soothing composition is further made of the following raw material components according to weight percentage:

[0034] 1,3-Butanediol 10-50%; 1,3-Propanediol 5-30%; 1,2-Pentanediol 5-10%; Bis-diethoxydiglycol cycloalkane 1,4-dicarboxylate 5-32%; Yeast polypeptides 5-15%; Hippophae Rhamnoides kernel extract 3-20%; Nannocholoropsis Oculata extract 5-15%.

[0035] The anti-aging and soothing composition is further made of the following raw material components according to weight percentage:

[0036] 1,3-Butanediol 40-45%; 1,3-Propanediol 25-30%; 1,2-Pentanediol 5-10%; Bis-diethoxydiglycol cycloalkane 1,4-dicarboxylate 5-10%; Yeast polypeptides 6-12%; Hippophae Rhamnoides kernel extract 3-10%; Nannocholoropsis Oculata extract 5-12%.

[0037] The anti-aging and soothing composition is further made of the following raw material components according to weight percentage:

[0038] 1,3-Butanediol 10-60%; 1,2-hexanediol 5-20%; bis-diethoxydiglycol cycloalkane 1,4-dicarboxylate 5-32%; 1,2-pentanediol 5-25%; Hippophae Rhamnoides kernel extract 3-20%; Nannocholoropsis Oculata extract 5-15%.

[0039] The anti-aging and soothing composition is further made of the following raw material components according to weight percentage:

[0040] 1,3-Butanediol 50-60%; 1,2-hexanediol 5-10%; bis-diethoxydiglycol cycloalkane 1,4-dicarboxylate 5-10%; 1,2-pentanediol 5-10%; Hippophae Rhamnoides kernel extract 3-10%; Nannocholoropsis Oculata extract 5-12%.

[0041] The anti-aging and soothing composition is further made of the following raw material components according to weight percentage:

[0042] 1,2-Hexanediol 5-30%; 1,3-Propanediol 10-60%; Bis-diethoxydiglycol cycloalkane 1,4-dicarboxylate 5-32%; 1,2-pentanediol 5-35%; Yeast polypeptides 5-15%; Hippophae rhamnoides kernel extract 3-20%.

[0043] The anti-aging and soothing composition is further made of the following raw material components according to weight percentage:

[0044] 1,2-Hexanediol 5-10%; 1,3-Propanediol 25-60%; Bis-diethoxydiglycol cycloalkane 1,4-dicarboxylate 5-10%; 1,2-pentanediol 5-10%; Yeast polypeptides 6-12%; Hippophae rhamnoides kernel extract 3-10%.

[0045] The anti-aging and soothing composition is further made of the following raw material components according to weight percentage:

[0046] 1,3-Butanediol 5-70%; 1,2-Hexanediol 5-30%; Tetrahydropiperine 1-10%; 1,2-Pentanediol 5-25%; Yeast polypeptides 5-15%; Nannocholoropsis Oculata extract 5-15%.

[0047] The anti-aging and soothing composition is further made of the following raw material components according to weight percentage:

[0048] 1,3-Butanediol 50-70%; 1,2-Hexanediol 5-10%; Tetrahydropiperine 1-5%; 1,2-Pentanediol 5-15%; Yeast polypeptides 6-12%; Nannochloropsis oculata extract 5-12%.

[0049] To achieve the above second purpose, the present invention provides the following technical solutions:

[0050] An application of an anti-aging soothing composition, wherein the anti-aging soothing composition is added to a skin care product, wherein the amount of the anti-aging soothing composition added is 1-10% by weight of the skin care product; the skin care product includes toner, essence, lotion, cream, etc.

[0051] Furthermore, the skin care product is an anti-aging soothing cream, and its components are:

[0052] Anti-aging soothing composition 1-10%, thickener 0.1-1%, chelating agent 0.01-0.5%, preservative 0.1-1.5%, emulsifier 1-5%, emollient 1-20%, balance water;

[0053] The thickener is selected from one or more of carbomer, xanthan gum, acrylic acid (ester) / C10-30 alkyl acrylate cross-linked polymer, sodium polyacrylate grafted starch, ammonium acryloyldimethyl taurate / behenyl alcohol polyether-25 methacrylate cross-linked polymer, and ammonium acryloyldimethyl taurate / VP copolymer;

[0054] The chelating agent is selected from one or two of EDTA-2Na and EDTA-4Na;

[0055] The preservative is selected from two or more of sodium benzoate, phenoxyethanol, ethylhexylglycerin, and p-hydroxyacetophenone;

[0056] The emulsifier is selected from two or more of glyceryl stearate, PEG-100 stearate, cetearyl glucoside, cetearyl alcohol, C14-22 alcohol, coconut glucoside, C12-20 alkyl glucoside, and tri(laureth-4) phosphate;

[0057] The emollient is selected from two or more of squalane, triethylhexanoin, jojoba oil, shea butter, hydrogenated polyisobutene, dicaprylyl carbonate, and polydimethylsiloxane.

[0058] The preparation method of the anti-aging soothing facial cream comprises the following steps:

[0059] 1) Add water to an emulsifying pot, add thickener, chelating agent, and preservative, and heat to 75°C-80°C while stirring to dissolve and mix evenly, which is called phase A and is set aside;

[0060] 2) Add the oil and emulsifier into the oil pan, raise the temperature to 75-80°C while stirring, dissolve and mix evenly, this is called phase B, and set aside;

[0061] 3) Pump phase B into phase A for emulsification, homogenize for 5 minutes, keep warm and stir for 20 minutes, and then start cooling;

[0062] 4) When the temperature reaches 40-45°C, add the anti-aging soothing composition, stir for 10 minutes until the material is uniform, and discharge the material after passing the test.

[0063] Furthermore, the skin care product is an anti-aging soothing essence, and its components are:

[0064] 1-10% anti-aging soothing composition, 0.1-1% thickener, 0.01-0.5% chelating agent, 0.1-1.5% preservative, 0.1-1% pH adjuster, and the balance water;

[0065] The thickener is selected from one or more of carbomer, xanthan gum, acrylic acid (ester) / C10-30 alkyl acrylate cross-linked polymer, sodium polyacrylate grafted starch, ammonium acryloyldimethyl taurate / behenyl alcohol polyether-25 methacrylate cross-linked polymer, and ammonium acryloyldimethyl taurate / VP copolymer;

[0066] The chelating agent is selected from one or two of EDTA-2Na and EDTA-4Na;

[0067] The preservative is selected from two or more of sodium benzoate, phenoxyethanol, ethylhexylglycerin, and p-hydroxyacetophenone;

[0068] The pH regulator is selected from one or two of citric acid, sodium citrate, arginine and triethanolamine.

[0069] The preparation method of the anti-aging soothing essence comprises the following steps:

[0070] 1) Add water to the main pot, add thickener, chelating agent, preservative, stir and heat to 75℃-80℃ to dissolve and mix evenly, set aside;

[0071] 2) Cool down to 40-45°C, add pH adjuster and anti-aging soothing composition, stir for 30 minutes until the material is uniform, then add phase C, stir for 10 minutes until uniform, and discharge after passing the test.

[0072] In summary, the anti-aging and soothing composition of the present invention and its application have the following beneficial effects:

[0073] 1) The present invention provides a new, unreported active ingredient A that can finely regulate the content of miR-365b-5p, miR-641, and miR-3614-5p to achieve anti-aging and soothing effects;

[0074] 2) The present invention uses active ingredient A, solvent and transdermal absorption enhancer in combination, so that active ingredient A can penetrate the skin, and can finely regulate the content of miR-365b-5p, miR-641, and miR-3614-5p, thereby regulating the synthesis of inflammatory factors, collagen and other products, and achieving anti-aging and soothing effects;

[0075] 3) At room temperature, the anti-aging soothing composition is obtained by stirring and mixing evenly, which is easy to operate and can be used for cold preparation, saving energy consumption and being conducive to improving production efficiency;

[0076] 4) Adding the anti-aging and soothing composition to skin care products is beneficial to improving the anti-aging and soothing effects of the skin care products. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Figure 1 Shown are comparison pictures of forehead lines of randomly selected subjects before using the product and after using Application Example 1 for 28 days;

[0078] Figure 2 Shown are comparison pictures of forehead lines of randomly selected subjects before using the product and 28 days after using Application Example 12;

[0079] Figure 3 The following are comparison pictures of under-eye wrinkles of randomly selected subjects before using the product and after using Application Example 1 for 28 days;

[0080] Figure 4 Shown is a comparison of the red area of ​​randomly selected subjects before using the product and 28 days after using Application Example 12. DETAILED DESCRIPTION

[0081] In order to better illustrate the content of the present invention, the present invention is described in detail below in conjunction with embodiments. However, these specific embodiments are only for better illustrating the content of the present invention, rather than limiting the content of the present invention.

[0082] The present invention discloses a composition for regulating the expression of miRNA to achieve skin anti-aging and soothing effects and its application. An anti-aging and soothing composition, according to weight percentage, is composed of: 50-90% solvent, 1-20% transdermal absorption enhancer, and 10-25% active ingredient A; or 50-90% solvent and 10-25% active ingredient A.

[0083] A composition comprising yeast peptides, Hippophae Rhamnoides kernel extract, and Nannochloropsis OCULATA extract regulates the content of miR-365b-5p, miR-641, and miR-3614-5p, thereby regulating the expression of genes such as ATP5F1E (ATP synthase), PTGS2 (cyclooxygenase), ITGA2 (integrin α2), COL1 (type I collagen), and IL-15, thereby achieving anti-aging and soothing effects.

[0084] The present invention also includes the use of a composition of yeast polypeptides, Hippophae rhamnoides kernel extracts and Nannochloropsis oculata extracts.

[0085] Among them, the efficacy description of the main raw materials is as follows:

[0086] ①Solvent

[0087] The solvent mainly dissolves and disperses other substances in the composition, and on the other hand, helps the transdermal absorption enhancer to play its role. Including: 1,3-butylene glycol (model: 1,3-Butylene Glycol (version number COS_BGC_2272), manufacturer: DAICEL CORPORATION), 1,3-propylene glycol (model: DAICEL CORPORATION, manufacturer: DuPont Taiwan Co., Ltd.), 1,2-hexanediol (model: BH-800, manufacturer: B AND B CO., LTD.)

[0088] ②Transdermal absorption enhancer

[0089] Penetration enhancers can act on the stratum corneum of the skin, reduce the resistance of the skin barrier, and make active substances more easily permeable and absorbed through the skin. In addition, penetration enhancers can also increase the water content of the stratum corneum of the skin, causing the cells in this layer to swell, and the active substances to form a reservoir in this layer, thereby maintaining a certain release and action time of the active substances, and promoting the permeation and absorption of water-soluble substances through aqueous channels. Including: 1,2-pentanediol (model: BP-800, manufacturer: B AND B CO., LTD.), tetrahydropiperine (model: COSMOPERINE CH, manufacturer: SAMI-SABINSA GROUP LIMITED), bis-diethoxydiglycol cycloalkane 1,4-dicarboxylate (model: Aqulio, manufacturer: Nippon Seika Co., Ltd.)

[0090] ③Active ingredient A

[0091] Active ingredient A has excellent anti-aging and soothing properties, and can accurately regulate the content of three miRNAs: miR-365b-5p, miR-641, and miR-3614-5p, thereby achieving the effects of wrinkle removal, soothing, and redness reduction, and improving skin condition.

[0092] The active ingredient A is selected from at least two or more of yeast polypeptides, Hippophae rhamnoides kernel extract, and Nannochloropsis oculata extract;

[0093] The preparation method of the yeast polypeptides comprises the following steps:

[0094] Step 1: placing the fermented saccharomyces cerevisiae suspension in a stirring pot, adding β-glucanase for stirring and enzymolysis;

[0095] Step 2: Heat the materials in the stirring pot to 90-100°C and stir to inactivate the enzyme for 30-60 minutes;

[0096] Step 3: Turn on the cooling device to 25-50°C, transfer the material into the centrifugal device, and collect the supernatant after centrifugation;

[0097] Step 4: Filter the material through 800 mesh to obtain yeast polypeptides.

[0098] The preparation method of the Hippophae rhamnoides kernel extract comprises the following steps:

[0099] Step 1: Material selection and cleaning: Select sea buckthorn seeds as raw materials, clean and pre-treat them into powder;

[0100] Step 2: Extraction: Add sea buckthorn seed powder into a stirring pot, then add 99% alcohol with a mass 9 times that of sea buckthorn seed powder into the stirring pot, stir for 10-30 minutes, then transfer the material into an ultrasonic equipment pot, ultrasonically treat for 5 minutes to 30 minutes, and the ultrasonic frequency is 22kHz to 26kHz to complete the extraction operation;

[0101] Step 3: impurity removal: transfer the material from the ultrasonic equipment pot to the stirring pot, add deionized water with a mass of 99% alcohol, stir and heat to 70°C-90°C, keep warm and stir for 30 minutes, then cool to 25-45°C, filter the material with 800 mesh, and obtain Hippophae rhamnoides kernel extract.

[0102] The preparation method of the Nannochloropsis oculata extract comprises the following steps:

[0103] Step 1: Material selection and cleaning: Select Nannochloropsis oculata as raw material, clean it, and pre-treat it into powder;

[0104] Step 2: Extraction: add deionized water into a stirring pot, heat it to 70°C-90°C while stirring, keep it warm for 20min-40min, then cool it to 25°C-50°C, add the eye-shaped veined Nannochloropsis oculata powder into the stirring pot, stir for 10-30min, then transfer the material into the pot of ultrasonic equipment, ultrasonically treat it for 5min-30min, the ultrasonic frequency is 18kHz-22kHz, filter the material with 800 mesh, and obtain the eye-shaped veined Nannochloropsis oculata (NANNOCHLOROPSIS OCULATA) extract.

[0105] The present invention is further described in detail below through specific preferred embodiments combined with effect test examples, but the present invention is not limited to the following embodiments.

[0106] Examples 1-8 and Comparative Examples 1-7

[0107] The anti-aging and soothing composition of the present invention provides the following examples and comparative examples, and the specific components are selected by weight as shown in Table 1 and Table 2, and the total amount of the components of the composition is 100%.

[0108] Table 1 Preparation Examples 1-8 of Anti-aging and Soothing Compositions (Weight Percentage %)

[0109]

[0110]

[0111] Table 2 Preparation of anti-aging and soothing compositions Comparative Examples 1-7 (weight percentage %)

[0112]

[0113] The preparation method of the composition described in Examples 1-8 and Comparative Examples 1-7 of the present invention comprises the following steps:

[0114] 1) Add active ingredient A to the solvent, and mix and stir until there is no insoluble matter;

[0115] 2) Adding a transdermal absorption enhancer (if any) to the mixture of step 1) and stirring evenly to obtain an anti-aging and soothing composition.

[0116] The operations of steps 1) and 2) are all carried out at room temperature.

[0117] The following are examples of the preparation of skin care products containing the anti-aging and soothing composition products of the present invention.

[0118] Application Examples 1-8 and Application Comparative Examples 1-7

[0119] Examples 1-8 and Comparative Examples 1-7 were applied to skin care creams, see Tables 3 and 4.

[0120] According to the weight percentage of each component of Examples 1-8 and Comparative Examples 1-7 in Tables 3 and 4 below, with the total weight being 100%, the facial creams of Application Examples 1-8 and Application Comparative Examples 1-7 were prepared according to the following method.

[0121] Table 3 Raw material composition of anti-aging soothing skin care cream formula of application examples 1-8

[0122]

[0123] Table 4 Raw material composition of skin care cream formula of comparative examples 1-7

[0124]

[0125]

[0126] The preparation methods of the facial creams of Application Examples 1-8 and Application Comparative Examples 1-7 are as follows:

[0127] 1) Add all components of phase A into an emulsifying pot, stir and mix evenly, heat to 75-80°C, and set aside;

[0128] 2) Add phase B into the oil phase pot, stir and heat to 75-80°C, mix and dissolve, stir evenly, and set aside;

[0129] 3) Add phase B to phase A, emulsify, homogenize for 5 minutes, keep warm and stir for 20 minutes, and cool down;

[0130] 4) When the temperature drops to 40-45°C, add phase C and continue stirring for 10 minutes;

[0131] 5) After passing the test, the material is discharged.

[0132] Application Examples 9-16 and Application Comparative Examples 8-14

[0133] Examples 1-8 and Comparative Examples 1-7 were applied to essences, see Tables 5 and 6; according to the weight percentage of each component of Examples 1-8 and Comparative Examples 1-7 in Tables 5 and 6 below, the total weight was 100%, and the essences of Application Examples 9-16 and Application Comparative Examples 8-14 were prepared according to the following method.

[0134] Table 5 Raw material composition of the anti-aging soothing skin care essence formula of application examples 9-16 (weight percentage %)

[0135]

[0136]

[0137] Table 6 Raw material composition of the anti-aging soothing skin care essence formula of comparative examples 8-14 (weight percentage %)

[0138]

[0139] The preparation methods of the essences of Application Examples 9-16 and Application Comparative Examples 8-14 are as follows:

[0140] 1) Add all components of phase A into an emulsifying pot, stir and mix evenly, heat to 75-80°C, and set aside;

[0141] 2) When the temperature drops to 40-45°C, add phase B and continue stirring for 30 minutes, then add phase C and stir for 10 minutes until the material is uniform;

[0142] 3) After passing the test, the material is discharged.

[0143] Efficacy test example

[0144] The anti-aging and soothing compositions of Examples 1-8 and Comparative Examples 1-7 shown in Table 1 and Table 2 were added to facial creams and essences (Tables 3 to 6) to conduct in vivo and in vitro performance testing experiments.

[0145] The specific evaluation tests are as follows:

[0146] Efficacy test example 1: transfection test

[0147] (Verify the effects / regulatory effects of three miRNAs on ATP5F1E (ATP synthase), PTGS2 (cyclooxygenase), and ITGA2 (integrin α2);

[0148] In order to verify the effects of miR-365b-5p, miR-641, and miR-3614-5p on the gene expression of ATP5F1E (ATP synthase), PTGS2 (cyclooxygenase), and ITGA2 (integrin α2), the synthesis of ATP5F1E (ATP synthase), ITGA2 (integrin α2) in normal fibroblasts and PTGS2 (cyclooxygenase) in normal keratinocytes after 72 hours of transfection with miR-365b-5p, miR-641, and miR-3614-5p was analyzed. The sequence numbers of the three miRNAs are as follows:

[0149] miR-365b-5p: CCACUUGGAUCUGAAGGCUGCCC;

[0150] miR-641:AAAGACAUAGGAUAGAGUCACCUC;

[0151] miR-3614-5p:AAAAGUAAUUGUGGUUUUUG.

[0152] The specific operations are as follows:

[0153] Fibroblasts and keratinocyte primary cell lines were cultured to observe the endogenous regulation of miR-365b-5p, miR-641, and miR-3614-5p expression. Fibroblasts were transfected with 20 nM miR-365b-5p-mimic and miR-3614-5p-mimic. After transfection, the cells were incubated at 37°C and collected after 48 and 72 hours for miRNA and protein analysis, with 3 parallel samples in each group. Keratinocytes were transfected with 20 nM miR-641-mimic. After transfection, the cells were incubated at 37°C and collected after 48 and 72 hours for miRNA and protein analysis, with 3 parallel samples in each group.

[0154] The effects of the three miRNAs on the expression of anti-aging and soothing related proteins are shown in Table 7.

[0155] Table 7 Effects of three miRNA transfections on the expression of anti-aging and soothing related genes

[0156]

[0157] From the results in Table 7, it can be concluded that when miR-365b-5p, miR-641, and miR-3614-5p were transfected into cells respectively, they had an inhibitory effect on the relative expression levels of the three genes ATP5F1E (ATP synthase), PTGS2 (cyclooxygenase), and ITGA2 (integrin α2). In other words, miR-365b-5p, miR-641, and miR-3614-5p have a regulatory effect on the expression of genes such as ATP5F1E, PTGS2, and ITGA2, thereby affecting physiological activities such as skin aging and inflammation.

[0158] Efficacy test example 2: Effects on the expression of functional genes related to HaCaT cells and fibroblasts

[0159] Using in vitro cultured human immortalized skin keratinocytes HaCat and cellulose primary cell lines as models, the expression changes of inflammation- and protein-related genes at the gene level after treatment with the anti-aging and soothing composition were tested, and the effect of the composition treatment on the expression of basement membrane-related functional genes in HaCaT cells was detected by qRT-PCR.

[0160] qRT-PCR method, the test method is as follows:

[0161] The first step is mRNA extraction and reverse transcription:

[0162] (1) 1.5×105 cells per well were plated in a 6-well plate, and 0.1% of the anti-aging and soothing composition of Example 1 was added and cultured for 24 hours;

[0163] (2) Wash once with PBS, add 1 mL of Trizol and transfer to a 1.5 mL centrifuge tube or place at -80°C for later use;

[0164] (3) Centrifuge at 12,000 rpm for 5 min at 4°C, discard the precipitate, and transfer the supernatant to another clean centrifuge tube;

[0165] (4) Add a certain amount of chloroform according to the ratio of 200 μL chloroform / 1 ml Trizol, shake and mix, and leave at room temperature for 15 min;

[0166] (5) Centrifuge at 12,000 rpm for 15 min at 4°C. Aspirate the upper layer of liquid into another clean centrifuge tube. Be careful not to touch the middle interface. If you accidentally touch it, centrifuge again and aspirate the upper layer of liquid.

[0167] (6) Add a certain amount of isopropanol in the ratio of 500 μL isopropanol / 1 mL Trizol, mix well and leave at room temperature for 10 min;

[0168] (7) Centrifuge at 12,000 rpm for 10 min at 4°C, aspirate and discard the supernatant to allow the RNA to precipitate at the bottom of the tube;

[0169] (8) Add a certain amount of 75% ethanol in the ratio of 1 ml 75% ethanol / 1 mL Trizol and mix gently;

[0170] (9) Centrifuge at 7500 rpm for 5 min at 4°C, aspirate and discard the supernatant, and let stand for 5 to 10 min to dry the RNA, but avoid under-drying or over-drying.

[0171] (10) Dissolve the precipitate with high-pressure DEPC water, gently pipette until completely dissolved, and place on ice or store in a -80°C refrigerator for later use;

[0172] (11) Detect OD260 / 280 value using a spectrophotometer to quantify RNA concentration.

[0173] Use a reverse transcription kit to reverse transcribe RNA into cDNA. The steps are as follows:

[0174] ① Removal of genomic DNA

[0175] Using reverse transcription (TaqMan MicroRNA Reverse Transcription Kit) kit, prepare the reaction mixture on ice according to the following ingredients. In order to ensure the accuracy of the reaction mixture preparation, when performing each reaction, the TaqMan Fast Advanced Master Mix was then dispensed into each reaction tube, and finally the RNA sample was added. The reaction system is shown in Table 8.

[0176] Table 8 Reaction system for removing genomic DNA

[0177]

[0178] ②Reverse transcription reaction

[0179] Prepare the reaction solution on ice. To ensure the accuracy of the reaction solution, prepare TaqMan® according to the amount of reaction number + 2 for each reaction. Fast Advanced Master Mix, and then dispense 10 μL into each reaction tube and mix gently. The reaction system is shown in Table 9.

[0180] Table 9 Reverse transcription reaction system

[0181]

[0182] ③ Real-time fluorescence quantitative PCR (qRT-PCR)

[0183] Prepare 20 μL of real-time fluorescence quantitative PCR reaction system as shown in Table 10.

[0184] Table 10 Real-time fluorescence quantitative PCR reaction system

[0185]

[0186] Three replicate wells were set for each sample, and the GAPDH gene was used as the internal reference to obtain the threshold cycle number (Ct) of GAPDH and the target gene. The relative expression level of the target gene was calculated using the detected Ct value: 2-ΔΔCT(target gene)-Ct(GAPDH)].

[0187] Table 11 In vitro test results of Examples 1-8 and Comparative Examples 1-7

[0188]

[0189]

[0190] From Table 11 above, it can be seen that ① the anti-aging and soothing composition of Examples 1-8 has a regulatory effect on the expression of three miRNAs: miR-365b-5p, miR-641, and miR-3614-5p.

[0191] Specifically, the anti-aging and soothing compositions of Examples 1-8 can reduce the expression of miR-365b-5p and increase the expression of miR-641 and miR-3614-5p; compared with Comparative Examples 1-7 in which yeast polypeptides, Hippophae Rhamnoides kernel extract, and Nannochloropsis OCULATA are used alone or in combination in proportions not within the scope specified by the present invention, the regulatory effects on the three miRNAs are not obvious.

[0192] After the components of Examples 1-8 are compounded, they have a regulatory effect on three miRNAs: miR-365b-5p, miR-641, and miR-3614-5p.

[0193] ② The anti-aging and soothing composition of Examples 1-8 reduces the expression of PTGS2 and IL-17 by regulating the expression of three miRNAs; and increases the expression levels of ATP5F1E, ITGA2, and COL1 genes. It can be seen that by regulating the expression of miRNA, a significant inhibitory or promoting effect is achieved on the expression of genes related to aging and inflammation, such as inflammatory factors and collagen.

[0194] It can be seen that the formula components of Examples 1-8 have a significant regulatory effect on the expression of genes related to anti-aging and soothing.

[0195] Effect Test Example 3: Human Efficacy Test of Anti-aging and Soothing Composition

[0196] In order to prove the effect and performance of the product of the present invention, product tests were conducted on application examples 1 (cream), 12 (essence) and application comparative examples 4 (cream) and 14 (essence). In particular, a left and right face comparison and blind test method were adopted, with 32 people in each group, and application example 1 and application comparative example 4 were blindly compared; application example 12 and application comparative example 14 were blindly compared.

[0197] Test purpose: To evaluate the efficacy of the test sample in anti-aging and soothing through continuous use of the test sample by adult female volunteers under normal conditions;

[0198] Volunteer age: 40-60 years old;

[0199] Gender: Female;

[0200] Number of volunteers: 64, divided into two groups, 32 people in each group;

[0201] Volunteer's facial skin condition: The facial skin is relatively dry and rough, the facial skin is relatively loose, there are fine lines under the eyes, fine lines or wrinkles at the corners of the eyes, obvious nasolabial folds, and fine lines or wrinkles on the forehead.

[0202] Product usage frequency: After cleansing and toning, take an appropriate amount of this product, apply it on the face and massage gently until absorbed. Use it twice a day, once in the morning and once in the evening for 28 days.

[0203] Evaluation method: The subjects were tested for facial gloss, skin firmness F4, wrinkle depth (forehead lines, nasolabial folds) and facial red area before using the test product (D0) and 28 days after using the test product (D28). The test results before and after product use were compared by statistical test methods to determine whether there were statistical differences.

[0204] Statistical methods: SPSS was used for statistical analysis. If the measured values ​​were normally distributed, the t-test method was used for statistical analysis; if the measured values ​​were non-normally distributed, the rank sum test method was used for statistical analysis. The statistical methods all used two-tailed tests, and the test level = 0.05.

[0205] The calculation formula is as follows:

[0206] Improvement rate of (skin firmness F4, wrinkle depth) after 28 days of using the product = (D0-D28) / D0×100%;

[0207] Improvement rate of glossiness after using the product for 28 days = -(D0-D28) / D0×100%;

[0208] The improvement rate (red area) after using the product for 28 days = (D0-D28) / D0×100%.

[0209] Among them, D0 represents the basic value of skin parameters of the test area before using the product, and D28 represents the value of skin parameters of the test area after using the product for 28 days.

[0210] Test results:

[0211] Table 12 Skin gloss index description

[0212]

[0213] Table 13 Skin gloss analysis results

[0214]

[0215] 1) Statistical methods: t-test or rank-sum test was used for analysis, with the test level α=0.05.

[0216] 2) Significance marking method: “ns” indicates no statistical difference, p≥0.05; p<0.05 indicates a significant difference (“*” indicates 0.01≤p<0.05; “**” indicates 0.001≤p<0.01; “***” indicates p<0.001).

[0217] 3) Number of people using the product = 32 / group.

[0218] Table 14 Skin firmness F4 index description table

[0219]

[0220] Table 15 Skin firmness F4 (mm*s) analysis results

[0221]

[0222]

[0223] 1) Statistical method: The rank sum test method was used for analysis, and the test level a=0.05.

[0224] 2) Significance marking method: "ns" indicates no statistical difference, p>0.05; p<0.05 indicates a significant difference ("*" indicates 0.01≤p<0.05; "**" indicates 0.001≤p<0.01; "***" indicates p<0.001).

[0225] 3) Number of people using the product = 32 / group.

[0226] Table 16 Forehead wrinkle depth index table

[0227]

[0228] Table 17 Analysis results of forehead wrinkle depth (μm)

[0229]

[0230]

[0231] 1) Statistical method: The t-test method was used for analysis, with a test level of a = 0.05.

[0232] Significance marking method: "ns" indicates no statistical difference, p≥0.05; p<0.05 indicates a significant difference (" " indicates 0.01≤p<0.05; "**" indicates 0.001≤p<0.01; "***" indicates p<0.001).

[0233] 2) Number of people using the product = 32 / group.

[0234] Table 18 Facial skin red area index table

[0235]

[0236] Table 19 Facial skin red area analysis results

[0237]

[0238] in Figures 1 to 4 The facial / forehead skin wrinkle images and red area of ​​4 randomly selected subjects (selected from Application Example 1 and Application Example 12) are shown. It can be seen from the figure that after using the anti-aging soothing cream, the subjects' forehead wrinkles and facial redness were significantly improved.

[0239] As can be seen from Tables 13, 15, 17 and 19, after continuous use of the products of test application examples 1 and 12 for 28 days (left face), the glossiness of the subjects decreased significantly compared with the baseline value after 28 days of product use (p<0.001), and the improvement rates were 40.74% and 22.65%, respectively; the skin firmness F4 of the subjects decreased significantly compared with the baseline value after 28 days of product use (p<0.001), and the improvement rates were 38.91% and 38.84%, respectively; the depth of forehead wrinkles of the subjects decreased significantly compared with the baseline value after 28 days of product use (p<0.001), and the improvement rates were 31.83% and 27.24%, and the skin red area of ​​the subjects decreased significantly compared with the baseline value after 28 days of product use (p<0.001), and the improvement rates were 35.98% and 34.40%.

[0240] As for application examples 4 and 14, the subjects used them continuously for 28 days (right face). Except for the glossiness of the subjects of application example 4, which was significantly different from the baseline value after 28 days of use, with an improvement rate of 7.43%, compared with the glossiness improvement rate of 40.74% of the subjects in application example 1, application example 1 was significantly better; there were no significant differences in other skin indicators (skin firmness F4, forehead wrinkle depth, skin red area and glossiness of application example 14) between application examples 4 and 14, that is, the application examples did not have the corresponding anti-aging and soothing effects.

[0241] Therefore, combining the test results of Tables 13, 15, 17 and 19, it can be obtained that the anti-aging and soothing composition of the present invention is used in skin care products, which can effectively fight wrinkles and soothe the skin, thereby achieving the effect of improving skin wrinkles and redness.

[0242] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Therefore, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. An anti-aging soothing composition, characterized in that: According to weight percentage, the anti-aging and soothing composition is composed of: 50-90% solvent, 1-20% transdermal absorption enhancer, and 10-25% active ingredient A; Or, composed of 50-90% solvent and 10-25% active ingredient A; The active ingredient A is selected from at least two or more of yeast polypeptides, seabuckthorn kernel extract, and Nannochloropsis oculi extract; The solvent is selected from at least two or more of 1,3-propylene glycol, 1,3-butylene glycol, and 1,2-hexanediol; The transdermal absorption enhancer is selected from one or more of bis-diethoxydiglycol cycloalkane 1,4-dicarboxylate, 1,2-pentanediol and tetrahydropiperine.

2. The anti-aging soothing composition according to claim 1, characterized in that: The preparation method of the yeast polypeptides comprises the following steps according to weight percentage: Step 1: placing the fermented saccharomyces cerevisiae suspension in a stirring pot, adding β-glucanase for stirring and enzymolysis; Step 2: Heat the materials in the stirring pot to 90-100°C and stir to inactivate the enzyme for 30-60 minutes; Step 3: Turn on the cooling device to 25-50°C, transfer the material into the centrifugal device, and collect the supernatant after centrifugation; Step 4: Filter the material through 800 mesh to obtain yeast polypeptides; The preparation method of the seabuckthorn kernel extract comprises the following steps: Step 1: Material selection and cleaning: Select sea buckthorn seeds as raw materials, clean and pre-treat them into powder; Step 2: Extraction: Add sea buckthorn seed powder into a stirring pot, then add 99% alcohol with a mass 9 times that of sea buckthorn seed powder into the stirring pot, stir for 10-30 minutes, then transfer the material into an ultrasonic equipment pot, ultrasonically treat for 5 minutes to 30 minutes, and the ultrasonic frequency is 22kHz to 26kHz to complete the extraction operation; Step 3: Impurity removal: transfer the material from the ultrasonic equipment pot to the stirring pot, add deionized water with a mass of 99% alcohol, stir and heat to 70℃-90℃, keep warm and stir for 30 minutes, then cool to 25-45℃, filter the material with 800 mesh, and obtain sea buckthorn kernel extract; The preparation method of the Nannochloropsis oculata extract comprises the following steps: Step 1: Material selection and cleaning: Select Nannochloropsis oculata as raw material, clean it, and pre-treat it into powder; Step 2: Extraction: Add deionized water into a stirring pot, heat it to 70-90°C while stirring, keep it warm for 20-40 minutes, then cool it to 25-50°C, add the eye-shaped veined Nannochloropsis algae powder into the stirring pot, stir for 10-30 minutes, then transfer the material into the pot of an ultrasonic device, perform ultrasonic treatment for 5-30 minutes, the ultrasonic frequency is 18kHz-22kHz, filter the material through 800 mesh, and obtain the eye-shaped veined Nannochloropsis algae extract.

3. The anti-aging and soothing composition according to claim 1, characterized in that: According to weight percentage, the anti-aging and soothing composition is composed of: 55-85% solvent, 1-18% transdermal absorption enhancer, and 10-20% active ingredient A.

4. The anti-aging and soothing composition according to claim 1, characterized in that: According to weight percentage, the anti-aging and soothing composition is composed of: 58-75% solvent, 8-15% transdermal absorption enhancer, and 11-20% active ingredient A.

5. The method for preparing the anti-aging and soothing composition according to claim 1, characterized in that: The specific process steps of the preparation method of the anti-aging soothing composition are: 1) At room temperature, add active ingredient A to the solvent, and mix and stir until there is no insoluble matter; 2) adding a transdermal absorption enhancer to the mixture of step 1), stirring evenly at room temperature to obtain an anti-aging and soothing composition.

6. The anti-aging and soothing composition according to claim 1, characterized in that: The anti-aging and soothing composition is made of the following raw material components according to weight percentage: 1,3-Butanediol 10-50%; 1,3-Propanediol 5-30%; 1,2-Pentanediol 5-10%; Bis-diethoxydiglycol cycloalkane 1,4-dicarboxylate 5-32%; Yeast polypeptides 5-15%; Seabuckthorn kernel extract 3-20%; Nannochloropsis oculata extract 5-15%; Or 1,3-butanediol 10-60%; 1,2-hexanediol 5-20%; bis-diethoxydiglycol cycloalkane 1,4-dicarboxylate 5-32%; 1,2-pentanediol 5-25%; sea buckthorn kernel extract 3-20%; eye-shaped vein microcystis extract 5-15%; Or 1,2-hexanediol 5-30%; 1,3-propylene glycol 10-60%; bis-diethoxydiglycol cycloalkane 1,4-dicarboxylate 5-32%; 1,2-pentanediol 5-35%; yeast polypeptides 5-15%; sea buckthorn kernel extract 3-20%; Or 1,3-butanediol 5-70%; 1,2-hexanediol 5-30%; tetrahydropiperine 1-10%; 1,2-pentanediol 5-25%; yeast polypeptides 5-15%; Nannochloropsis oculata extract 5-15%.

7. Use of the anti-aging and soothing composition according to any one of claims 1 to 6 in the preparation of skin care products, characterized in that: The anti-aging and soothing composition is added in an amount of 1-10% by weight of skin care products; the skin care products include toners, essences, lotions, creams, etc.

8. Use of the anti-aging and soothing composition according to claim 7 in the preparation of skin care products, characterized in that: The skin care product is an anti-aging soothing cream, and its components are: Anti-aging soothing composition 1-10%, thickener 0.1-1%, chelating agent 0.01-0.5%, preservative 0.1-1.5%, emulsifier 1-5%, emollient 1-20%, balance water; The thickener is selected from one or more of carbomer, xanthan gum, acrylic acid (ester) / C10-30 alkyl acrylate cross-linked polymer, sodium polyacrylate grafted starch, ammonium acryloyldimethyl taurate / behenyl alcohol polyether-25 methacrylate cross-linked polymer, and ammonium acryloyldimethyl taurate / VP copolymer; The chelating agent is selected from one or both of EDTA-2Na and EDTA-4Na; The preservative is selected from two or more of sodium benzoate, phenoxyethanol, ethylhexylglycerin, and p-hydroxyacetophenone; The emulsifier is selected from two or more of glyceryl stearate, PEG-100 stearate, cetearyl glucoside, cetearyl alcohol, C14-22 alcohol, coconut glucoside, C12-20 alkyl glucoside, and tri(laureth-4) phosphate; The emollient is selected from two or more of squalane, triethylhexanoin, jojoba oil, shea butter, hydrogenated polyisobutene, dicaprylyl carbonate, and polydimethylsiloxane.

9. Use of the anti-aging and soothing composition according to claim 8 in the preparation of skin care products, characterized in that: The preparation method of the anti-aging soothing facial cream comprises the following steps: 1) Add water to an emulsifying pot, add thickener, chelating agent, and preservative, and heat to 75°C-80°C while stirring to dissolve and mix evenly, which is called phase A and is set aside; 2) Add the oil and emulsifier into the oil pan, raise the temperature to 75-80°C while stirring, dissolve and mix evenly, this is called phase B, and set aside; 3) Pump phase B into phase A for emulsification, homogenize for 5 minutes, keep warm and stir for 20 minutes, and then start cooling; 4) When the temperature drops to 40-45°C, add the anti-aging soothing composition, stir for 10 minutes until the material is uniform, and discharge the material after passing the test.

10. Use of the anti-aging and soothing composition according to claim 8 in the preparation of skin care products, characterized in that: The skin care product is an anti-aging soothing essence, and its components are: 1-10% anti-aging soothing composition, 0.1-1% thickener, 0.01-0.5% chelating agent, 0.1-1.5% preservative, 0.1-1% pH adjuster, and the balance water; The thickener is selected from one or more of carbomer, xanthan gum, acrylic acid (ester) / C10-30 alkyl acrylate cross-linked polymer, sodium polyacrylate grafted starch, ammonium acryloyldimethyl taurate / behenyl alcohol polyether-25 methacrylate cross-linked polymer, and ammonium acryloyldimethyl taurate / VP copolymer; The chelating agent is selected from one or both of EDTA-2Na and EDTA-4Na; The preservative is selected from two or more of sodium benzoate, phenoxyethanol, ethylhexylglycerin, and p-hydroxyacetophenone; The pH regulator is selected from one or two of citric acid, sodium citrate, arginine and triethanolamine; The preparation method of the anti-aging soothing essence comprises the following steps: 1) Add water to the main pot, add thickener, chelating agent, preservative, stir and heat to 75℃-80℃ to dissolve and mix evenly, set aside; 2) Cool down to 40-45°C, add pH adjuster and anti-aging soothing composition, stir for 30 minutes until the material is uniform, then add phase C, stir for 10 minutes until uniform, and discharge after passing the test.

Images