Strain for producing cholest-5, 7, 24-triene-3beta alcohol and application thereof

Abstract

The invention relates to the technical field of microorganisms, in particular to a bacterial strain for producing cholest-5, 7, 24-triene-3beta alcohol and application of the bacterial strain. The invention provides a gene engineering strain for producing cholest-5, 7, 24-triene-3 beta alcohol, an ERG4 gene, an ERG5 gene and an ERG6 gene are knocked out, and the yield of the cholest-5, 7, 24-triene-3 beta alcohol of the strain reaches 360 mg / L and is increased by 300% or above compared with the prior art; in addition, the fermentation time is shortened to 20 hours, and compared with other strains, the fermentation time is saved by 70 hours.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, in particular to a strain producing cholesteryl-5,7,24-triene-3β-ol and application thereof. Background Art

[0002] Cholesterol-5,7,24-triene-3β-ol is an important intermediate of active vitamin D3. It can be used as a starting material for the synthesis of calcifediol in industry, and then further synthesized into calcitriol. In addition, this substance is also a synthetic intermediate for other cholesterol drugs and has high economic value. Establishing a production process for obtaining cholesterol-5,7,24-triene-3β-ol can change the current production status of using high-priced raw materials such as vitamin D3 as reaction substrates, and effectively reduce production costs.

[0003] Calcifediol is a highly active vitamin D3, which is more active than VD3. It can be used as a substitute for VD3 in the feed industry. Only DSM and Garden Bio can produce it on a large scale in the world, with a market capacity of more than 1 billion yuan. Calcifediol currently uses a full chemical synthesis process, extracting 24-dehydrocholesterol from lanolin and synthesizing it through 10 steps of chemical reactions. There are problems such as long synthesis route, high cost and severe environmental pollution.

[0004] Cholesterol-5,7,24-triene-3β-ol is similar to ergosterol in yeast, so the synthesis of cholesterol-5,7,24-triene-3β-ol in yeast can be achieved by modifying the ergosterol pathway in yeast. However, due to the long synthesis pathway of cholesterol-5,7,24-triene-3β-ol, the many intermediates involved, and the complexity of subsequent purification and impurity removal, the cost of producing cholesterol-5,7,24-triene-3β-ol with yeast is relatively high. Summary of the invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide a strain producing cholesteryl-5,7,24-triene-3β-ol and its application.

[0006] The present invention provides a cholesteryl-5,7,24-triene-3β-ol producing strain, which is a cerevisiae yeast in which ERG4 gene, ERG5 gene and ERG6 gene are knocked out.

[0007] The invention provides an engineered strain of Saccharomyces cerevisiae with a high yield of cholesteryl-5,7,24-triene-3β-ol. By genetically modifying the strain, the strain loses the expression activities of sterol 24-C methyltransferase, sterol 22 desaturase and sterol Δ24 (28)-methylene reductase. The strain increases the yield of cholesteryl-5,7,24-triene-3β-ol without affecting the growth of the strain. The yield can reach 360 mg / L after 20 hours of fermentation.

[0008] In the present invention, the base bacteria of the strain is Saccharomyces cerevisiae. Preferably, the base bacteria of the strain is CCTCCNo: M2016418.

[0009] In the present invention, the knockout refers to the loss of expression activity of ERG4, ERG5 and ERG6 genes, including but not limited to knocking out part or all of the fragments of ERG4, ERG5 and ERG6 genes, or inhibiting the expression of ERG4, ERG5 and ERG6 genes. In a specific embodiment, the knockout is the loss of expression activity of ERG4, ERG5 and ERG6 genes.

[0010] In a specific embodiment, the nucleic acid sequence of the ERG4 gene knocked-out fragment is shown as SEQ ID NO: 1; the nucleic acid sequence of the ERG5 gene knocked-out fragment is shown as SEQ ID NO: 4; the nucleic acid sequence of the ERG6 gene knocked-out fragment is shown as SEQ ID NO: 7.

[0011] Furthermore, the present invention also provides a method for constructing the aforementioned strain, comprising: knocking out the ERG4 gene, the ERG5 gene and the ERG6 gene in Saccharomyces cerevisiae.

[0012] In the present invention, the method of knocking out a gene includes: knocking out the target gene using homologous recombination technology, knocking out the target gene using CRISPR-Cas9 technology, knocking out the target gene using TALEN technology, and knocking out the target gene using ZFN technology. In the embodiment of the present invention, CRISPR-Cas9 technology is used to knock out the target gene.

[0013] In the present invention, the construction method specifically includes: mixing Saccharomyces cerevisiae competent cells, upstream and downstream homology arms, gRNA, PEG3350, pHCas9 plasmid, salmon sperm and lithium acetate, and then incubating and culturing to obtain the strain.

[0014] In the present invention, the gRNA for knocking out each gene includes: The target N20 nucleic acid sequence of the gRNA for knocking out the EGR4 gene is ATAAAGTAAAGGGTGAACCA (SEQ ID NO: 10); The target N20 nucleic acid sequence of the gRNA for knocking out the EGR5 gene is AAACTGTGCTCAAATGGCTA (SEQ ID NO: 11); The target nucleic acid sequence N20 of the gRNA for knocking out the EGR6 gene is AATCTTGCAATCTTCTTGC (SEQ ID NO: 12).

[0015] The upstream and downstream homology arms include: The nucleic acid sequence of the upstream homology arm of the EGR4 gene is shown in SEQ ID NO: 2; The nucleic acid sequence of the downstream homology arm of the EGR4 gene is shown in SEQ ID NO: 3; The nucleic acid sequence of the upstream homology arm of the EGR5 gene is shown in SEQ ID NO:5; The nucleic acid sequence of the downstream homology arm of the EGR5 gene is shown in SEQ ID NO:6; The nucleic acid sequence of the upstream homology arm of the EGR6 gene is shown in SEQ ID NO:8; The nucleic acid sequence of the downstream homology arm of the EGR6 gene is shown in SEQ ID NO:9.

[0016] Furthermore, the present invention also provides a reagent for constructing a cholesteryl-5,7,24-triene-3β-ol producing strain, which includes gRNA and homology arm donor fragments of each gene; The gRNA comprises: The nucleic acid sequence of the gRNA for knocking out the EGR4 gene is shown in SEQ ID NO: 10; The nucleic acid sequence of the gRNA for knocking out the EGR5 gene is shown in SEQ ID NO: 11; The nucleic acid sequence of the gRNA for knocking out the EGR6 gene is shown in SEQ ID NO: 12; The upstream and downstream homology arms include: The nucleic acid sequence of the upstream homology arm of the EGR4 gene is shown in SEQ ID NO: 2; The nucleic acid sequence of the downstream homology arm of the EGR4 gene is shown in SEQ ID NO: 3; The nucleic acid sequence of the upstream homology arm of the EGR5 gene is shown in SEQ ID NO:5; The nucleic acid sequence of the downstream homology arm of the EGR5 gene is shown in SEQ ID NO:6; The nucleic acid sequence of the upstream homology arm of the EGR6 gene is shown in SEQ ID NO:8; The nucleic acid sequence of the downstream homology arm of the EGR6 gene is shown in SEQ ID NO:9.

[0017] In some embodiments, the construction reagents also include pHCas9 plasmid, PEG3350, salmon sperm and lithium acetate.

[0018] In some other embodiments, the construction reagents further include: The nucleic acid sequences of two primers for constructing the N20 sequence of the gRNA target site of the ERG4 gene are shown in SEQ ID NOs: 13-14; The nucleic acid sequences of two primers for constructing the N20 sequence of the gRNA target site of the ERG5 gene are shown in SEQ ID NOs: 15-16; The nucleic acid sequences of two primers for constructing the N20 sequence of the gRNA target site of the ERG6 gene are shown in SEQ ID NOs: 17-18; The nucleic acid sequences of the two primers for amplifying the upstream homology arms of the EGR4 gene are shown in SEQ ID NOs: 19-20; The nucleic acid sequences of the two primers for amplifying the downstream homology arms of the EGR4 gene are shown in SEQ ID NOs: 21-22; The nucleic acid sequences of the two primers for amplifying the upstream homology arms of the EGR5 gene are shown in SEQ ID NOs: 23-24; The nucleic acid sequences of the two primers for amplifying the downstream homology arms of the EGR5 gene are shown in SEQ ID NOs: 25-26; The nucleic acid sequences of the two primers for amplifying the upstream homology arms of the EGR6 gene are shown in SEQ ID NOs: 27-28; The nucleic acid sequences of the two primers for amplifying the downstream homology arms of the EGR6 gene are shown in SEQ ID NOs: 29-30.

[0019] Furthermore, the present invention also provides a method for preparing cholesta-5,7,24-triene-3β-ol, which comprises culturing the strain as described above to obtain a product containing cholesta-5,7,24-triene-3β-ol.

[0020] In the present invention, the culture substrate is 20 g / L YE culture medium; Feed 1 contained 30% glucose, 30% molasses, 0.24 g / L copper sulfate, and water; Feed 2 was 150 g / L diammonium phosphate solution; Feed three is ammonia water.

[0021] In the initial fermentation process of the experiment of the present invention, before the strain is cultured to a cholesterol-5,7,24-triene-3β alcohol content of 180 g / L, the cholesterol-5,7,24-triene-3β alcohol content increases normally, but after 180 g / L, the content decreases. Analysis shows that one of the main factors for the increase in dissolved oxygen is insufficient carbon source. In the case of insufficient sugar, it is speculated that the strain conducts other synthetic pathways, competes for substrates, consumes itself, and causes a decrease in content. The subsequent process was improved. In the control method of maintaining 20% ​​dissolved oxygen, no sugar reduction measures were taken, but the method of increasing air volume, stirring, and increasing tank pressure was adopted to keep the cholesterol-5,7,24-triene-3β alcohol content elevated.

[0022] Preferably, in the present invention, the culture conditions include: 1. During the fermentation process, the alcohol content is less than 0.2%. If the alcohol content is too high, reduce the sugar content and wait until the alcohol content drops to about 0.1% before restoring. 2. Provide nutrients required for bacterial growth at the beginning of fermentation. When the wet weight is greater than 40g / L, the amount of sugar added can be adjusted according to the actual situation. The RQ can be controlled at around 1.1-1.15 by adding sugar, and the CER / OUR can be maintained to rise steadily. The amount of P flow added is about 1 / 17.6-1 / 10 of the amount of C source flow added (rounded).

[0023] 3. Control dissolved oxygen above 20%, maximum air volume 50, stirring 500 (linked).

[0024] The present invention provides a genetically engineered strain for producing cholesteryl-5,7,24-triene-3β-ol, wherein the ERG4 gene, the ERG5 gene and the ERG6 gene are knocked out, and the yield of cholesteryl-5,7,24-triene-3β-ol of the strain reaches 360 mg / L, which is more than 300% higher than the prior art; and the fermentation time is shortened to 20 hours, which saves 70 hours of fermentation time compared with other strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It shows the liquid phase detection spectrum of cholesteryl-5,7,24-triene-3β-ol standard; Figure 2 The liquid phase detection spectrum of GL0134 strain is shown; Figure 3 The liquid chromatography peak diagrams of different strains are shown. DETAILED DESCRIPTION

[0026] The present invention provides a strain producing cholesteryl-5,7,24-triene-3β-ol and a construction method and application thereof. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters for implementation. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0027] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0028] The culture medium involved in the embodiment includes: LB medium: peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L. Add 20g / L agar powder to prepare LB solid medium.

[0029] YPD medium: 20 g / L peptone, 10 g / L yeast powder, 20 g / L glucose. Add 20 g / L agar powder to prepare YPD solid medium.

[0030] Shake flask fermentation medium: sucrose 5 g / L, YE 20 g / L, potassium dihydrogen phosphate 4 g / L, magnesium sulfate 2 g / L.

[0031] Fermentation medium: base material: YE 20g / L; supplementary feed 1: 30% glucose, 30% molasses, copper sulfate 0.24g / L; supplementary feed 2: diammonium phosphate 150g / L; supplementary feed 3: ammonia water.

[0032] The gene sequences involved in the present invention include:

[0033] The upstream homologous arm sequence of the ERG4 gene is: attttctttttctatccgcttcattaacttattttacagtttgtatataaaagtattgatgtatttacgcgacaaaagggcttgaaaagattcgattttctattacttgatctactttttcctataaaataaatcctaaatgaaacgtgtccatacatatattgagtgttgacgcgtgtgatttcacattatgttgtggcaggaagtatgttaatcttgttcagcaattgctactagcctttcttcgatgttctcagcactcaaggtaaagaatttgtcctttgtagcgacaccgacttccaagtcattctttgaaaattcagtacccagtgcgtcaatcatatgagtaatagcaaattctaccaccttctcccatgattcttcattaatatggtcgattttactctttttgaaatggttttctaagtttgttgtaatctcctgttgttttggtcctgtcgcagtagctttgtagccaacgtaataacctgcagggtca (SEQ ID NO:2).

[0034] The downstream homologous arm sequence of the ERG4 gene is: aagtgatgtgcaaattgtatttttttagccaaaactcactcctggtaatgtctatatggccgctatggtcctgctatcatgctattgttgacaatgaaagagtggctgatcatgtgtaataggcgaataaggttgttttgaagagctttaattagcgcctcttattgccactcattaggtcttgaacaagaaaagaaactccatttagggtatgcgtctgtttccaacaaagccctattggaccctgagaatgtaaatcagggctcgtttcttctcgtttaataactaaacgagactcatttctttttcgttccttggcgctattttcgtgcatcccgtaattgccggtattacgcgatcgtttggcgttactatggaaaagcagaattatatatcctcgaggaaaaattaccaaacagtggtaataacgtaggaatgtagttcagttatgtagataggcagatacggatatttacgtagtgtacatagattagcatcgct (SEQ ID NO:3).

[0035]

[0036] The upstream homologous arm sequence of the ERG5 gene is: catccttcttggattgcaaaaagattagctgaagaaaaattacaaaaagctaaatttgaaggtaagaagatcaaatttgattgaacataacgtcttcatctcctaacttcatgtataataaaaactattagcacatctattttatatatgtacgcgtatatcttacatcgtaccgttatagcatttgaattattgagcttttgtatcatctaccactgtcatgctcgccttcacggaacttagtatatgcgaaaaagaattcaggaaaccaaagctggcaaggtgagtatttgtttgtaaagtcgcacctttagcagatcattagctgtagcgcatggaagaaaactaaatgaaattgtttataaaacctgaatatgataaaagaaatctaaataataaatatgattgctatataatagttatatttgaaatgaagagaaagggaagaaaataaaagtattcaaaacgccaacccttaatgaagtaaatatgatttattgtctggacaaagttctgtttttccccattattc (SEQ ID NO:5).

[0037] The downstream homologous arm sequence of the ERG5 gene is: ggtatttattgtctattggaatagcaaaatgtgatgttttgtttattgtgatgaaaattaaggaaacaatataacaagaaagaaatgagtaagaataagatatttggaacaatagacaattagcttatatatgatttttttcttccaacaagattccctgcttgcgtatataaaccaatcagtccctttgcctgaagacaataaggacgatcttttacaaccgattcgataaaaaatcttttcaaaaccgaaacatgagctctcttcaatagcgatataaacaccggcagcatatagacgcaggtttgggctatgttttgtcagcagcgataaaaggtacgagacttcgcagacttaaacgagggaaaccttctcgagaactatggtaacaaatattacccgccccggaaattgcggaacaaatacactgtctctttacgagtttctcg (SEQ ID NO:6).

[0038]

[0039] The upstream homologous arm sequence of the ERG6 gene is ccaatggctttctttctgccactttccttttctttgcttctttgaaaagcacatgccgtttcaccacaggatcgtatctgacctgagtaaccaaaggtgcacctttcttaatcgagatgtaacgagagtatccacttgccgctgtagacaatagctttataacactattcttagatttcacttttaccatatcggcacataaatatggaaacagttacgatgttgtattcttactatcttccgctgtaggggagcagtcaatacgtttgtatgcagtgaattatagttttttcttattctgatagaaaatactggtcgtttgccacgacatgatgaaaaaaaaaaaagccgaacttgaaaatcacaagtgggataaattgtggggtagtaaaggcatcggacagtctgtttgtaaggcctgctagcaatgaacgtgctatctttttatctgcatatataggaaaataggtatatatcgtgcgctttatttgaatctt (SEQ ID NO:8).

[0040] The downstream homology arm sequence of ERG6 gene is actcatcttatgctgcctactatattattattttattcttgtttttttaaattatgtaaaacttaaatcgaaagtaaaacagataagggaaacttgaatgaaaattaacagcttataaattacaaagacgaatggaaagaaaaagagagcagcagaggataggagaaaacacccgaactatataaaaagcaatgaagaagttatcggcaacagcaagtattggaggtttctcaccaatcttcgcataaaacgca tgcttcgtaaggcgataaaaatgaagtgtaccattgagacgaagtggagcagtttacagtgaataatacattgtctgctcctcacttactctcgcttctcgaaaacttttttgtatttatcggaaacggcagta aacgacgccaaaaattgaaaataagtacgggaacgaggtaccatatacgaagatcggggctttgttcggccctaaattttgctgatcttaccctgttgcatcttttcaaaaatagtaaccagccctagctg (seq ID NO:9).

[0041] The present invention will be further described below in conjunction with embodiments: Example 1 Construction of engineered yeast strains 1.1 Construction of gRNA for knockout site Design the following primers and construct gRNA by primer self-annealing Table 1 Primers for gRNA construction

[0042] 1.1.1 Prepare PCR reaction mixture: 20 μL system contains: 2 μL 10×T4 Buffer, 2 μL 10uM Primer F / R, and make up the volume to 20 μL with deionized water.

[0043] 1.1.2 Set the working program on the PCR instrument: keep at 95℃ for 5 minutes; reduce the temperature by 5℃ every 1 minute to 16℃; keep at 16℃ for 10 minutes and store at 4℃.

[0044] 1.1.3 BsaI digestion of pScm-N20 plasmid and recovery: 50 μL system contains: 1 μg pScm-N20 plasmid, 5 μL 10X rCutSmartTM Buffer, 1 μL BasI enzyme, and the volume is made up to 50 μL with deionized water. React at 37℃ overnight. After the digestion product is analyzed by agarose gel electrophoresis, the target fragment is recovered by gel excision.

[0045] 1.1.4 Prepare T4 enzyme ligation reaction mixture: 10 μL system contains: 1 μL self-annealing product, 1 μL BsaI-pScm recovery product, 1 μL T4 ligase, 1 μL 10X T4 Buffer, add deionized water to make up the volume to 10 μL, and react at room temperature for 3-4 hours.

[0046] 1.1.5 Transformation into competent E. coli DH5a: Add the ligation product to 50 μL of competent E. coli DH5a, place on ice for 30 min, heat shock at 42°C for 45 s; quickly place on ice for 3 min, add 800 μL of LB medium; resuscitate at 37°C, 200 rpm for 50 min; and apply to the corresponding Amp-resistant plate.

[0047] 1.1.6 After sequencing verification, the plasmid is extracted for standby use, and the recombinant gRNA plasmid is obtained.

[0048] The target N20 nucleic acid sequence of the gRNA for knocking out the EGR4 gene is ATAAAGTAAAGGGTGAACCA (SEQ ID NO: 10); The target N20 nucleic acid sequence of the gRNA for knocking out the EGR5 gene is AAACTGTGCTCAAATGGCTA (SEQ ID NO: 11); The target nucleic acid sequence N20 of the gRNA for knocking out the EGR6 gene is AATCTTGCAATCTTCTTGC (SEQ ID NO: 12).

[0049] 1.2 Construction of homology arm donor fragment The following primers were designed, and the genome of the starting strain CCTCC No: M2016418 was used as a template to obtain upstream and downstream homology arm fragments by PCR amplification.

[0050] Table 2 Upstream and downstream homology arm amplification primers

[0051] The amplified Up and Down fragments were subjected to overlap PCR to obtain the homology arm donor fragment.

[0052] 1.3 Construction of gene knockout engineering strains 1.3.1 Preparation of competent cells of Saccharomyces cerevisiae ①Pick out a single colony of the starting strain CCTCC No: M2016418 and place it in 5 mL YPD medium, at 30°C, 200 rpm, and activate overnight ② Transfer 500 μL of bacterial solution to 50 mL of YPD medium and culture at 30°C, 200 rpm until OD600 is between 0.8-1.0.

[0053] ③ Place the bacterial solution in an ice bath for 20 minutes, then centrifuge it at 4°C, 5000 rpm to remove the supernatant.

[0054] ④ Add 50 mL of pre-cooled deionized water to resuspend and wash the centrifuged cells, centrifuge at 4°C, 5000 rpm, and remove the supernatant. Repeat this step twice.

[0055] ⑤ Add an appropriate amount of pre-cooled deionized water to resuspend the centrifuged cells.

[0056] 1.3.2 Transformation of Saccharomyces cerevisiae The transformation was performed three times according to the following method. After knocking out the ERG4 gene, the yeast was cultured to knock out the ERG5 gene, and then the ERG6 gene, to obtain the brewer's yeast in which the ERG4 gene, the ERG5 gene and the ERG6 gene were knocked out.

[0057] ① Take 100 μL competent cells, add 1-2 μg of upstream and downstream homology arms, 1-2 μg of gRNA, 1-2 μg of pHCas9 plasmid, 240 μL of 50% PEG3350, 10 μL of 10 mg / mL salmon sperm and 36 μL of 1 M lithium acetate, and mix thoroughly.

[0058] ②Incubate at 30℃ for 30min. During the incubation process, flick the tube 2-3 times with your fingers to mix it evenly.

[0059] ③Then incubate at 42℃ for 50min. During the incubation process, flick the tube 2-3 times with your fingers to mix it evenly.

[0060] ④ Centrifuge the bacterial solution at 5000 rpm, remove the supernatant and add 1 mL of YPD, and resuscitate at 30°C, 200 rpm overnight.

[0061] ⑤ Add all the culture to 4 mL of YPD medium with corresponding resistance, resuscitate at 30°C, 200 rpm for 6-8 hours, and then spread on the corresponding resistance plate.

[0062] ⑥Cultivate at 30℃ for 2-3 days to produce transformants.

[0063] 1.3.3 Verification of transformants The following primers were designed for colony PCR verification, and after preliminary verification, the results were sent for sequencing to confirm that the gene was successfully knocked out.

[0064] Table 3 Validation primers

[0065] Results: The Saccharomyces cerevisiae engineered strain GL0134 with the above three genes knocked out was successfully constructed.

[0066] Example 2 Fermentation of high-yield cholesteryl-5,7,24-triene-3β-ol yeast engineering bacteria 2.1 Shake flask fermentation of high-yield cholesteryl-5,7,24-triene-3β-ol yeast The shake flask detection process of high-yield cholesteryl-5,7,24-triene-3β-alcohol yeast includes: slant culture → liquid culture → shake flask culture → centrifugal collection of precipitate → obtaining high-yield cholesteryl-5,7,24-triene-3β-alcohol yeast cells 2.1.1 Slant culture: Saccharomyces cerevisiae GL0134 producing cholesteryl-5,7,24-triene-3β-ol was inoculated on a YPD solid slant, cultured at 30°C for 48 h, and stored in a 4°C refrigerator.

[0067] 2.1.2 Liquid strain: After activating the preserved cholesteryl-5,7,24-triene-3β-alcohol brewer's yeast GL0134, place a loop of cells in a YPD liquid culture tube and culture at 30°C and 200 rpm for 15-24 hours to obtain the liquid strain.

[0068] 2.1.3 Shake flask culture: Inoculate the liquid bacteria into a 500 mL shake flask containing 100 mL shake flask fermentation medium at an inoculum size of 2% at OD = 1.0, and culture at 30°C and 200 rpm for 48 h.

[0069] 2.1.4 Collect yeast cells by centrifugation: Collect yeast cells with high cholesteryl-5,7,24-triene-3β-ol production by centrifugation and freeze-dry them.

[0070] 2.2 Fermentation of high-yield cholesteryl-5,7,24-triene-3β-ol yeast engineered strains in fermenter The fermentation process of high-yield cholesteryl-5,7,24-triene-3β-ol yeast includes: test tube (picking a single colony) → 50 / 250ml shake flask (24h, 200rpm, 31℃) → 50 / 250ml first-level shake flask (5ml activated bacterial solution, 24h, 200rpm, 31℃) → 2 / 5L second-level shake flask (24h, 200rpm, 31℃) → 45L tank (batch feeding / continuous flow feeding) → sampling → detecting the cholesteryl-5,7,24-triene-3β-ol content → collecting the bacteria by centrifugation.

[0071] 1. During the fermentation process, the alcohol content is less than 0.2%. If the alcohol content is too high, reduce the sugar content and wait until the alcohol content drops to about 0.1% before restoring. 2. Provide nutrients required for bacterial growth at the beginning of fermentation. When the wet weight is greater than 40g / L, the amount of sugar added can be adjusted according to the actual situation. The RQ can be controlled at around 1.1-1.15 by adding sugar, and the CER / OUR can be maintained to rise steadily. The amount of P flow added is about 1 / 17.6-1 / 10 of the amount of C source flow added (rounded). 3. Control dissolved oxygen above 20%, maximum air volume 50, stirring 500 (linked).

[0072] Example 3 Determination of the content of cholesteryl-5,7,24-triene-3β-ol in Saccharomyces cerevisiae cells 3.1 Detection of cholesteryl-5,7,24-triene-3β-ol content 3.1.1 Weigh 0.1g dry yeast into a 25mL glass screw-cap test tube, add 3mL saponifier (composition: 20% sodium hydroxide: methanol = 5:3), and saponify in a water bath at 80℃ for 2h.

[0073] 3.1.2 Take out the test tube, cool it to room temperature away from light, add anhydrous ethanol to 25mL mark, shake well, and let it stand.

[0074] 3.1.3 Filter with a 0.22μm organic microporous filter membrane and set aside.

[0075] 3.1.4 High performance liquid chromatography detection: Chromatographic column: C18 column, 4.6 mm×250 mm, particle size 5 μm; column temperature: 30°C; flow rate: 1.0 mL / min; mobile phase: methanol 100%; detection wavelength: 282 nm, 206 nm; injection volume: 10 μL.

[0076] Results: Figure 1~2 The retention time of cholesta-5,7,24-triene-3β-ol in the strain was 10.443 min, and the final calculated cholesta-5,7,24-triene-3β-ol content was 360 mg / L.

[0077] Comparative Example 1 Construction of control strain and determination of product content Another chassis strain CEN.PK 113-7D in the laboratory was modified to obtain a high-yield cholesteryl-5,7,24-triene-3β-ol strain. After strengthening its mevalonate pathway and post-squalene pathway, the ERG4 and ERG5 genes were knocked out to obtain the strain GL0152. However, further knocking out the ERG6 gene of this strain had a serious impact on its growth. Therefore, the GL0152 strain was tested. The test results showed that the content of cholesteryl-5,7,24-triene-3β-ol in the expression product of GL0152 was much lower than that of GL0134 ( Figure 3 ), the liquid phase detection peak graph showed that under this detection condition, the GL0152 strain had a large amount of by-products, while the GL0134 strain had no obvious by-products.

[0078] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A cholesteryl-5,7,24-triene-3β-ol producing strain, which is a cerevisiae yeast in which the ERG4 gene, the ERG5 gene and the ERG6 gene are knocked out.

2. The strain according to claim 1, characterized in that Its base bacteria is CCTCC No: M2016418.

3. The strain according to claim 1 or 2, characterized in that The nucleic acid sequence of the ERG4 gene knocked-out fragment is shown in SEQ ID NO: 1; The nucleic acid sequence of the ERG5 gene knockout fragment is shown in SEQ ID NO: 4; The nucleic acid sequence of the ERG6 gene knocked-out fragment is shown in SEQ ID NO:

7.

4. A method for constructing the strain according to any one of claims 1 to 3, comprising: Knockout of ERG4, ERG5 and ERG6 genes in Saccharomyces cerevisiae.

5. The method according to claim 4, characterized in that The strain is obtained by mixing Saccharomyces cerevisiae competent cells, upstream and downstream homology arms, gRNA, PEG3350, pHCas9 plasmid, salmon sperm and lithium acetate, and incubating and culturing the mixture; The gRNA comprises: The nucleic acid sequence of the gRNA for knocking out the EGR4 gene is shown in SEQ ID NO: 10; The nucleic acid sequence of the gRNA for knocking out the EGR5 gene is shown in SEQ ID NO: 11; The nucleic acid sequence of the gRNA for knocking out the EGR6 gene is shown in SEQ ID NO: 12; The upstream and downstream homology arms include: The nucleic acid sequence of the upstream homology arm of the EGR4 gene is shown in SEQ ID NO: 2; The nucleic acid sequence of the downstream homology arm of the EGR4 gene is shown in SEQ ID NO: 3; The nucleic acid sequence of the upstream homology arm of the EGR5 gene is shown in SEQ ID NO:5; The nucleic acid sequence of the downstream homology arm of the EGR5 gene is shown in SEQ ID NO:6; The nucleic acid sequence of the upstream homology arm of the EGR6 gene is shown in SEQ ID NO:8; The nucleic acid sequence of the downstream homology arm of the EGR6 gene is shown in SEQ ID NO:

9.

6. A reagent for constructing a cholesteryl-5,7,24-triene-3β-ol producing strain, characterized in that: Including gRNA and upstream and downstream homology arm donor fragments of each gene; The gRNA comprises: The nucleic acid sequence of the gRNA for knocking out the EGR4 gene is shown in SEQ ID NO: 10; The nucleic acid sequence of the gRNA for knocking out the EGR5 gene is shown in SEQ ID NO: 11; The nucleic acid sequence of the gRNA for knocking out the EGR6 gene is shown in SEQ ID NO: 12; The upstream and downstream homology arms include: The nucleic acid sequence of the upstream homology arm of the EGR4 gene is shown in SEQ ID NO: 2; The nucleic acid sequence of the downstream homology arm of the EGR4 gene is shown in SEQ ID NO: 3; The nucleic acid sequence of the upstream homology arm of the EGR5 gene is shown in SEQ ID NO:5; The nucleic acid sequence of the downstream homology arm of the EGR5 gene is shown in SEQ ID NO:6; The nucleic acid sequence of the upstream homology arm of the EGR6 gene is shown in SEQ ID NO:8; The nucleic acid sequence of the downstream homology arm of the EGR6 gene is shown in SEQ ID NO:

9.

7. The reagent according to claim 6, characterized in that Also included are Cas plasmid, PEG3350, salmon sperm, and lithium acetate; Alternatively, the reagent further comprises: The nucleic acid sequences of two primers for constructing the N20 sequence of the gRNA target site of the ERG4 gene are shown in SEQ ID NOs: 13-14; The nucleic acid sequences of two primers for constructing the N20 sequence of the gRNA target site of the ERG5 gene are shown in SEQ ID NOs: 15-16; The nucleic acid sequences of two primers for constructing the N20 sequence of the gRNA target site of the ERG6 gene are shown in SEQ ID NOs: 17-18; The nucleic acid sequences of the two primers for amplifying the upstream homology arms of the EGR4 gene are shown in SEQ ID NOs: 19-20; The nucleic acid sequences of the two primers for amplifying the downstream homology arms of the EGR4 gene are shown in SEQ ID NOs: 21-22; The nucleic acid sequences of the two primers for amplifying the upstream homology arms of the EGR5 gene are shown in SEQ ID NOs: 23-24; The nucleic acid sequences of the two primers for amplifying the downstream homology arms of the EGR5 gene are shown in SEQ ID NOs: 25-26; The nucleic acid sequences of the two primers for amplifying the upstream homology arms of the EGR6 gene are shown in SEQ ID NOs: 27-28; The nucleic acid sequences of the two primers for amplifying the downstream homology arms of the EGR6 gene are shown in SEQ ID NOs: 29-30.

8. A method for preparing cholesta-5,7,24-triene-3β-ol, comprising culturing the strain according to any one of claims 1 to 3 to obtain a product containing cholesta-5,7,24-triene-3β-ol.

9. The method according to claim 8, characterized in that The culture substrate is 20 g / L YE medium; Feed 1 contained 30% glucose, 30% molasses, 0.24 g / L copper sulfate, and water; Feed 2 was 150 g / L diammonium phosphate solution; Feed three is ammonia water.

10. The method according to claim 8, characterized in that The culture conditions include: During the fermentation process, alcohol content is less than 0.2%, RQ value is 1.1~1.15; after wet weight is greater than 40g / L, dissolved oxygen is more than 20%; the amount of P flow added is 1 / 17.6~1 / 10 of the amount of C source flow added.

Images