Vp8-Apaf1 fusion protein as well as preparation method and application thereof

Abstract

The invention provides a Vp8-Apaf1 fusion protein as well as a preparation method and application thereof, and relates to the technical field of biological medicines. According to the invention, a Vp8-Apaf1 fusion protein is constructed and expressed, the protein is formed by connecting a dsRBD binding domain of a Vp8 protein of a reoviridae Kadipiro virus and a signal transduction domain of human Apaf-1 composed of CARD, and the amino acid sequence of the fusion protein Vp8-Apaf1 is as shown in SEQ ID NO. 1. According to the preparation method provided by the invention, the Vp8-Apaf1 fusion protein can be successfully and stably expressed. The Vp8-Apaf1 fusion protein provided by the invention has an obvious inhibition effect on RNA (Ribonucleic Acid) virus VSV and DNA (Deoxyribose Nucleic Acid) virus HSV1, and the antiviral effect of the Vp8-Apaf1 fusion protein is influenced by the Vp8-Apaf1 fusion protein in a dose-dependent manner; the Vp8-Apaf1 fusion protein has relatively strong inhibition, prevention and killing effects on the VTT-GFP (Virus Triglyceride-Green Fluorescent Protein). The Vp8-Apaf1 fusion protein provided by the invention has a broad-spectrum antiviral effect, has relatively strong inhibiting, preventing and killing effects on viruses, and provides a new idea for developing broad-spectrum antiviral preparations.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a Vp8-Apaf1 fusion protein and a preparation method and application thereof. Background Art

[0002] In recent years, the world has experienced multiple global pandemics caused by viruses, which have seriously endangered national public health and strategic security. Antiviral drugs or vaccines developed for a single new virus only have a certain protective effect on strains with a high degree of antigenic matching within the subtype, and there is a lag in research and development and production, which is not only inefficient but also uneconomical.

[0003] The innate immune system is the first line of defense against external viral infection. It recognizes the pathogen-associated molecular patterns of viruses through pattern recognition receptors and initiates innate immune responses, which is the main way for the host to clear viruses in the early stage. Retinoic acid-induced gene 1-like receptor (RIG-I like receptor, RLR) is a type of pattern recognition receptor existing in the cytoplasm. The innate immune response mediated by it is an important way for the body to resist viruses. RLR is mainly composed of RIG-I and MDA5 receptors, with high family homology. It has two functionally independent domains: RBD binding domain (RNA Binding Domain, RBD) and CARD signaling domain (CARD signaling domain). The continuous emergence of new viruses or viral mutant pandemics indicates that the virus has established an immune escape mechanism during the evolution process and has broken through the innate immune defense line mediated by RLR. The evolutionary speed of host RLR in recognizing new viruses is much lower than the mutation speed of the virus. According to the functional domain characteristics and mechanism of action of RLR receptors, the functions of its RBD binding domain and CARD domain are independent of each other. Therefore, using the RBD binding domain and CARD signaling domain of specific proteins to reshape the RLR receptor, more effectively identify viruses, and avoid viral immune escape is a key issue that needs to be addressed in the development of viral drugs. This has far-reaching significance for the prevention and control of any viral outbreaks, including new viral mutants or unknown viruses, and is also in line with the country's major strategic needs. Summary of the invention

[0004] 1. Technical issues to be resolved

[0005] In view of the deficiencies in the prior art, the present invention provides a Vp8-Apaf1 fusion protein and a preparation method and application thereof.

[0006] (II) Technical solution

[0007] To achieve the above objectives, the present invention is implemented through the following technical solutions:

[0008] In a first aspect, the present invention provides a Vp8-Apaf1 fusion protein, which is composed of a cell-penetrating peptide domain PTD, a Vp8 protein of Kadipiro virus of the Reoviridae family, a dsRBD binding domain, and a CARD signaling domain of a human Apaf-1 protein.

[0009] Specifically, the sequence of the PTD is shown in SEQ ID NO.4; the RBD sequence of the Vp8 protein of Kadipiro virus of the Reoviridae family is shown in SEQ ID NO.6; and the CARD sequence of Apaf-1 is shown in SEQ ID NO.7.

[0010] Specifically, the structure of the Vp8-Apaf1 fusion protein is: 6*His–BamHI–[PTD]–XhoI-[RBD]-KpnI-[CARD]-HindIII; the amino acid sequence of the Vp8-Apaf1 fusion protein is shown in SEQ ID NO.1, specifically:

[0011] HHHHHHGSYARAAARQARASGLEKGMLQELCVKRGLELPVYEKLSKVGPDHAPTITVKLTANGIEVIEAASSRAQAEKLAAATLYEKGTMDAKARNCLLQHREALEKDIKTSYIMDHMISDGFLTISEEEKVRNEPTQQQRAAMLIKMILKKDNDSYVSFYNALLHEGYKDLAALLHDGIPVV

[0012] In a second aspect, the present invention also provides a gene encoding a Vp8-Apaf1 fusion protein sequence, the amino acid sequence of the gene is shown in SEQ ID NO.1.

[0013] The present invention also provides a method for constructing a gene sequence encoding a Vp8-Apaf1 fusion protein, specifically comprising: double-enzyme digesting the PTD sequence shown in SEQ ID NO.4, the RBD sequence of the Vp8 protein of the Kadipiro virus of the Reoviridae family shown in SEQ ID NO.6, and the CARD sequence of Apaf-1 shown in SEQ ID NO.7, and then connecting them into a vector for integration.

[0014] In a third aspect, the present invention also provides an expression vector containing the Vp8-Apaf1 fusion protein gene.

[0015] In a fourth aspect, the present invention also provides a recombinant bacterium containing the above expression vector.

[0016] In a fifth aspect, the present invention provides a method for preparing a Vp8-Apaf1 fusion protein, wherein the Vp8-Apaf1 fusion protein is prepared according to the following steps:

[0017] (1) The Vp8-Apaf1 fusion protein gene sequence was connected to the pRSET-B vector by double restriction digestion to obtain the pRSET-Vp8-Apaf1 recombinant plasmid;

[0018] (2) The recombinant plasmid obtained in step (1) was transformed into Rosetta gami (DE3) Escherichia coli, coated with an LB plate containing ampicillin and cultured overnight, a single colony on the LB plate was picked for amplification and culture, and sequencing was performed for identification. The consistency of the sequencing sequence indicated that the Vp8-Apaf1 fusion protein expression vector was successfully constructed, and a recombinant bacterium expressing the Vp8-Apaf1 fusion protein was obtained;

[0019] (3) amplifying the recombinant bacteria in step (2), inducing expression with IPTG, collecting the bacteria, breaking them, collecting the precipitate after centrifugation, and washing, denaturing, and renaturing the precipitate to obtain the Vp8-Apaf1 fusion protein;

[0020] Furthermore, step (1) specifically includes the following steps:

[0021] a. Obtain pRSET-PTD vector:

[0022] Synthesize two oligonucleotides with the following sequences:

[0023] CATGGATCCTACGCCCGTGCCGCCGCCCGTCAGGCCCGTGCCATGGT

[0024] (SEQ ID NO.2) and CGTACTCGAGACCACTGGCACGGGCCTG (SEQ ID NO.3)

[0025] Annealing and extension were performed, and restriction enzyme digestion was performed with BamHI and XhoI to obtain cell-penetrating peptide domain (PTD) cDNA, which encoded the amino acid sequence: YARAAARQARA (SEQ ID NO. 4). The PTD sequence was inserted between BamHI and XhoI of the pRSET-B vector to obtain the pRSET-PTD vector;

[0026] b. Obtain pRSET-PTD-Vp8 vector:

[0027] The RBD of the Vp8-Apaf1 fusion protein is the RBD domain of the Vp8 protein of the Kadipiro virus of the Reoviridae family. The sequence is an XhoI restriction site introduced before the sequence and a KpnI restriction site introduced after the sequence. The synthetic sequence is:

[0028] CTCGAGAAGGGTATGCTTCAAGAGTTATGTGTTAAACGTGGATTGGAACTGCCTGTTTACGAAAAATTGTCTAAAGTTGGTCCTGACCATGCACCAACCATTACTGTTAAATTAACAGCTAATGGTATTGAAGTGATTGAGGCCGCTAGCTCACGAGCTCAAGCTGAAAAGCTGGCAGCAGCAACGTTGTATGAAAAGGGTACC(SEQ ID NO.5)

[0029] Its protein sequence is:

[0030] KGMLQE LCVKRGLELP VYEKLSKVGP DHAPTITVKL TANGIEVIEA ASSRAQAEKLAAATLYEK(SEQ ID NO.6)

[0031] Digest with XhoI and KpnI restriction endonucleases to obtain RBD of Vp8, and insert it between XhoI and KpnI of pRSET-PTD vector to obtain pRSET-PTD-Vp8 vector;

[0032] c. Obtain the pRSET-PTD-Vp8-Apaf1 recombinant plasmid:

[0033] The CARD of the Vp8-Apaf1 fusion protein is the CARD of human Apaf-1. A KpnI restriction site is introduced before the upstream primer, and a HindIII restriction site is introduced before the downstream primer. Human cell RNA is extracted and reversely transcribed into cDNA. The primers are used to amplify the CARD of human Apaf-1, and its sequence is as follows:

[0034] GGTACCATGGATGCAAAAGCTCGAAATTGTTTGCTTCAACATAGAGAAGCTCTGGAAAAGGACATCAAGACATCCTACATCATGGATCACATGATTAGTGATGGATTTTTAACAATATCAGAAGAGGAAAAAGTAAGAAATGAGCCCAC TCAACAGCAAAGAGCAGCTATGCTGATTAAAATGATACTTAAAAAAGATAATGATTCCTACGTATCATTCTACAATGCTCTACTACATGAAGGATATAAAGATCTTGCTGCCCTTCTCCATGATGGCATTCCTGTTGTCTAAGCTT(SEQ ID NO.7)

[0035] The human Apaf-1 CARD was obtained by digestion with KpnI and HindIII restriction enzymes, and then inserted between KpnI and HindIII of the pRSET-PTD-Vp8 vector to obtain the pRSET-PTD-Vp8-Apaf1 recombinant plasmid.

[0036] Furthermore, step (3) specifically includes the following steps:

[0037] Pick the Vp8-Apaf1 recombinant bacteria and inoculate them into 20ml Amp + LB medium, culture at 37℃ until OD 600 About 0.5; take 3ml culture and transfer into 250ml Amp + LB culture medium was cultured at 37°C overnight with shaking until the mid-log phase (OD 600 =0.5-1.0), add IPTG to induce protein expression; after induction overnight, centrifuge at 4,000rpm for 30min at 4°C to collect cells; resuspend 10g of wet bacteria with 50ml Lysis Buffer, centrifuge at 8,000rpm for 10min, and discard the supernatant; resuspend 100ml 2M urea-Lysis Buffer for 10g of wet bacteria, ultrasonicate at 200W power, work for 2s and stop for 5s, for a total of 20min; after ultrasonication, stir the sample at 4°C for 1-2h; centrifuge at 12,000rpm for 10min at 4°C, discard the supernatant, add 0.01% NP-40 and 8M urea-Lysis Buffer with the same volume as 2M urea-Lysis Buffer to the precipitate, resuspend, and stir at 4°C overnight (more than 15h); centrifuge at 12,000rpm for 20min at 4°C the next day, take the supernatant, filter with 0.45μm filter membrane, and use it for affinity chromatography to purify protein;

[0038] Furthermore, step (3) further includes the following steps: agarose affinity purification of the recombinant fusion protein Vp8-Apaf1 and on-column renaturation, the specific steps being:

[0039] 1) Column loading: Load 5 ml of Ni-NTA filler into the chromatography column, remove bubbles and compact the filler, turn on the UV detection of the purification system, and rinse with 50 ml of deionized water at a flow rate of 2 ml / min;

[0040] 2) Column equilibration: 30 ml Lysis Buffer was used to equilibrate the column; then 20 ml 8 M urea-Lysis Buffer was used to equilibrate the column at a flow rate of 2 ml / min;

[0041] 3) Protein loading: Add an equal volume of 8 M urea-Lysis Buffer to the protein solution to dilute it, and then slowly pass the protein solution through the chromatography column at a flow rate of 0.5 ml / min;

[0042] 4) On-column renaturation: rinse with 50 ml 8 M, 6 M, 4 M, 2 M, 1 M urea-Lysis Buffer respectively, and then rinse with 200 ml Lysis Buffer, with a flow rate of 1 ml / min.

[0043] 5) Rinse: rinse with 100 ml Wash Buffer until the A280 curve is flat, flow rate 1 ml / min;

[0044] 6) Elution: Add Elution Buffer and collect the protein at a flow rate of 1 ml / min until the A280 curve flattens;

[0045] 7) Column cleaning: rinse with 100 ml of distilled water, and then rinse with 30 ml of 20% ethanol and immerse the chromatography column therein.

[0046] 8) Dialysis desalination: prepare 3 cylinders of 2L Lysis Buffer each and pre-cool them, load the eluted protein into the dialysis tape, dialyze at 4℃, and change the external solution every 6 hours;

[0047] 9) Ultrafiltration concentration: add the dialyzed protein solution into the inner tube of an ultrafiltration tube with a cutoff of 3 kD, centrifuge at 12,000 rpm for 30 min at 4°C, discard the waste liquid in the tube, add PBS and centrifuge again to collect the protein in the inner tube;

[0048] 10) Add 10% glycerol to the protein, filter the protein with a 0.2 μm filter, and then determine the protein concentration using the BCA method and freeze it at -80°C.

[0049] In a sixth aspect, the present invention also provides the use of Vp8-Apaf1 fusion protein in the preparation of antiviral preparations against highly pathogenic viruses.

[0050] The innate immune system constitutes the initial line of defense against viral infection. It recognizes viral pathogen-associated molecular patterns (PAMPs) through pattern recognition receptors (PRRs), thereby initiating innate immune responses. RLRs are a crucial class of receptors in PRRs, and the antiviral innate immune response mediated by them is the most important means of cytoplasmic antiviral. RLRs have a high family homology and have two functionally independent domains, the N-terminal CARD signaling domain and the C-terminal RNA binding domain, which are mainly composed of RIG-I and MDA5 receptors. After the RLR receptor recognizes viral RNA through the RNA binding domain, it uses the CARD-CARD interaction to recruit IPS-1 containing the CARD signaling domain, activates the NF-κB downstream pathway, and exerts a potent antiviral effect. Based on the structure and function of the RLR domain, we assume that its dsRNA binding domain and CARD signaling domain are functionally independent of each other. Since dsRNA is a common feature in the process of viral infection, the presence of long dsRNA can be detected in the cytoplasm of almost all viruses except ssRNA viruses, so remodeling the RLR receptor, especially its dsRNA binding domain, may improve the expression of the RLR receptor. The ability of RLR receptors to recognize viruses and trigger antiviral immune responses prevents viral immune escape.

[0051] In order to improve the sensitivity and specificity of RLR protein in blocking virus immune escape, the present invention constructs and expresses a Vp8-Apaf1 fusion protein, which is composed of the dsRBD binding domain of the Vp8 protein of the Kadipiro virus of the Reoviridae family and the signal transduction domain of human Apaf-1 composed of CARD, and the structure of the Vp8-Apaf1 fusion protein is: 6*His-BamHI-[PTD]-XhoI-[RBD]-KpnI-[CARD]-HindIII; the amino acid sequence of the fusion protein Vp8-Apaf1 is shown in SEQ ID NO. 1. The preparation method provided by the present invention can successfully and stably express the Vp8-Apaf1 fusion protein.

[0052] According to the antiviral effect experiment of Vp8-Apaf1 fusion protein, the Vp8-Apaf1 fusion protein provided by the present invention has a significant inhibitory effect on both RNA virus VSV and DNA virus HSV1, and the Vp8-Apaf1 fusion protein affects their antiviral effects in a dose-dependent manner; at the same time, the Vp8-Apaf1 fusion protein provided by the present invention has a strong inhibitory, preventive and killing effect on VTT-GFP.

[0053] The Vp8-Apaf1 fusion protein provided by the present invention has a broad-spectrum antiviral effect, and has a strong inhibitory, preventive and killing effect on viruses, providing a new idea for the development of a broad-spectrum antiviral preparation. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 Schematic diagram of the structure of Vp8-Apaf1 fusion protein.

[0055] Figure 2 This is the sequencing result of Vp8-Apaf1 fusion protein.

[0056] Figure 3 The results of SDS-PAGE electrophoresis analysis of Vp8-Apaf1 fusion protein (A), where channel 2 is the target protein; the results of Western blot identification of Vp8-Apaf1 fusion protein (B), where channel 1 is the target protein.

[0057] Figure 4 The results of cytotoxicity assay of Vp8-Apaf1 fusion protein.

[0058] Figure 5 The antiviral effect of Vp8-Apaf1 fusion protein on RNA virus VSV, where (A) is the virus content in cells infected with VSV under treatment with different concentrations of Vp8-Apaf1; (B) is the expression level of VSV-G protein in cells infected with VSV under treatment with different concentrations of Vp8-Apaf1; (C) is the expression level of VSV mRNA in cells infected with VSV under treatment with different concentrations of Vp8-Apaf1.

[0059] Figure 6 The figures show the antiviral effect of Vp8-Apaf1 fusion protein on DNA virus HSV1, where (A) is the viral content in cells infected with HSV1 under treatment with different concentrations of Vp8-Apaf1; (B) is the HSV1 mRNA expression results in cells infected with HSV1 under treatment with different concentrations of Vp8-Apaf1.

[0060] Figure 7 The preventive effect of Vp8-Apaf1 fusion protein on VTT, where (left) is the fluorescence image of cells infected with VTT-GFP under the treatment of different concentrations of Vp8-Apaf1; (right) is the FFU value of cells infected with VTT-GFP under the treatment of different concentrations of Vp8-Apaf1.

[0061] Figure 8The killing effect of Vp8-Apaf1 fusion protein on VTT, where (left) is the fluorescence image of cells infected with VTT-GFP under the treatment of different concentrations of Vp8-Apaf1; (right) is the FFU value of cells infected with VTT-GFP under the treatment of different concentrations of Vp8-Apaf1.

[0062] Fig. 9 The inhibitory effect of Vp8-Apaf1 fusion protein on VTT, where (left) is the fluorescence image of cells infected with VTT-GFP under the treatment of different concentrations of Vp8-Apaf1; (right) is the FFU value of cells infected with VTT-GFP under the treatment of different concentrations of Vp8-Apaf1. DETAILED DESCRIPTION

[0063] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0064] Example

[0065] Preparation of 1Vp8-Apaf1 fusion protein

[0066] 1.1 Construction of pRSET-Vp8-Apaf1 recombinant plasmid

[0067] a. Obtain pRSET-PTD vector:

[0068] Synthesize two oligonucleotides with the following sequences:

[0069] CATGGATCCTACGCCCGTGCCGCCGCCCGTCAGGCCCGTGCCATGGT

[0070] (SEQ ID NO.2) and CGTACTCGAGACCACTGGCACGGGCCTG (SEQ ID NO.3)

[0071] Annealing and extension were performed, and restriction enzyme digestion was performed with BamHI and XhoI to obtain cell-penetrating peptide domain (PTD) cDNA, which encoded the amino acid sequence: YARAAARQARA (SEQ ID NO. 4). The PTD sequence was inserted between BamHI and XhoI of the pRSET-B vector to obtain the pRSET-PTD vector;

[0072] b. Obtain pRSET-PTD-Vp8 vector:

[0073] The RBD of the Vp8-Apaf1 fusion protein is the dsRBD of the Vp8 protein of the Kadipiro virus of the Reoviridae family. The RBD fragment of Vp8 is fully synthesized by the company, and the sequence is an XhoI restriction site introduced before the sequence and a KpnI restriction site introduced after the sequence. The synthetic sequence is:

[0074] CTCGAGAAGGGTATGCTTCAAGAGTTATGTGTTAAACGTGGATTGGAACTGCCTGTTTACGAAAAATTGTCTAAAGTTGGTCCTGACCATGCACCAACCATTACTGTTAAATTAACAGCTAATGGTATTGAAGTGATTGAGGCCGCTAGCTCACGAGCTCAAGCTGAAAAGCTGGCAGCAGCAACGTTGTATGAAAAGGGTACC(SEQ ID NO.5)

[0075] Its protein sequence is:

[0076] KGMLQE LCVKRGLELP VYEKLSKVGP DHAPTITVKL TANGIEVIEA ASSRAQAEKLAAATLYEK(SEQ ID NO.6)

[0077] Digest with XhoI and KpnI restriction endonucleases to obtain RBD of Vp8, and insert it between XhoI and KpnI of pRSET-PTD vector to obtain pRSET-PTD-Vp8 vector;

[0078] c. Obtain the pRSET-PTD-Vp8-Apaf1 recombinant plasmid:

[0079] The CARD of the Vp8-Apaf1 fusion protein is the CARD of human Apaf-1. A KpnI restriction site is introduced before the upstream primer, and a HindIII restriction site is introduced before the downstream primer. Human cell RNA is extracted, reverse transcribed into cDNA, and the primers are used to amplify the CARD of human Apaf-1. The sequence is:

[0080] GGTACCATGGATGCAAAAGCTCGAAATTGTTTGCTTCAACATAGAGAAGCTCTGGAAAAGGACATCAAGACATCCTACATCATGGATCACATGATTAGTGATGGATTTTTAACAATATCAGAAGAGGAAAAAGTAAGAAATGAGCCCAC TCAACAGCAAAGAGCAGCTATGCTGATTAAAATGATACTTAAAAAAGATAATGATTCCTACGTATCATTCTACAATGCTCTACTACATGAAGGATATAAAGATCTTGCTGCCCTTCTCCATGATGGCATTCCTGTTGTCTAAGCTT(SEQ ID NO.7)

[0081] The Apaf-1 CARD was obtained by digestion with KpnI and HindIII restriction enzymes, and then inserted between KpnI and HindIII of the pRSET-PTD-Vp8 vector to obtain the pRSET-Vp8-Apaf1 recombinant plasmid.

[0082] 1.2 Construction of Vp8-Apaf1 fusion protein expression vector

[0083] The pRSET-Vp8-Apaf1 recombinant plasmid obtained in 1.1 was transformed into Rosetta gami (DE3) Escherichia coli, coated with LB plates containing ampicillin and cultured overnight, a single colony on the LB plate was picked for amplification and culture, and sequencing was performed for identification. The matching of the sequencing sequences indicated that the Vp8-Apaf1 fusion protein expression vector was successfully constructed, and a recombinant bacterium expressing the Vp8-Apaf1 fusion protein was obtained; the structure of the fusion protein Vp8-Apaf1 is: 6*His–BamHI–[PTD]–XhoI-[RBD]-KpnI-[CARD]-HindIII, and the structural schematic diagram is shown in the figure. Figure 1 The amino acid sequence of the fusion protein Vp8-Apaf1 is shown in SEQ ID NO.1, specifically:

[0084] HHHHHHGSYARAAARQARASGLEKGMLQELCVKRGLELPVYEKLSKVGPDHAPTITVKLTANGIEVIEAASSRAQAEKLAAATLYEKGTMDAKARNCLLQHREALEKDIKTSYIMDHMISDGFLTISEEEKVRNEPTQQQRAAMLIKMILKKDNDSYVSFYNALLHEGYKDLAALLHDGIPVV

[0085] The obtained Vp8-Apaf1 fusion protein was sequenced and identified. Figure 2 As shown, after comparing the sequencing results with the designed sequence, the sequencing sequence was consistent with the designed sequence, indicating that the Vp8-Apaf1 fusion protein expression vector was successfully constructed.

[0086] The fusion protein Vp8-Apaf1 was identified by Western blot. The recombinant bacteria of Vp8-Apaf1 were selected and cultured in LB medium containing ampicillin. The OD 600 When the value was between 0.6 and 0.8, IPTG was added at a final concentration of 1.0 mM to induce expression for 6 h. The cells were collected and broken, and the supernatant and precipitate were collected after centrifugation. The supernatant and precipitate were taken for SDS-PAGE electrophoresis analysis, with channel 2 as the target protein. The results are as follows: Figure 3 As shown in A. After IPTG induction and expression for 6 hours, the bacterial protein can be seen at 20.8KD, and the recombinant protein is expressed in inclusion bodies. Western blot identification shows that the bacterial protein after IPTG induction and expression for 6 hours can react specifically with anti-6*His monoclonal antibody, and a specific band appears at around 20.8KD with high specificity. Channel 1 is the target protein. The results are shown in Figure 3 As shown in B.

[0087] The above sequencing results showed that the Vp8-Apaf1 fusion protein expression vector was successfully constructed.

[0088] 1.3 Expression, purification and renaturation of Vp8-Apaf1 fusion protein

[0089] The recombinant bacteria in 1.2 are cultured and induced to express by IPTG, and then the bacteria are collected; the collected bacteria are crushed, and the precipitate is collected after centrifugation, and the precipitate is washed, denatured, and renatured to obtain the Vp8-Apaf1 fusion protein. The specific steps are as follows:

[0090] (1) Pick the Vp8-Apaf1 recombinant bacteria and inoculate them into 20ml Amp + LB medium, culture at 37℃ until OD 600 About 0.5; take 3ml culture and transfer into 250ml Amp + LB culture medium was cultured at 37°C overnight with shaking until the mid-log phase (OD 600=0.5-1.0), add IPTG to induce protein expression; after induction overnight, centrifuge at 4,000rpm for 30min at 4°C to collect cells; resuspend 10g of wet bacteria with 50ml Lysis Buffer, centrifuge at 8,000rpm for 10min, and discard the supernatant; resuspend 100ml 2M urea-Lysis Buffer for 10g of wet bacteria, ultrasonicate at 200W power, work for 2s and stop for 5s, for a total of 20min; after ultrasonication, stir the sample at 4°C for 1-2h; centrifuge at 12,000rpm for 10min at 4°C, discard the supernatant, add 0.01% NP-40 and 8M urea-Lysis Buffer with the same volume as 2M urea-Lysis Buffer to the precipitate, resuspend, and stir at 4°C overnight (more than 15h); centrifuge at 12,000rpm for 20min at 4°C the next day, take the supernatant, filter with 0.45μm filter membrane, and use it for affinity chromatography to purify protein;

[0091] (2) Agarose affinity purification of the recombinant fusion protein Vp8-Apaf1 and on-column renaturation, the specific steps are as follows:

[0092] 1) Column loading: Load 5 ml of Ni-NTA filler into the chromatography column, remove bubbles and compact the filler, turn on the UV detection of the purification system, and rinse with 50 ml of deionized water at a flow rate of 2 ml / min;

[0093] 2) Column equilibration: 30 ml Lysis Buffer was used to equilibrate the column; then 20 ml 8 M urea-Lysis Buffer was used to equilibrate the column at a flow rate of 2 ml / min;

[0094] 3) Protein loading: Add an equal volume of 8 M urea-Lysis Buffer to the protein solution to dilute it, and then slowly pass the protein solution through the chromatography column at a flow rate of 0.5 ml / min;

[0095] 4) On-column renaturation: rinse with 50 ml 8 M, 6 M, 4 M, 2 M, 1 M urea-Lysis Buffer respectively, and then rinse with 200 ml Lysis Buffer, with a flow rate of 1 ml / min.

[0096] 5) Rinse: rinse with 100 ml Wash Buffer until the A280 curve is flat, flow rate 1 ml / min;

[0097] 6) Elution: Add Elution Buffer and collect the protein at a flow rate of 1 ml / min until the A280 curve flattens;

[0098] 7) Column cleaning: rinse with 100 ml of distilled water, and then rinse with 30 ml of 20% ethanol and immerse the chromatography column therein.

[0099] 8) Dialysis desalination: prepare 3 cylinders of 2L Lysis Buffer each and pre-cool them, load the eluted protein into the dialysis tape, dialyze at 4℃, and change the external solution every 6 hours;

[0100] 9) Ultrafiltration concentration: add the dialyzed protein solution into the inner tube of an ultrafiltration tube with a cutoff of 3 kD, centrifuge at 12,000 rpm for 30 min at 4°C, discard the waste liquid in the tube, add PBS and centrifuge again to collect the protein in the inner tube;

[0101] 10) Add 10% glycerol to the protein, filter the protein with a 0.2 μm filter, and then determine the protein concentration using the BCA method and freeze it at -80°C.

[0102] Cytotoxicity assay of 2Vp8-Apaf1 fusion protein

[0103] The CCK8 kit was used to determine the cytotoxicity of Vp8-Apaf1 protein. The specific method is: 293T cells were inoculated into a 96-well plate, the culture medium was discarded when the cells grew to 60% confluence, and Vp8-Apaf1 protein was introduced at concentrations of 10, 25, 50, 100, 150, 200, 400 and 800nM; 10 replicate wells were assigned to each concentration, and the cell culture medium without cells and Vp8-Apaf1 protein was used as a blank group, and cells without any Vp8-Apaf1 protein (0nM) were used as a control group. The 96-well plate was taken out at 0h, 24h, 48h, and 72h, and CCK8 detection solution was added to each well. After incubation at 37°C for 2 hours, the absorbance value of each well was measured using an enzyme reader. The cell survival rate was then calculated.

[0104] Cell survival rate = (OD 450 -Blank group OD 450 ) / (control group OD 450 -Blank group OD 450 )100%.

[0105] like Figure 4 As shown, compared with the control group, there was no significant difference in the survival rate of cells treated with 10, 20, 50, 100, 150, and 200 nM Vp8-Apaf1 (P>0.05), and the cell viability of the 400 and 800 nM Vp8-Apaf1 treatment groups decreased, with significant differences (P<0.05); based on the above results, 200 nM Vp8-Apaf1 was taken as the maximum safe concentration affecting cell activity.

[0106] Broad-spectrum antiviral effect of 3Vp8-Apaf1 fusion protein

[0107] To verify the broad-spectrum antiviral effect of the Vp8-Apaf1 fusion protein, we first detected the antiviral effect of the Vp8-Apaf1 protein against the RNA virus vesicular stomatitis virus (VSV) and the DNA virus herpes simplex virus type 1 (HSV1).

[0108] 3.1 Antiviral effect of Vp8-Apaf1 fusion protein on RNA virus VSV

[0109] Macrophage RAW264.7 cells were infected with RNA virus VSV for 2 hours and then incubated with Vp8-Apaf1 protein at final concentrations of 0nM, 10nM, 25nM, 50nM, 100nM and 200nM. After 2 days, the cell culture supernatant was collected and diluted, and 8 replicates were set for each dilution factor. The cell culture supernatant of different dilution factors was added to a 96-well plate with Vero cells, and the cytopathic state was observed daily, and the TCID was calculated using the Reed-Muench method. 50 The results showed that as the concentration of Vp8-Apaf1 protein increased, the VSV virus titer gradually decreased ( Figure 5 A). The cells were collected and the expression of VSV protein and mRNA was detected by western blot and qRT-PCR. The results showed that Vp8-Apaf1 protein reduced the levels of VSV protein and mRNA in a dose-dependent manner ( Figure 5 B, Figure 5 C). The above results show that Vp8-Apaf1 protein has a significant inhibitory effect on the RNA virus VSV.

[0110] 3.2 Antiviral effect of fusion protein Vp8-Apaf1 on DNA virus HSV1

[0111] Macrophage RAW264.7 cells were infected with DNA virus HSV1 for 2 hours and then incubated with Vp8-Apaf1 protein at final concentrations of 0nM, 10nM, 25nM, 50nM, 100nM and 200nM. After 2 days, the cell culture supernatant was collected and diluted, and the cell culture supernatant of different dilution multiples was added to a 96-well plate with Vero cells. The cytopathic state was observed daily, and the TCID was calculated using the Reed-Muench method. 50 The results showed that as the concentration of Vp8-Apaf1 protein increased, the HSV1 virus titer gradually decreased ( Figure 6 A). The cells were collected and the expression of HSV1 mRNA was detected by qRT-PCR. The results showed that Vp8-Apaf1 protein reduced the level of HSV1 mRNA in a dose-dependent manner ( Figure 6 B). The above results show that Vp8-Apaf1 protein has a significant inhibitory effect on the DNA virus HSV1.

[0112] 4Vp8-Apaf1 fusion protein inhibits, prevents and kills viruses

[0113] VTT-GFP is a DNA virus that expresses green fluorescent protein and produces a large amount of double-stranded RNA during replication. We also studied the antiviral effect of Vp8-Apaf1 fusion protein on VTT-GFP.

[0114] 4.1 Inhibitory effect of Vp8-Apaf1 fusion protein on VTT-GFP

[0115] First, VTT-GFP was added to the cells, and then Vp8-Apaf1 protein was added. The specific method was as follows: 293T cells were strongly infected with VTT-GFP for 2 hours, and then Vp8-Apaf1 protein was added at final concentrations of 0nM, 10nM, 25nM, 50nM, 100nM, and 200nM for incubation. VTT-GFP-infected cells were observed under a fluorescence microscope and photographed every day.

[0116] The results are as follows Figure 7 As shown in Figure 2, as the concentration of Vp8-Apaf1 protein increased, the number of cells infected with VTT-GFP decreased. At a concentration of 200 nM, no obvious GFP fluorescence was observed, and the infected cells obviously lost their normal morphology (e.g. Figure 7 Left). The FFU of cells in different groups were quantified using the Spearman-Karber method, and it was found that Vp8-Apaf1 protein reduced the titer of VTT-GFP in a dose-dependent manner (e.g. Figure 7 The above results show that the fusion protein Vp8-Apaf1 provided by the present invention has a strong inhibitory effect on VTT.

[0117] 4.2 Preventive effect of Vp8-Apaf1 fusion protein on VTT-GFP

[0118] First, add Vp8-Apaf1 protein to the cells, and then add VTT-GFP. The specific method is: before VTT-GFP infects 293T cells, add Vp8-Apaf1 at final concentrations of 0nM, 10nM, 25nM, 50nM, 100nM, and 200nM. Observe the cells infected with VTT-GFP under a fluorescence microscope every day and take pictures. The results are shown in Figure 2. Figure 8 As shown in Figure 2, the protective effect of Vp8-Apaf1 protein on 293T cells infected with VTT-GFP is related to its concentration. As the concentration of Vp8-Apaf1 protein increases, the number of cells infected with VTT-GFP decreases (Figure Figure 8Left). Quantification of FFU of cells in different groups showed that Vp8-Apaf1 protein reduced the titer of VTT-GFP in a dose-dependent manner ( Figure 8 The above results show that the Vp8-Apaf1 fusion protein provided by the present invention has a strong preventive effect on VTT.

[0119] 4.3 Killing effect of Vp8-Apaf1 fusion protein on VTT-GFP

[0120] Vp8-Apaf1 protein and VTT-GFP were added to the cells at the same time. The specific method was: Vp8-Apaf1 and VTT-GFP were added to 293T cells at final concentrations of 0nM, 10nM, 25nM, 50nM, 100nM and 200nM at the same time. The results are shown in Fig. 9 As shown in the figure, compared with the VTT-GFP control group (0nM Vp8-Apaf1), different concentrations of Vp8-Apaf1 protein showed a certain killing effect on VTT-GFP, and there was a certain dose-effect relationship ( Fig. 9 Left). FFU quantification of cells in different groups showed that Vp8-Apaf1 protein reduced the titer of VTT-GFP in a dose-dependent manner ( Fig. 9 The above results show that the Vp8-Apaf1 fusion protein provided by the present invention has a significant killing effect on VTT.

[0121] 5 Discussions

[0122] In order to improve the sensitivity and specificity of RLR protein in blocking viral immune escape, the present invention constructs and expresses a Vp8-Apaf1 fusion protein, which is composed of the dsRBD binding domain of the Vp8 protein of Kadipiro virus of the Reoviridae family connected with the signal transduction domain of human Apaf-1 composed of CARD. The structure of the Vp8-Apaf1 fusion protein is: 6*His-BamHI-[PTD]-XhoI-[RBD]-KpnI-[CARD]-HindIII; the amino acid sequence of the fusion protein Vp8-Apaf1 is shown in SEQ ID NO.1.

[0123] We also verified the antiviral effect of the Vp8-Apaf1 fusion protein. According to the above experimental results, the Vp8-Apaf1 fusion protein provided by the present invention has a significant inhibitory effect on both RNA virus VSV and DNA virus HSV1, and the Vp8-Apaf1 fusion protein affects its antiviral effect in a dose-dependent manner; at the same time, the Vp8-Apaf1 fusion protein provided by the present invention has a strong inhibitory, preventive and killing effect on VTT-GFP. According to the above, the Vp8-Apaf1 fusion protein provided by the present invention has a broad-spectrum antiviral effect, which provides a new idea for the development of antiviral drugs.

[0124] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Vp8-Apaf1 fusion protein, characterized in that: The Vp8-Apaf1 fusion protein consists of a cell-penetrating peptide domain PTD, a dsRBD binding domain of the Vp8 protein of the Kadipiro virus of the Reoviridae family, and a CARD signal domain of the human Apaf-1 protein.

2. The Vp8-Apaf1 fusion protein according to claim 1, characterized in that: The sequence of the PTD is shown in SEQ ID NO.4; the RBD sequence of the Vp8 protein of the Kadipiro virus of the Reoviridae family is shown in SEQ ID NO.6; and the CARD sequence of Apaf-1 is shown in SEQ ID NO.

7.

3. The Vp8-Apaf1 fusion protein according to claim 1, characterized in that: The amino acid sequence of the Vp8-Apaf1 fusion protein is shown in SEQ ID NO.

1.

4. A gene encoding the Vp8-Apaf1 fusion protein sequence according to claim 1, characterized in that: The amino acid sequence of the gene is shown in SEQ ID NO.

1.

5. The method for constructing a gene encoding a Vp8-Apaf1 fusion protein sequence according to claim 4, characterized in that: The PTD sequence shown in SEQ ID NO.4, the RBD sequence of Vp8 protein of Kadipiro virus of Reoviridae family shown in SEQ ID NO.6 and the CARD sequence of Apaf-1 shown in SEQ ID NO.7 were double-digested and then connected into the vector for integration. An expression vector comprising the Vp8-Apaf1 fusion protein according to claim 1 .

7. An expression recombinant bacterium comprising the expression vector according to claim 6.

8. A method for preparing a Vp8-Apaf1 fusion protein, characterized in that: The Vp8-Apaf1 fusion protein was prepared according to the following steps: (1) The Vp8-Apaf1 fusion protein gene sequence was connected to the pRSET-B vector by double restriction digestion to obtain the pRSET-Vp8-Apaf1 recombinant plasmid; (2) The recombinant plasmid obtained in step (1) was transformed into Rosetta gami (DE3) Escherichia coli, coated with an LB plate containing ampicillin and cultured overnight, a single colony on the LB plate was picked for amplification and culture, and sequencing was performed for identification. The consistency of the sequencing sequence indicated that the Vp8-Apaf1 fusion protein Vp8-Apaf1 fusion protein expression vector was successfully constructed, and a recombinant bacterium expressing the Vp8-Apaf1 fusion protein was obtained; (3) The recombinant bacteria in step (2) are cultured and induced to express by IPTG, the bacteria are collected and crushed, the precipitate is collected after centrifugation, and the precipitate is washed, denatured, and renatured to obtain the Vp8-Apaf1 fusion protein.

9. Use of the Vp8-Apaf1 fusion protein according to claim 1 in the preparation of an antiviral preparation against highly pathogenic viruses.

Images