Human papilloma virus 16 mutant E2 protein and application thereof

Abstract

The invention provides a human papilloma virus 16 mutant E2 protein and application thereof. The mutant E2 protein is obtained by performing the following three mutation modes on the basis of a wild HPV16 E2 protein: (1) mutating serine at the 317th site of the wild HPV16 E2 protein into proline; (2) the 17th-site threonine of the wild type HPV16 type E2 protein is mutated into arginine, and the 55th-site asparagine of the wild type HPV16 type E2 protein is mutated into arginine; and (3) the 218th histidine of the wild type HPV 16 type E2 protein is mutated into proline. The target protein is obtained through amino acid mutation, codon optimization, expression and purification, the protein structure is more stable and more beneficial to expression, so that the yield and preparation efficiency of the HPV16 type E2 protein are remarkably improved, and the antigen can be used for detecting an HPV16 type E2 antibody or evaluating the humoral immune efficacy of a therapeutic vaccine targeting HPV16 type E2.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and in particular to a human papillomavirus type 16 mutant E2 protein and an application thereof. Background Art

[0002] Human papillomavirus (HPV) is a small non-enveloped DNA virus that contains a double-stranded DNA genome. High-risk HPV types include 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 and 68, with 16 and 18 being the two most common high-risk genotypes. Studies have shown that globally, types 16 and 18 can be detected in approximately 70% of cervical cancer patients.

[0003] The HPV genome encodes eight open reading frames (ORFs). According to different functions, the genome can be divided into three regions, namely the early protein coding region (ER), which mainly encodes proteins E1, E2, E4, E5, E6, and E7; the late protein coding region (LR), which encodes proteins L1 and L2; and the long terminal control region (LCR). Among them, E6 and E7 are considered to be the most important pathogenic genes of HPV. When HPV infects the host, the viral oncoprotein E6 binds to the body's P53 (a tumor suppressor gene) and causes P53 to lose its normal function, causing the host cell to initiate DNA repair, cell apoptosis or growth arrest, and ultimately leading to abnormal cell development. Therefore, the E6 protein can be selected as the target antigen for HPV-related tumor therapeutic vaccines. The E2 protein plays a vital role in the occurrence and development of HPV infection and related tumors by virtue of its ability to regulate viral transcription, induction effect on immune response, enhancement of antibody-dependent cell-mediated cytotoxicity (ADCC), and display of cross-reactivity. In the early stages of viral infection and precancerous lesions, the expression of E2 protein is more significant than that of E6 and E7 proteins. In addition, the development process of tumor tissue shows significant heterogeneity in different internal regions. Vaccines designed for E2 protein are expected to more effectively eliminate early infected cells and early precancerous lesion cells, and produce synergistic effects with E6 and E7 proteins, which may greatly improve the treatment effect, broaden the scope of clinical application, and benefit more patients.

[0004] At present, several therapeutic vaccines targeting HPV16 / 18-related precancerous lesions or tumors have entered the clinical trial stage at home and abroad, but most of them target E6 and E7 proteins, such as BioNTech's mRNA vaccine BNT113 and NykodeTherapeutics ASA's DNA vaccine VB10.1. In view of the important role of E2 protein in carcinogenesis, it is of great application value to prepare HPV16 E2 protein and establish a method for detecting the humoral immune efficacy of therapeutic vaccines targeting HPV16 E2. Summary of the invention

[0005] The purpose of the present invention is to provide a human papillomavirus type 16 mutant E2 protein and its application, screen out a human papillomavirus type 16 mutant E2 protein, and express the target protein by amino acid mutation (S317P, T17R and N55R and H218P) and codon optimization of HPV16 E2 protein using an Escherichia coli fermentation system, thereby improving the expression and stability of the target protein, thereby significantly improving the preparation efficiency of HPV16 E2 protein, and obtaining HPV16 E2 protein with high purity and natural activity. The method is simple to operate and low in cost. The HPV16 E2 protein prepared by the method can be used as a coating antigen, and an indirect ELISA method is established to evaluate the humoral immune efficacy of a targeted HPV16 E2 vaccine.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] In a first aspect of the present invention, a human papillomavirus type 16 mutant E2 protein is provided, wherein the human papillomavirus type 16 mutant E2 protein is obtained by performing the following three mutations on the wild-type HPV E2 protein:

[0008] (1) S317P: The serine 317 at position E2 of wild-type HPV16 E2 protein is mutated to proline;

[0009] (2) T17R and N55R: The threonine 17 of the wild-type HPV16 E2 protein mutated to arginine, and the asparagine 55 mutated to arginine;

[0010] (3) H218P: The histidine 218th position of the wild-type HPV16 E2 protein is mutated to proline.

[0011] Furthermore, the amino acid sequence of the human papillomavirus type 16 mutant E2 protein is shown in SEQ ID NO.1.

[0012] In the second aspect of the present invention, a codon-optimized nucleic acid molecule encoding the human papillomavirus type 16 mutant E2 protein is provided.

[0013] Furthermore, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 2.

[0014] In the third aspect of the present invention, an expression vector of a human papillomavirus type 16 mutant E2 protein is provided, wherein the expression vector comprises the nucleic acid molecule.

[0015] Furthermore, the expression vector can express the nucleic acid in a prokaryotic or eukaryotic host cell. The vector can be a conventional vector, specifically a plasmid vector, a phage vector, or a viral vector.

[0016] In the fourth aspect of the present invention, a method for preparing a human papillomavirus type 16 mutant E2 protein expression vector is provided, wherein the nucleic acid molecule is constructed into a prokaryotic expression vector or a eukaryotic expression vector to obtain a human papillomavirus type 16 mutant E2 protein expression vector.

[0017] Furthermore, the method comprises:

[0018] Obtaining an expression vector for human papillomavirus type 16 mutant E2 protein;

[0019] Transforming the expression vector of the human papillomavirus type 16 mutant E2 protein into competent Escherichia coli cells to obtain expression engineered bacteria;

[0020] The expression engineering bacteria are induced to express and purified to obtain the human papillomavirus type 16 mutant E2 protein.

[0021] In the fifth aspect of the present invention, a recombinant bacterium or an engineered cell line comprising the expression vector is provided.

[0022] In the sixth aspect of the present invention, a method for preparing the human papillomavirus type 16 mutant E2 protein is provided, the method comprising: performing prokaryotic or eukaryotic expression and purification on the recombinant bacteria or engineered cell line to obtain the human papillomavirus type 16 mutant E2 protein.

[0023] In the seventh aspect of the present invention, provided is the use of a mutant E2 protein of human papillomavirus type 16 or the nucleic acid molecule or the recombinant vector or the recombinant bacteria or the engineered cell line in the preparation of a product for detecting HPV16 E2 antibodies or a product for evaluating the humoral immune efficacy of a therapeutic vaccine targeting HPV16 E2.

[0024] In an eighth aspect of the present invention, an ELISA kit for detecting human papillomavirus type 16 E2 antibodies is provided, wherein the ELISA detection kit comprises: an ELISA enzyme labeling plate coated with the human papillomavirus type 16 mutant E2 protein.

[0025] Furthermore, the coating concentration of the human papillomavirus type 16 mutant E2 protein is 2-6 μg / mL (100 μL / well). Preferably, the coating concentration of the human papillomavirus type 16 mutant E2 protein is 4 μg / mL (100 μL / well).

[0026] Furthermore, the ELISA detection kit also includes:

[0027] Horseradish peroxidase-labeled secondary antibody;

[0028] Standard negative serum;

[0029] Standard positive serum;

[0030] Detection reagents: coating solution, coating washing solution, diluent, washing solution, blocking solution, antibody diluent, color developing solution and stop solution.

[0031] In the above technical scheme, the negative control serum comes from SPF mice, and the positive serum comes from SPF mice immunized with targeted human papillomavirus type 16 E2 vaccine; the enzyme-labeled secondary antibody is rabbit anti-mouse IgG labeled with horseradish peroxidase.

[0032] In a ninth aspect of the present invention, a method for using the ELISA detection kit using the human papillomavirus type 16 antibody is provided, the method comprising:

[0033] The human papillomavirus type 16 mutant E2 protein is diluted and added to an ELISA plate at 4° C. overnight, air-dried and then blocked with a blocking solution to obtain an ELISA plate coated with the human papillomavirus type 16 mutant E2 protein;

[0034] The serum to be tested, negative serum and positive serum are added as primary antibodies to the wells of the ELISA plate coated with the human papillomavirus type 16 mutant E2 protein for incubation; the liquid is discarded, then washed and dried, and then the enzyme-labeled secondary antibody labeled with horseradish peroxidase is added for incubation, washed and dried;

[0035] Add the color developing solution and incubate at room temperature in the dark, then add the stop solution to terminate the reaction, and measure the OD value at a wavelength of 450nm on an enzyme reader.

[0036] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0037] 1. The human papillomavirus type 16 mutant E2 protein of the present invention has a high expression level in the Escherichia coli expression system, good protein stability, and strong affinity, and can be used to detect human papillomavirus type 16 E2 antibodies.

[0038] 2. The ELISA detection kit for human papillomavirus type 16 E2 antibody provided by the present invention can be used for the detection of human papillomavirus type 16 E2 antibody, and can also be used to evaluate the humoral immune efficacy of therapeutic vaccines targeting HPV type 16 E2. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0040] Figure 1 This is the SDS-PAGE electrophoresis of the HPV16 E2 protein expressed in the E. coli expression system. DETAILED DESCRIPTION

[0041] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0042] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0043] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained by existing methods.

[0044] The embodiment of the present invention provides a human papillomavirus type 16 mutant E2 protein and its application, and the overall idea is as follows:

[0045] Based on the prediction and analysis of E2 protein structure by AlphaFold3 and DynaMut (DynaMut combines static (based on FoldX) and dynamic (based on ENCoM) analysis to predict the effects of mutations on protein structure and stability), and based on general protein structure design principles (introducing disulfide bonds, proline; building salt bridges; filling hydrophobic cavities, etc.), we designed the following mutation sites:

[0046] Table 1 Mutation site design

[0047]

[0048]

[0049] Replacing serine (S) at position 317 with proline (P) interacts with the charges of R302 and Y303 to form a spatially stable structure, while the mutations of T17R and N55R can form salt bridges with the surrounding K351 and K306, thereby strengthening the stability of the overall structure. In addition, the loop region is more flexible, and we designed the H218P mutation at the active position to strengthen the spatial repression to a certain extent. In general, these mutation designs can maintain the stability of the overall structure, thereby improving the efficiency of the protein expression and facilitating the binding with antibodies.

[0050] The sequence encoding the E2 protein was further optimized for the codon preference of Escherichia coli, and the nucleic acid sequence of E2 is shown in SEQ ID NO: 2; this sequence is inserted into a plasmid, and the soluble expression of the E2 protein can be achieved through the Escherichia coli expression system, and the expressed protein can be purified by metal affinity chromatography to obtain a recombinant protein with high purity and activity.

[0051] The following will describe in detail a human papillomavirus type 16 mutant E2 protein and its application in combination with examples and experimental data.

[0052] Example 1 Expression and purification of human papillomavirus type 16 mutant E2 protein

[0053] 1. Materials:

[0054] 1. Bacterial species

[0055] BL21 Escherichia coli

[0056] 2. Name of plasmid vector

[0057] pET-32m3c: purchased from Addgene, Catalog #196475.

[0058] 3. Protein purification column name

[0059] Ni Sepharose (10280275, Cytiva)

[0060] 4. Instruments:

[0061] Table 2

[0062]

[0063]

[0064] 5. Consumables:

[0065] Table 3

[0066] Reagents Part Number factory <![CDATA[T4 DNA ligase]]> 9015-85-4 Bao Biotechnology (Dalian) Co., Ltd. Restriction endonucleases NO.B600236 Shanghai Bioengineering Co., Ltd. PBS buffer powder (pH 7.3) ZLI-9061 Wuxi Aorui Dongyuan Biotechnology Co., Ltd. 1mL sterile insulin syringe 328421 BD Shu Rui 1.5mL nuclease-free centrifuge tube MCT-001-015 Lanjieke Technology Co., Ltd. ELISA plate 504201 Wuxi Nice Life Sciences Co., Ltd. Skim milk powder A600669-0250 Shanghai Bioengineering Co., Ltd. HRP-goat-anti-mouse IgG A0216 BioSky Biotech Co., Ltd. TMB display fluid P0209-500ml BioSky Biotech Co., Ltd. TMB color stop solution P0215-500ml BioSky Biotech Co., Ltd.

[0067] 2. Construction of vector

[0068] 1. Amino acid sequence optimization

[0069] The sequence of HPV16 E2 protein is derived from E2 protein [Human papillomavirus 16]. The protein sequence number on the protein database website UniProt is P03120, and the sequence number on the NCBI database is Gene ID: 1489080. Compared with the wild-type HPV16 E2 protein, we designed 4 amino acid mutations (S317P, T17R, N55R, H218P) and performed codon optimization to make the protein structure more stable and more conducive to expression and purification. The amino acid sequence is shown in SEQID NO.1.

[0070] Replacing serine (S) at position 317 with proline (P) interacts with the charges of R302 and Y303 to form a spatially stable structure, while the mutations of T17R and N55R can form salt bridges with the surrounding K351 and K306, thereby strengthening the stability of the overall structure. In addition, the loop region is more flexible, and we designed the H218P mutation at the active position to strengthen the spatial repression to a certain extent. In general, these mutation designs can maintain the stability of the overall structure, thereby improving the efficiency of the protein expression and facilitating the binding with antibodies.

[0071] 2. Recombinant plasmid construction

[0072] A gene synthesis company was commissioned to synthesize the target gene of the HPV16 E2 protein mutant that had been optimized for E. coli codon preference (nucleotide sequence as shown in SEQ ID NO.2), and the target gene DNA fragment was recombined into the BamH I and BglⅡ restriction sites of the pET-32m3c plasmid vector. The primer pair sequence is as follows:

[0073] Table 4 Primer sequences of HPV16 E2 protein mutants

[0074] Group Sequence (5'-3') Upstream primer CGGGATCCATGGAGACTTTGTGTCAAAGGTTAAAC(SEQ ID NO.3) Downstream primer GAAGATCTTATGGACATAAACCCAGTGGACAC(SEQ ID NO.4)

[0075] 3. Conversion

[0076] Add 1 μL of the above recombinant plasmid to 100 μL of BL21 competent cells; place on ice for 30 minutes, then heat shock in a 42°C water bath for 75 seconds, and immediately place on ice for 2 minutes. Then add 100 μL of LB medium without antibiotics, incubate in a 37°C incubator for 30 minutes, spread the bacterial solution on the plate, and invert it in a 37°C incubator overnight for 12 to 16 hours for transformation reaction.

[0077] 3. Protein Expression and Purification

[0078] 1. Escherichia coli amplification culture

[0079] Monoclonal strains were selected by plating, and a single BL21 colony transformed with the target plasmid was selected and cultured in 10 mL of LB medium containing ampicillin resistance for 7-8 hours under shaking, then transferred to a conical flask containing 1 L of LB medium and cultured at 37°C, 250 rpm, and the final concentration of ampicillin was 50 μg / mL.

[0080] 2. Fermentation to prepare target protein

[0081] Detect the OD value of the bacterial solution in the conical flask. When the concentration of the bacterial solution reaches 0.6-0.8, lower the shaking temperature to 16°C. After cooling for 20 minutes, add the inducer IPTG (Isopropylβ-D-Thiogalactoside) to a final concentration of 200μM. Induce protein expression at low temperature for 18-22 hours, usually 21 hours is the best. Collect the bacterial solution and centrifuge it. Centrifuge it at room temperature at 4000rpm for 15 minutes to obtain the precipitated bacteria. Discard the supernatant and resuspend the bacteria with binding buffer. Resuspend each liter of bacterial solution with 45mL binding buffer. After resuspension, it can be stored at -20°C for a long time or the bacteria can be lysed immediately.

[0082] 3. Bacterial lysis and protein purification

[0083] Collect the above-mentioned bacteria, shake repeatedly to resuspend the bacteria evenly, use a high-pressure homogenizer to break the cells at low temperature, and the breaking conditions are 4°C, 650-750bar, 3min. After the cells are completely broken, use a high-speed centrifuge at 18000rpm, 4°C for 30min, collect the supernatant, and then perform nickel column affinity chromatography to purify the protein. Load the new nickel column beads (Ni Sepharose) into a special 50mL glass column, rinse the nickel column twice with ddH2O, and balance the nickel column with 1 column volume of binding buffer for use.

[0084] The nickel column was emptied before use, and the supernatant collected after high-speed centrifugation was added to the nickel column to allow it to bind to the nickel beads for at least 30 minutes. During this period, it was stirred every 10 minutes to ensure that the protein was fully in contact with the nickel beads and that the supernatant fully flowed through the nickel column, and the supernatant was sampled; the nickel column was directly rinsed with 1 column volume of washing buffer to remove non-specifically bound proteins, and the flow-through was sampled; 15 mL of elution buffer was added to the nickel column, and it was allowed to contact with the nickel beads for 30 minutes, and the target protein was eluted and collected, and a sample was taken for subsequent identification.

[0085] 4. Dialysis

[0086] Place a dialysis bag (cellophane) of appropriate size and length in ddH2O and boil for 10 minutes; seal the bottom of the dialysis bag, make sure there is no leakage, pour in the target protein solution after nickel column purification and elution, seal the top, place in a 2L beaker filled with GBbuffer, and stir at 4 degrees for 24 hours; open the dialysis bag, pour out the target protein in the dialysis bag, filter through a 0.22μm filter membrane, remove the precipitated flocculent protein, and obtain the desired target protein. The purified protein sample is identified by SDS-PAGE electrophoresis and the protein purity is evaluated.

[0087] Table 5 Formulas of protein purification related buffers

[0088] Buffer Imidazole NaCl Tris EDTA DTT pH Binding Buffer 5mM 490mM 20mM \ \ 7.5 Washing Buffer 60mM 500mM 20mM \ \ 7.6 Elution Buffer 1M 500mM 20mM \ \ 7.8 GB Buffer \ 100mM 50mM 1mM 1mM 7.8

[0089] Next, the protein yield and purity were tested, as shown in Experimental Example 1 below.

[0090] Comparative Example 1: Expression and purification of natural E2 protein

[0091] The DNA of the natural E2 protein of this comparative example (sequence number in the NCBI database is Gene ID: 1489080) was commissioned to be synthesized by a bioengineering company, and its amino acid sequence is shown in SEQ ID NO.7, and its nucleic acid sequence is shown in SEQ ID NO.8. Then the DNA fragment was recombined into the BamH I and BglⅡ restriction sites of the pET-32m3c plasmid vector, specifically by PCR with the primer pair of FPrimer and RPrimer and then obtained by restriction enzyme ligation, and the primer pair sequence is as follows:

[0092] Table 6 Primer sequences of wild-type HPV16 E2

[0093] Group Sequence (5'-3') Upstream primer CGGGATCCATGGAAACCCTCTGTCAGCGATT(SEQ ID NO.5) Downstream primer CTCGAGGATCGACATGAAGCCCGTGGAAAC(SEQ ID NO.6)

[0094] Experimental Example 1: Protein yield and purity detection

[0095] 1. Protein Quantification

[0096] Gel chromatography was used to determine the protein yields of Example 1 and Comparative Example 1. The results of the determination of the concentrations of the two proteins (3 batches) are shown in Table 7.

[0097] Table 7 The yield of each batch of target protein fermented

[0098]

[0099] The protein quantification results showed that the yield of the natural E2 protein (amino acid sequence as shown in SEQ ID NO.3) of the three batches of comparative example 1 was 2.7±0.65 mg / L, while the yield of the mutant E2 protein (amino acid sequence as shown in SEQ ID NO.1) of Example 1 of the present invention was 5.9±1.0 mg / L, which was significantly higher than that of the natural protein (p<0.05, t test).

[0100] 2. Protein purity test

[0101] The purified protein samples in Example 1 and Comparative Example 1 were subjected to SDS-PAGE electrophoresis to identify the molecular weight and purity of the protein. The test results are as follows: Figure 1 As shown, the molecular weight of the three batches of E2 protein mutants was around 45KD, which was in line with expectations, and the protein concentration was significantly higher than that of the wild-type protein. The purity of the purified protein reached more than 90%, making it suitable as a coating protein for ELISA kits.

[0102] The above results show that the expression level of the mutant E2 protein in Example 1 is significantly higher than that of the wild-type E2 protein in Comparative Example 1, indicating that the human papillomavirus type 16 mutant E2 protein of the present invention has high stability in expression in Escherichia coli and is not easily degraded, and the codon optimization further increases the expression level.

[0103] Example 2: ELISA kit for detecting serum human papillomavirus type 16 E2 antibody and its preparation method

[0104] 1. Serum Human Papillomavirus Type 16 E2 Antibody ELISA Detection Kit

[0105] The ELISA detection kit comprises:

[0106] HPV16 type E2 protein prepared in Example 1: coating concentration is 2-8 μg / mL, 100 μL per well, preferably 4 μg / mL, 100 μL / well;

[0107] Horseradish peroxidase-labeled secondary antibody;

[0108] Standard negative serum;

[0109] Standard positive serum;

[0110] Detection reagents: coating solution, coating washing solution, diluent, washing solution, blocking solution, antibody diluent, color developing solution and stop solution.

[0111] It should be noted that the human papillomavirus type 16 mutant E2 protein provided by the present invention is used to prepare ELISA kits, and can also be used to prepare various forms of products such as immunocolloidal gold test strips, immunofluorescence, immunoturbidimetry, and chemiluminescence.

[0112] 2. Operation steps of serum human papillomavirus type 16 E2 antibody ELISA test kit

[0113] The purified HPV16 E2 protein was coated on the ELISA plate at the coating concentrations of 2μg / mL; 4μg / mL; 6μg / mL; 5% skim milk powder blocking solution, and then the vaccine-immunized mouse serum and horseradish peroxidase-coupled rabbit anti-mouse IgG antibody were added for detection. The target antigen of the vaccine is the HPV16 E2 protein. The optimal coating concentration was determined by titration with standard positive serum (see Table 9).

[0114] 1. Mouse immunization

[0115] Five female C57BL / 6J mice aged 6-8 weeks were selected as the experimental group. Each mouse was immunized with 10 μg of vaccine, and the injection volume was 50 μL / mouse. A 1mL disposable sterile insulin syringe was used to draw 50 μL of vaccine and injected into the posterior thigh muscle. The mice were vaccinated for a total of 2 doses, and the second booster immunization was performed 14 days after the first immunization. The negative control group was injected intramuscularly with sterile 1×PBS, and a total of 5 mice were injected with an injection volume of 50 μL / mouse.

[0116] 2. Mouse serum collection

[0117] The condition and body weight of the mice were observed after immunization. Blood was collected 14 days after the second immunization. After standing at room temperature for 3 hours, the whole blood of the mice was centrifuged at 3000 rpm for 15 minutes at room temperature. The upper serum was carefully aspirated with a pipette and transferred to a 1.5 mL sterile centrifuge tube. It was inactivated in a 56°C water bath for 30 minutes and set aside for use.

[0118] 3. ELISA test of antibody titer in serum

[0119] (1) ELISA plate coating: Take HPV16 E2 protein, dilute to 4 μg / mL, add 100 μL / well to the ELISA plate, and coat at 4°C overnight (16-20 hours). Discard the coating solution, add 300 μL of washing solution to each well, wash the plate 4 times, then add 200 μL / well of blocking solution, and block at room temperature in the dark for 2 hours.

[0120] (2) Serum dilution: Use diluent to dilute the serum in a gradient manner according to Table 4. Take 5 μL of negative serum, i.e., serum from mice injected with PBS, and mix them together to serve as negative mixed serum. Then, add 4995 μL of diluent to dilute 5 μL of negative mixed serum by 1000 times.

[0121] Table 8 Serum gradient dilution

[0122]

[0123]

[0124] (3) Sample addition and incubation: After blocking, add diluted test serum (S1-S8) and negative mixed serum, positive control serum, and blank control at 100 μL / well. All samples are duplicated and incubated at room temperature for 1 hour. Add 300 μL of washing solution to each well and wash the plate 4 times in succession. Let it stand for 1 minute each time and pat dry.

[0125] (4) Secondary antibody incubation: Dilute the secondary antibody HRP-goat-anti-mouse IgG 1000 times with diluent, mix well and add to the ELISA plate, 100 μL / well, incubate at room temperature for 1 hour. Add 300 μL of washing solution to each well, wash the plate 4 times, let it stand for 1 minute each time, and pat dry.

[0126] (5) Color development termination: Add 100 μL of TMB color development solution to each well and place it in the dark at room temperature for 8 to 15 min (the termination time is determined based on the color development). Then, directly add 50 μL of stop solution to each well to terminate the reaction.

[0127] (6) Reading: The absorbance at OD 450 nm was detected by a microplate reader. The average OD values ​​of the blank control and negative serum should be no higher than 0.1. The cut-off value was calculated based on the average OD value of the negative serum. When the average OD value of the negative serum was no higher than 0.05, it was calculated as 0.05. The results of the comparison of the HPV16 E2 protein coating concentration are shown in Table 9, and the reading results of different samples are shown in Table 10.

[0128] Table 9 Comparison of HPV16 E2 protein coating concentrations

[0129]

[0130] From the results in Table 9, it was determined that the optimal coating concentration was 4 μg / mL.

[0131] Table 10 OD values ​​of ELISA results of mouse serum in the experimental group

[0132]

[0133] Cut off value = negative serum OD average value × 2.1. When the average OD value of the serum to be tested is higher than the Cut off value, it is judged as positive. The highest dilution of the serum to be tested that is judged as positive is the serum titer. The serum titers of the experimental group mice were subjected to geometric mean titer analysis, and the GMT value was calculated using the GEOMEAN function. The results are shown in Table 11.

[0134] Table 11 Serum titers and GMT values ​​of mice in the experimental group

[0135]

[0136] From the data in Table 11, we can see that:

[0137] The titers of E2 protein against HPV16 in the sera of 5 mice were between 1600 and 6400, and the GMT value was 3200. All 5 mice were judged to be positive (5 / 5). The kit was used to test the sera of 5 immunized mice, and the results were all positive, indicating that the kit has good accuracy.

[0138] The above experimental results show that the ELISA detection kit for detecting human papillomavirus type 16 E2 antibodies provided by the embodiment of the present invention has good accuracy and can be used to detect the antibody level of human papillomavirus type 16 E2 protein.

[0139] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

[0140] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0141] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0142] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A mutant E2 protein of human papillomavirus type 16, characterized in that: The human papillomavirus type 16 mutant E2 protein is obtained by performing the following three mutations on the wild-type HPV E2 protein: (1) S317P: The serine 317 at position E2 of wild-type HPV16 E2 protein is mutated to proline; (2) T17R and N55R: The threonine 17 of the wild-type HPV16 E2 protein mutated to arginine, and the asparagine 55 mutated to arginine; (3) H218P: The histidine 218th position of the wild-type HPV16 E2 protein is mutated to proline.

2. The human papillomavirus type 16 mutant E2 protein according to claim 1, characterized in that: The amino acid sequence of the human papillomavirus type 16 mutant E2 protein is as shown in SEQ ID NO.

1.

3. A nucleic acid molecule encoding the mutant E2 protein of human papillomavirus type 16 according to claim 1.

4. The nucleic acid molecule according to claim 3, characterized in that The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:

2.

5. An expression vector for human papillomavirus type 16 mutant E2 protein, characterized in that: The expression vector comprises the nucleic acid molecule of claim 4.

6. A recombinant bacterium or engineered cell line comprising the expression vector of claim 5.

7. A method for preparing the mutant E2 protein of human papillomavirus type 16 according to any one of claims 1-2, characterized in that: The method comprises: performing prokaryotic or eukaryotic expression and purification on the recombinant bacteria or engineered cell line of claim 6 to obtain the human papillomavirus type 16 mutant E2 protein.

8. Use of the human papillomavirus type 16 mutant E2 protein according to any one of claims 1-2, or the nucleic acid molecule according to any one of claims 3-4, or the recombinant vector according to claim 5, or the recombinant bacteria or engineered cell line according to claim 6 in the preparation of a product for detecting HPV16 type E2 antibodies or a product for evaluating the humoral immune efficacy of a therapeutic vaccine targeting HPV16 type E2.

9. An ELISA detection kit for E2 antibody of human papillomavirus type 16, characterized in that: The ELISA detection kit comprises: an ELISA enzyme label plate coated with the human papillomavirus type 16 mutant E2 protein according to any one of claims 1-2.

10. An ELISA kit for detecting human papillomavirus type 16 E2 antibody according to claim 9, characterized in that: The coating amount of the human papillomavirus type 18 mutant E6 protein is 2-6 μg / well.

Images