A microbial agent and fertilizer and their use in preventing and controlling apple continuous cropping disorders

Abstract

The present invention relates to the field of agricultural microbial technology, and in particular to a microbial agent and compound microbial fertilizer comprising Paenibacillus eihime KF-B6 and applications thereof. The KF-B6 Paenibacillus eihime and its microbial agent and compound microbial fertilizer provided by the present invention can promote the formation of soil aggregates, increase soil organic matter, increase soil enzyme activity, effectively improve the soil, and increase the proportion of soil bacteria and fungi. Therefore, it can be applied to the prevention and control of apple continuous cropping disorders to ensure the survival rate of planted apple seedling rootstocks and replanted saplings in orchards. The application of KF-B6 compound microbial fertilizer and agent can increase the survival rate of M9 T337 rootstock seedlings planted in continuous cropping soil, with the survival rate reaching up to 96.67%, and the root system of the seedlings is highly active and grows well. The survival rate of the Daphne Red apple seedlings replanted in old orchards with continuous cropping disorders is as high as 94.00%, achieving the effect of effectively preventing and controlling apple continuous cropping disorders.

Description

Technical Field

[0001] The present invention relates to the field of agricultural microbial technology, and in particular to a composite functional bacterium strain Paenibacillus eihime KF-B6 that has the functions of soil improvement, multi-mechanism efficient biocontrol, and decomposition of macromolecular organic matter for nutrient conversion, as well as a microbial agent and composite microbial fertilizer thereof and applications thereof, in particular, applications in preventing and controlling apple continuous cropping disorders. Background Art

[0002] With the impact of the overall restructuring of the apple industry, the rise of new apple varieties such as Ruixianghong, Ruiyang, and Ruixue has driven a new round of development in the industry. Therefore, replacing old orchards with new varieties has become a new opportunity. Most orchards in my country's major apple-producing regions, particularly in Shandong, Shaanxi, and Gansu, are over 30 years old. However, due to limited land resources, the renovation and renewal of aging orchards can only be achieved through continuous cropping. This can lead to abnormal root development, stunted growth, weak growth, reduced resistance, shortened lifespan, and even death in replanted apple trees. This phenomenon is known as apple continuous cropping disorder, also known as apple replant disease.

[0003] Many factors contribute to apple continuous cropping problems, primarily the deterioration of soil physical and chemical properties, the destruction of soil aggregate structure, soil compaction, and poor air permeability, which affect the root growth of newly planted saplings; an imbalance in soil microbial flora, a decrease in the number of beneficial bacteria, limited decomposition of soil organic matter, and low soil organic matter content; and an increase in the number of pathogenic fungi in the soil, particularly Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme. These pathogens infect the roots of young apple seedlings, causing diseases such as stem rot and rot, resulting in a low survival rate for newly planted saplings when new varieties are replaced. Therefore, the apple industry urgently needs to address the low survival rate and weak growth of young apple trees in the renovation of older orchards, as well as the serious problems of apple continuous cropping problems.

[0004] Chinese patent CN202011124878.8 discloses a strain of Bacillus amyloliquefaciens and its use in preventing and controlling apple cropping problems. This strain has inhibitory effects on various pathogens, particularly Fusarium oxysporum, Fusarium verticillioides, Fusarium solani, and Fusarium solani, which cause apple cropping problems. This strain also promotes the growth of both aboveground and underground parts of apple seedlings that have been cropped continuously; increases the bacterial content in the soil and the bacterial-fungal ratio; and enhances the activity of urease, phosphatase, sucrase, and catalase in soil that has been cropped continuously, making it useful for preventing and controlling apple cropping problems. Chinese patent CN202310488273.4 discloses a strain of Paenibacillus polymyxa GRY-11, which has antagonistic effects on Fusarium oxysporum, Fusarium moniliforme, Fusarium solani, and Fusarium solani, which cause apple continuous cropping problems. The strain can increase the number of soil bacteria, reduce the number of pathogens, and promote plant growth; increase the activity of soil enzymes in apple continuous cropping soil and the protective enzyme activity of apple seedling roots; reduce the content of phenolic acid substances in the soil; and effectively alleviate apple continuous cropping problems.

[0005] The above patent mainly prevents and controls the problem of apple continuous cropping by producing water-soluble antibacterial substances to antagonize the growth of pathogenic fungi, increase the bacterial content in the soil, degrade phenolic acid autotoxic substances and increase the activity of soil enzymes. The antibacterial mechanism and antibacterial performance are limited, and it cannot achieve the effect of improving the soil by increasing the stability of soil structure, increasing the organic matter content, etc.

[0006] Functional strains only produce water-soluble antibacterial substances to inhibit the growth of pathogens. Generally, the inhibition rate is low and the effect is unstable. Therefore, it is a guarantee of preventive effectiveness that the strains have multiple antibacterial mechanisms.

[0007] Soil with stable structure, looseness, good air permeability and water retention, and high organic matter and humus content is not only conducive to the reproduction of beneficial microorganisms but also promotes root growth. Therefore, it is crucial to focus on improving the soil in the orchard while preventing and controlling apple continuous cropping problems and pathogenic fungi.

[0008] It's widely recognized that microorganisms producing exopolysaccharides (EPS) can improve soil, regulate plant growth, and induce plant stress resistance. Therefore, obtaining strains that produce high EPS is an effective approach to soil improvement. However, current challenges exist: EPS production from common strains is low, or production takes a long time, resulting in slow formation of water-stable aggregates in the soil and unstable structures. Therefore, obtaining strains that not only produce high EPS but also rapidly would greatly enhance soil improvement effectiveness.

[0009] In summary, there is an urgent need to screen out functional strains and microbial agents that are comprehensive and effective in preventing and controlling apple continuous cropping problems. Chinese patent CN202011579100.6 discloses an antimicrobial peptide-producing Paenibacillus eihime HD and its application. The antimicrobial peptide produced by the fermentation method of the present invention has good stability and a broad antimicrobial spectrum. The resulting product is used in biological control fields such as food preservation and antibiotic-free livestock and poultry farming. Chinese patent CN201810202641.3 discloses a bacteriocin-producing Paenibacillus eihime strain NPUST-1, which can promote the growth and immune response of aquaculture organisms.

[0010] The aforementioned inventions all demonstrate that Paenibacillus eihime possesses strong antibacterial properties and can produce antimicrobial substances such as antimicrobial peptides and bacteriocins. However, most existing technologies focus on aquaculture or livestock farming, and the disclosed strains have limited functionality. They lack the ability to produce high levels of EPS, volatile antimicrobial substances, or chitinase to degrade pathogenic fungal hyphae. Furthermore, they lack nutrient conversion functions such as the decomposition of macromolecular organic matter such as cellulose, protein, and starch, or nitrogen fixation and growth promotion. Furthermore, these technologies do not involve the agricultural sector. Consequently, there are currently no reports of Paenibacillus eihime being used to prevent and control apple cropping problems. Summary of the Invention

[0011] Therefore, the technical problem to be solved by the present invention is to overcome the defects of the existing technology in that the agricultural functional bacteria are limited in function, cannot efficiently inhibit fungal diseases through multiple mechanisms, cannot simultaneously produce high EPS to increase soil water stability aggregates to effectively improve the soil, increase soil organic matter, and do not have nutrient conversion and growth promotion. The present invention thus provides a strain of Bacillus Ehime with soil improvement, multi-mechanism efficient biocontrol, growth promotion and nutrient conversion functions, and its microbial agent and compound microbial fertilizer for use in preventing and controlling apple continuous cropping disorders.

[0012] To achieve the above object, the present invention provides the following technical solutions:

[0013] One of the technical solutions provided by the present invention is a Paenibacillus eihime, wherein the Paenibacillus eihime is specifically Paenibacillus eihime ( Paenibacillus ehimensis )KF-B6, the deposit number is CGMCC No.32131.

[0014] The present invention provides the Ehime Bacillus ( Paenibacillus ehimensis ) KF-B6, deposited at the Center for General Microbiology, China Culture Collection Administration on September 30, 2024. Address of the depository: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0015] The second technical solution provided by the present invention is a method comprising Paenibacillus eihime ( Paenibacillus ehimensis ) KF-B6 bacterial agent;

[0016] Furthermore, the preparation method of the bacterial agent is as follows: a spore suspension of Paenibacillus eihime KF-B6 is inoculated into an EPS-producing fermentation medium, and cultured until the fermentation liquid is viscous and more than 95% of the spores are detected by microscopy, thereby obtaining a KF-B6 fermentation liquid containing EPS; and any one or more of a synergist, an osmotic salt system stabilizer, an antifreeze agent, an emulsifier, and a preservative are added to the fermentation liquid to obtain a bacterial agent containing Paenibacillus eihime KF-B6.

[0017] Furthermore, the specific preparation method is as follows:

[0018] (1) Preparation of spore suspension on slant: streak the activated KF-B6 on the slant of NA culture medium and culture until the spore rate under microscopic examination is greater than 95%. Elute the spores with sterile distilled water and bathe in 80℃ water for 5 min to obtain the spore suspension inoculant.

[0019] (2) EPS production liquid fermentation: The spore suspension was inoculated into the EPS production liquid medium A at a rate of 5-10% (v / v), and cultured until the fermentation liquid became viscous and more than 95% of the spores were observed under a microscope, thereby obtaining the EPS-containing KF-B6 fermentation liquid; further, the culture conditions were: 35-45°C constant temperature shaker at 150-200 rpm for 40-48 hours;

[0020] The liquid culture medium A is composed of: 15.0-25.0 g of sucrose, 1.5-2.5 g of corn steep liquor powder, 1.5-2.5 g of CaCO3, 0.5-1.5 g of K2HPO4·3H2O, 0.25-0.75 g of MgSO4·7H2O, 0.25-0.75 g of MnSO4·H2O, 1 L of distilled water, and a pH of 7.0-7.3.

[0021] (3) Preparation of KF-B6 liquid microbial agent: Add 10-15% (w / v) mineral potassium humate (synergist), 3.0-4.5% (w / v) potassium dihydrogen phosphate (osmotic salt system stabilizer), 1.5-3.5% (w / v) seaweed liquid with pH 7.0 (synergist), 3.0-5.0% (w / v) ethylene glycol (antifreeze), 1.5-2.5% (w / v) OP-10 (emulsifier), and 0.05-0.1% (w / v) sodium dehydroacetate (preservative) to the KF-B6 fermentation broth containing EPS, and mix thoroughly to obtain the KF-B6 microbial agent.

[0022] Furthermore, the specific indicators of the KF-B6 liquid microbial agent are: KF-B6 effective viable bacteria count> 200 million / mL, extracellular polysaccharide> 3000 μg / mL, pH 5.0-7.0.

[0023] The third technical solution provided by the present invention is a method comprising Paenibacillus eihime ( Paenibacillus ehimensis ) KF-B6 compound microbial fertilizer;

[0024] Furthermore, the preparation method of the composite microbial fertilizer is as follows: inoculating Ehime Bacillus KF-B6 seed liquid into a fermentation medium, and culturing until the spore rate in the fermentation liquid is greater than 95% and the number of effective viable bacteria is greater than 600 million / mL to obtain a fermentation liquid; after the KF-B6 fermentation liquid is evenly mixed with a sterilized carrier, the mixture is spread thickly in a constant temperature culture room while being ventilated and cultured until the moisture content is less than 10%, thereby obtaining a KF-B6 composite microbial fertilizer;

[0025] Furthermore, the specific preparation method is as follows:

[0026] (1) Preparation of spore suspension on slant: streak the activated KF-B6 on the slant of NA culture medium and culture until the spore rate under microscopic examination is greater than 95%. Elute the spores with sterile distilled water and bathe in 80℃ water for 5 min to obtain the spore suspension inoculant.

[0027] (2) Seed liquid culture: Inoculate the slant spore suspension into liquid culture medium B at a 5-10% (v / v) inoculation rate, and culture at 35-45°C and 150-200 rpm for 16-20 h to obtain seed liquid;

[0028] The liquid culture medium B is composed of: yeast extract powder 4.0-6.0g, soybean meal powder 4.0-6.0g, K2HPO4·3H2O 0.50-1.50g, MnSO4 . H2O 0.25-0.75g, NaCl 0.5-1.0g, MgSO4 . 7H2O 0.3-0.5g, KCl 0.15-0.35g, distilled water 1L, natural pH.

[0029] (3) Fermentation culture: The seed liquid is inoculated into liquid culture medium C at a 5-10% (v / v) inoculation rate to obtain a fermentation broth with a spore rate >95% and a bacterial viability >600 million / mL; further, the culture conditions are: constant temperature culture at 35-45°C and 150-200 rpm for 24-32 hours;

[0030] The liquid culture medium C is composed of: yeast extract powder 4.0-6.0g, soybean meal powder 4.0-6.0g, K2HPO4·3H2O 0.50-1.50g, MnSO4 . H2O 0.25-0.75g, NaCl 0.5-1.0g, MgSO4 . 7H2O 0.3-0.5g, KCl 0.15-0.35g, sucrose 1.0-2.5g, CaCO3 1.5-3.5g, distilled water 1L, pH natural.

[0031] (4) Preparation of KF-B6 compound microbial fertilizer: After the fermentation liquid of KF-B6 is evenly mixed with the sterilized carrier in a volume-to-mass ratio of 1:2-1:3, it is spread in a 15cm-20cm thickness in a constant temperature culture room at 35-45℃ and cultured with ventilation for 5-7 days until the moisture content is below 10%, thereby obtaining KF-B6 compound microbial fertilizer.

[0032] Furthermore, the carrier is a mixture of vermiculite: mature cow dung compost: peat: humic acid in a weight ratio of 1:2:1:1;

[0033] Furthermore, the specific indicators of KF-B6 powdered compound microbial fertilizer are: organic matter > 40%, total nutrients (N+P2O5+K2O) of 8-10%, moisture < 10%, KF-B6 effective viable bacteria count > 300 million / g, pH 7.0-8.5.

[0034] A fourth technical solution provided by the present invention is the use of Paenibacillus erythrix KF-B6 described in the first technical solution, or the bacterial agent described in the second technical solution, or the compound fertilizer described in the third technical solution, particularly in the field of agricultural microbiology, and more particularly in preventing and controlling apple continuous cropping problems.

[0035] Furthermore, the microbial agent described in the second technical solution is used for root soaking of seedlings before planting; furthermore, the roots of seedlings are soaked in a 50-150 times diluted solution of KF-B6 liquid microbial agent for 30-60 minutes before planting;

[0036] Furthermore, after covering the soil during planting, the roots are irrigated with a 150-350 times diluted solution of the bacterial agent described in the second technical solution;

[0037] Furthermore, during the growing season from May to June, the roots are irrigated once with a 150-350 times diluted solution of the bacterial agent described in the second technical solution;

[0038] Furthermore, during land preparation, the compound microbial fertilizer described in the third technical solution is spread on the soil at a rate of 300-450 kg / mu;

[0039] Furthermore, the compound microbial fertilizer described in the third technical solution is spread in the planting ditch at a rate of 400-600 kg / mu;

[0040] Furthermore, when planting, 15-25% of the compound microbial fertilizer described in the third technical solution and 15-25% of soil are added to a 50-150 times diluted solution of the bacterial agent described in the second technical solution to form a slurry, the roots of the seedlings are dipped in the slurry, and then the seedlings are planted in the pit;

[0041] Furthermore, during autumn fertilization, 1.5-3.5 kg of the compound microbial fertilizer described in the third technical solution is applied to each tree.

[0042] Preferably, the method of use is as follows:

[0043] (1) Excavation of planting trenches

[0044] ① Deep plowing and land preparation: After the fruit is harvested in autumn, old trees are dug out and residual roots and diseased roots are picked out. When plowing the land, KF-B6 powdered compound microbial fertilizer is applied to the test plot at a rate of 300 kg / mu.

[0045] ② Dig planting trenches;

[0046] ③ Backfilling of planting trenches in spring: spread 500kg of KF-B6 compound microbial fertilizer per mu in the planting trenches, mix it with the backfill soil and backfill;

[0047] (2) Treatment of seedlings before planting

[0048] For seedlings that have not lost water after planting, soak their roots in a 100-fold diluted solution of KF-B6 liquid microbial agent for 30 minutes;

[0049] (3) Planting trees

[0050] ① When planting, apply 2kg of KF-B6 compound microbial fertilizer to each planting pit and mix it evenly with the soil; when planting, add 20% (w / v) of KF-B6 powdered compound microbial fertilizer and 20% (w / v) soil to a 100-fold diluted solution of KF-B6 liquid microbial agent to make a slurry, dip the roots of the seedlings in the slurry, and then plant the seedlings in the dug pits.

[0051] ② Covering with soil

[0052] After covering the soil, use 300 times diluted solution of KF-B6 liquid microbial agent for root irrigation treatment;

[0053] (4) Management after planting

[0054] ①Growing season, May to June: Use KF-B6 liquid microbial agent diluted 300 times to irrigate the roots once;

[0055] ② Autumn fertilization: 2kg KF-B6 powdered compound microbial fertilizer + 0.5kg commercially available trace elements in Mumei soil per tree.

[0056] Beneficial effects:

[0057] 1. The Paenibacillus eihime KF-B6 provided by the present invention has the performance of rapid and high EPS production, increases soil water-stable aggregates and reduces soil bulk density, thereby improving soil stability and structure, achieving soil improvement effects. It produces water-soluble and volatile antibacterial substances and high-yield chitinase to directly degrade chitin in fungal cell walls, causing mycelium to become coarse, shrunken, deformed, broken, hollow, or even completely degraded, inactivating pathogens. Multiple biocontrol mechanisms ensure comprehensive biocontrol effects. This bacterium also has the functions of decomposing cellulose, protein, starch, fat, and other nutrient conversion functions and promoting growth, making it a multifunctional strain. The application of this fungus, its microbial agent and compound microbial fertilizer can effectively increase the number of rhizosphere soil bacteria, reduce the number of pathogenic fungi, increase the ratio of bacteria and fungi, and promote the recovery of the soil microbial ecosystem in apple orchards with continuous cropping problems; increase the proportion of water-stable aggregates, increase the soil organic matter content and increase the soil enzyme activity, and improve the soil; improve the survival rate of planted young trees in the process of updating new varieties in old orchards with continuous cropping problems, promote plant root vitality and plant growth, and comprehensively alleviate and prevent apple continuous cropping problems, meeting the needs of the agricultural industry, especially the apple industry.

[0058] (1) The Paenibacillus erythrocephalus KF-B6 provided by the present invention is a highly safe strain that can rapidly produce exopolysaccharides (EPS). It can start producing EPS within 6 hours, and the viscosity of the fermentation liquid increases significantly after 16 hours, with the yield reaching 978.41 μg / mL. The maximum yield of 4307.39 μg / mL can be reached after 24 hours. The yield remains stable after 24 hours. It is currently the fastest and highest-yielding strain reported to produce EPS.

[0059] Experimental results using EPS-containing fermentation solutions in sandy loam soil showed that after 10 days of incubation, the proportion of water-stable aggregates (>0.25 mm) in the sandy loam soil inoculated with the EPS-containing KF-B6 fermentation solution reached 21.38%, 5.4 times that of the sterile water-treated soil. After 20 days of incubation, the proportion of water-stable aggregates reached a maximum of 32.97%, 6.6 times that of the sterile water-treated soil. The proportion of water-stable aggregates after 30 days of incubation was similar to that after 20 days, and the aggregate size remained stable between 0.25 and 3 mm. This indicates that KF-B6 and the EPS it produces can rapidly promote the formation of water-stable aggregates in the soil and maintain their stability.

[0060] (2) Paenibacillus erythrorhizium KF-B6 produces water-soluble antibacterial substances that inhibit the growth of pathogens. The antibacterial rates against the pathogenic fungi Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme that cause apple cropping problems are as high as 82.66%, 83.81%, and 78.49% respectively. At the same time, KF-B6 also produces volatile antibacterial substances, and the antibacterial rates against the above three pathogens are 91.11%, 87.78%, and 86.67% respectively. The antibacterial effect is extremely significant.

[0061] Paenibacillus erythrorhizium KF-B6 is a broad-spectrum biocontrol strain that has a good antagonistic effect against other apple disease pathogens such as Alternaria alternata (apple tree rot), Alternaria spp. (apple leaf spot disease), Botrytis cinerea (apple ring rot), as well as pathogens of vegetables and field crops such as Alternaria solani (tomato early blight), Pyricularia oryzae (rice blast), and Helminthosporium maxima (corn leaf spot disease), with an inhibition rate of 59.84%-82.54%.

[0062] (3) Paenibacillus erythrocytes KF-B6 produced chitinase, which had a strong decomposition effect on the hyphae of the three pathogens, causing the cell walls to be degraded, resulting in hyphae breakage, hollowing, and overflowing. It was even destructive to the spores of the pathogens, reducing or even losing their activity. Among them, KF-B6 had the strongest decomposition effect on the hyphae of Fusarium oxysporum, and could completely inactivate the hyphae of the pathogen at temperatures of 30℃ and 35℃. Compared with CK, KF-B6 could reduce the activity of Fusarium solani by 200-20,000 times and the activity of Fusarium moniliforme by 1,300-12,000 times. This shows that KF-B6 not only inhibits the growth of the main pathogens of apple continuous cropping problems, Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme, but also can inactivate their hyphae and even spores, making them partially or completely inactive, with a significant biocontrol effect.

[0063] Paenibacillus eihime KF-B6 is a high-chitinase producer, producing 11.51-13.54 U / mL of chitinase in the absence of exogenous chitin or pathogen hyphae. Both exogenous chitin and pathogen hyphae can induce higher chitinase activity in this strain. KF-B6 produced high levels of chitinase when degrading hyphae from various pathogens, with the enzyme activity reaching as high as 17.88 U / mL when degrading Fusarium oxysporum, demonstrating its potential for strong biocontrol effectiveness.

[0064] (4) Paenibacillus erythrocytes KF-B6 has the ability to decompose macromolecular organic matter and transform it into small-molecule organic nutrients such as sugars, amino acids, peptides, and fatty acids. This balances the quantity and type of small-molecule organic nutrients in the soil, facilitates plant absorption and utilization, and promotes crop growth. At the same time, the bacterium has a certain nitrogen fixation ability and growth-promoting ability such as producing IAA, which can increase the supply of nitrogen nutrients to plants and promote plant growth.

[0065] 2. The KF-B6 Paenibacillus erythrix and its microbial agent and composite microbial fertilizer provided by the present invention can promote the formation of soil aggregates, increase soil organic matter, enhance soil enzyme activity, effectively improve soil, and increase the proportion of soil bacteria and fungi; ensure the survival rate of planted apple seedling rootstocks and planted saplings in orchard reconstruction, and effectively prevent and control apple continuous cropping problems, as follows:

[0066] (1) The application of KF-B6 microbial agent and compound microbial fertilizer can increase the activities of soil neutral phosphatase, soil urease, soil sucrase and soil catalase, which are 1.63 times, 1.44 times, 3.81 times and 2.53 times of the continuous crop soil treatment CK, respectively. This indirectly reflects that KF-B6 bacteria and its microbial agent and compound microbial fertilizer can improve the soil, increase the conversion intensity of soil carbon, nitrogen and phosphorus, promote the metabolic activity of soil microorganisms and increase soil vitality.

[0067] (2) After applying KF-B6 microbial agent and compound microbial fertilizer, KF-B6 bacteria can effectively colonize rhizosphere soil and plant roots, promoting the increase of soil bacteria and actinomycetes. The number of bacteria increased by 8.01 times, the number of actinomycetes increased by 5.00 times, and the number of fungi decreased by 81.56%. The ratio of bacteria and fungi was increased, which was beneficial to the reconstruction of the soil microbial ecosystem in apple orchards with continuous cropping problems and transformed towards promoting plant growth.

[0068] (3) KF-B6 microbial agent and compound microbial fertilizer increased soil organic matter content by 17.03 g / kg compared with the CK group, improving soil fertility; promoted the formation of water-stable aggregates, especially the proportion of large-size aggregates, of which >2 mm and 1-2 mm water-stable aggregates increased by 28.01% and 47.64% respectively compared with the CK group; compared with the CK group, the proportion of microaggregates (<0.25 mm) decreased by 48.60%, and the soil bulk density decreased by 6.87%. This indicates that KF-B6 bacteria and its agent not only increased soil organic matter, but also promoted the formation of water-stable aggregates, reduced soil bulk density, increased soil structural stability and air permeability, and achieved the effect of improving soil.

[0069] (4) The application of KF-B6 compound microbial fertilizer and inoculant increased the survival rate of M9 T337 rootstock seedlings planted in continuous cropping soil, with the highest survival rate reaching 96.67%. The seedlings also had high root vitality and good growth. The survival rate of Daphne Red apple seedlings planted in old orchards with continuous cropping problems reached 94.00%, achieving the effect of effectively preventing and controlling apple continuous cropping problems. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 The antibacterial effect of KF-B6 on three pathogenic fungi that cause apple continuous cropping problems.

[0071] Figure 2 This is the colony morphology of KF-B6.

[0072] Figure 3 KF-B6 bacteria and spores.

[0073] Figure 4 The KF-B6 hemolytic test was negative.

[0074] Figure 5 Normal hyphae and spores of three pathogens and those degraded by KF-B6 (35℃).

[0075] Figure 6 This is the chitin-degrading transparent circle of KF-B6.

[0076] Figure 7 Chitinization effect of KF-B6 in shake flask (35℃).

[0077] Figure 8 It is the antibacterial ability of KF-B6 volatile antibacterial substances against pathogens.

[0078] Figure 9 The antibacterial effect of KF-B6 on different pathogens.

[0079] Figure 10 is the glucose standard curve.

[0080] Figure 11 EPS produced for KF-B6

[0081] Among them, A is the EPS precipitated by 95% anhydrous ethanol, and B is the EPS-containing bacterial liquid produced by KF-B6.

[0082] Figure 12 It is the function of KF-B6 bacteria to decompose and transform macromolecular nutrients.

[0083] Figure 13 Nitrogen fixation by KF-B6 bacteria

[0084] Among them, left: Ashby's medium, right: silicate bacterial medium.

[0085] Figure 14 KF-B6 promotes the formation of water-stable aggregates in soil.

[0086] Figure 15 Effects of KF-B6 compound microbial fertilizer and bacterial agent treatment on soil enzyme activities in continuous apple cropping. DETAILED DESCRIPTION

[0087] The following examples are provided for a better understanding of the present invention and are not intended to limit the best mode of implementation. They do not limit the content and scope of protection of the present invention. Any product identical or similar to the present invention obtained by anyone under the guidance of the present invention or by combining the features of the present invention with other prior arts shall fall within the scope of protection of the present invention.

[0088] If specific experimental steps or conditions are not specified in the examples, the procedures or conditions of conventional experimental steps described in the literature in the field can be followed. All raw materials and instruments used are commercially available, including but not limited to those used in the examples of this application.

[0089] Some of the culture media involved in the embodiments of the present invention are as follows:

[0090] The composition of liquid culture medium A for EPS production is: sucrose 20 g, corn steep liquor powder 2 g, CaCO3 2 g, K2HPO4·3H2O 1 g, MgSO4·7H2O 0.5 g, MnSO4·H2O 0.5 g, distilled water 1 L, pH 7.25.

[0091] Liquid culture medium B consists of: yeast extract powder 5g, soybean meal powder 5g, K2HPO4·3H2O 1g, MnSO4 . H2O 0.5g, NaCl 0.6g, MgSO4 . 7H2O 0.4g, KCl 0.2g, distilled water 1L, pH natural.

[0092] Liquid culture medium C consists of: yeast extract powder 5g, soybean meal powder 5g, K2HPO4·3H2O 1g, MnSO4 . H2O 0.5g, NaCl 0.6g, MgSO4 . 7H2O 0.4g, KCl 0.2g, sucrose 1g, CaCO3 2g, distilled water 1L, pH natural.

[0093] The composition of NA medium is: peptone 10.0 g, beef powder 3.0 g, NaCl 5.0 g, distilled water 1 L, pH 7.0-7.2.

[0094] Gao's medium No. 1 is composed of: soluble starch 20g, NaCl 0.5g, KNO31g, K2HPO4 . 3H2O 0.5g, MgSO4 . 7H2O 0.5g, FeSO4 . 7H2O 0.01g, agar 20g, distilled water 1L, pH 7.2-7.4.

[0095] The present invention will be further explained below through specific examples.

[0096] Example 1 Screening of strains

[0097] 1. Primary screening: EPS-producing bacteria screening

[0098] Take a clean, dry 500 mL triangular flask, pour in 10.0 g of rhizosphere soil from healthy apple plants in a continuous cropping disorder orchard, add 100 mL of ddH2O to prepare a bacterial suspension, mix well, add a small amount of glass beads and shake, and serially dilute 10 2 , 10 3 , 10 4 , 10 5 , 100 μL of the above soil extracts were measured and evenly spread on Gao's No. 1 medium plates, with 3 replicates for each gradient, and cultured in a 37°C constant temperature incubator for 3-5 days. Single colonies were picked with sterilized bamboo sticks, and strains with moist surfaces and high viscosity were selected. The strains with EPS production were initially screened and numbered KF-B2, KF-B3, KF-B6, and KF-B10 (see Table 1). They were purified and stored in glycerol tubes.

[0099] Table 1 Different strains producing EPS

[0100]

[0101] Note: The more + the longer the wire drawing, the higher the viscosity

[0102] 2. Rescreening: Bacteria that produce EPS and have antibacterial effects on apple continuous cropping pathogens

[0103] The plate confrontation method was used to determine the antagonistic effects of the four strains KF-B2, KF-B3, KF-B6, and KF-B10 obtained in the initial screening on the main pathogens of apple continuous cropping problems, Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme. The preserved strains were cultured on NA medium at 37°C for 48 hours for activation. 5mm diameter bacterial cakes of the three pathogens were inoculated on the center of the circle of the NA medium plate, and three points 25mm away from the center of the circle were inoculated with functional bacteria as the treatment group; the plate inoculated with only pathogenic bacteria cakes but not functional bacteria was used as the control group and cultured at 28°C for 7 days (the results are shown in the table). Figure 1 The colony radius of the pathogens was measured to calculate the inhibition rate of each bacterium on the pathogens.

[0104] Inhibition rate = (control colony radius - treated colony radius) / control colony radius × 100%.

[0105] The three pathogenic bacteria used in this patent were isolated from apple orchards with continuous cropping problems and stored in the strain collection center of Mumei Tuli Ecological Agriculture Co., Ltd.

[0106] Table 2 Inhibitory rate of 4 strains against pathogens

[0107]

[0108] Note: The data in the table are mean ± standard error. The lowercase letters after the data indicate the difference between the two groups after Duncan's new multiple range test.P The differences were significant at the <0.05 level.

[0109] It was found that among the four strains, KF-B6 had a higher inhibition rate against the three pathogens than the other three functional strains, with inhibition rates ranging from 78.49% to 83.81%, and an antagonism coefficient of level I. This also indicates that the strain has a broad spectrum of antibacterial activity against the pathogens of apple continuous cropping disorder. Therefore, through primary and secondary screening, the KF-B6 strain was finally selected as having the ability to produce EPS and exhibit significant antibacterial activity against the main pathogens of apple continuous cropping disorder.

[0110] Example 2 Identification of KF-B6 strain

[0111] (1) Morphological identification

[0112] The KF-B6 strain was streaked onto Gao's No. 1 and NA media, respectively, and cultured at 45°C for 72 h to grow single colonies, and the morphological characteristics of the colonies were observed.

[0113] The results are as follows Figure 2 As shown in the figure, KF-B6 colonies on Gao's medium I exhibit distinct characteristics: a round, translucent colony with a patterned surface and strong adhesion to the medium, making it difficult to lift. Upon lifting, the colonies form strings, demonstrating high viscosity. Colonies on NA medium are round, with a moist surface and raised, viscous structures.

[0114] At the same time, the bacteria were gram-stained and the morphology was observed under a microscope. Figure 3 Gram staining results showed that KF-B6 was a Gram-positive bacterium with short rod-shaped bodies and spores.

[0115] (2) Physiological and biochemical identification

[0116] Physiological and biochemical identification was performed using the methods described in Bergey's Manual of Bacterial Identification (Second Edition) and the Manual of Identification of Common Bacterial Systems. The experiments were repeated three times. Physiological and biochemical parameters of strain KF-B6 were tested, and the results are shown in Table 3.

[0117] Table 3 Physiological and biochemical characteristics of KF-B6 strain

[0118]

[0119] Note: "+" represents a positive reaction or availability; "-" represents a negative reaction

[0120] (3) 16S rDNA sequence analysis and phylogenetic analysis

[0121] KF-B6 was inoculated into LB liquid culture medium and cultured with shaking at 45°C for 1 day until the culture medium became turbid. The bacterial liquid was added to a centrifuge tube (1.5 mL), and the genome was extracted strictly according to the process of the genome extraction kit. The extracted DNA genome was used as a template, and 27f / 1492r (27f: GAGTTTGATCCTGGCTCAG; 1492r: ACGGCTACCTTGTTACGACTT) were used as primers for PCR amplification of the 16s DNA (16s ribosomal DNA) sequence fragment. The PCR reaction conditions were: 94°C for 5 min, 94°C for 30 s, 55°C for 40 s, and 72°C for 1.5 min, 30 cycles, and a final extension at 72°C for 10 min.

[0122] After electrophoresis, the PCR product was recovered by gel excision (the gel excision and recovery steps strictly followed the protocol of the full-length gold gel recovery kit) and ligated into the pEASY T3 vector. Trans-Top1 competent cells were then transformed using heat shock. Blue-white spot screening was performed, and white spot colonies were selected and added to LB liquid medium containing Amp. Incubate at 37°C, 200 rpm for 8-12 hours. Positive clones were detected using M13F / M13R primers. The positive clones were sent to Beijing Liuhe BGI for sequencing. The obtained sequences were assembled and proofread, and then analyzed by blast analysis using the GeneBank database.

[0123] Results: The 16S rDNA sequence of KF-B6 was 1512 bp in length. The NCBI comparison results showed that the 16S rDNA sequence of KF-B6 was consistent with Paenibacillus ehimensis The similarity to GE17-1 (Sequence ID: KF030787.1) is as high as 99.20%.

[0124] Finally, the strain KF-B6 was identified as Paenibacillus eihime ( Paenibacillus ehimensis ).

[0125] On September 30, 2024, Paenibacillus eihime ( Paenibacillus ehimensis KF-B6 is deposited with the General Microbiology Center of the China Culture Collection Administration under the accession number CGMCC No. 32131. The address of the depository is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0126] The 16S rDNA sequence of KF-B6 is shown below:

[0127]

[0128] Example 3 Safety Experiment of Paenibacillus eihime KF-B6

[0129] Experimental method: The activated KF-B6 was inoculated onto the blood plate culture medium, and hemolysis-positive bacteria were used as a control. The culture was kept at 45℃ for 24-72 hours, and the hemolysis was observed.

[0130] Preparation method of blood plate culture medium: 18g peptone, 1g yeast powder, 5g NaCl, 15g agar, 1L distilled water, pH 7.2-7.4. Sterilize at 121℃ for 30min, add 5% sheep blood after the culture medium cools to 50℃, mix well and pour the culture medium onto the plate.

[0131] The results are as follows Figure 4 As shown in the figure, no hemolytic transparent zone appeared around the KF-B6 colony within 24-72 hours, while a hemolytic zone appeared around the hemolytic-positive bacteria within 24 hours, indicating that KF-B6 bacteria are not hemolytic, harmless to humans, livestock, etc., and have high application safety.

[0132] Example 4 Functional Study of Paenibacillus Ehime KF-B6

[0133] 1. Paenibacillus Ehime KF-B6 degrades the cell walls of pathogens, dissolves hyphae and spores, inactivates them, and reduces the number of pathogens

[0134] (1) Destructive effect on the mycelium and spores of the main pathogens of apple continuous cropping, Fusarium oxysporum, Fusarium solani and Fusarium moniliforme.

[0135] ① Preparation of seed solutions of three pathogenic bacteria: Activated Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme were inoculated into PDA liquid culture medium, respectively, and cultured at 30°C and 200 rpm for 18 h to obtain seed solutions of the three pathogenic bacteria.

[0136] ② Preparation of KF-B6 seed solution: Inoculate the activated KF-B6 into liquid culture medium B and culture at 40°C and 200 rpm for 18 h to obtain KF-B6 seed solution;

[0137] ③ Co-cultivation: The above two seed solutions were treated according to the table below (Table 4), inoculated into liquid culture medium C for co-cultivation, and cultured at 30℃ and 35℃ with shaking at 200 rpm for 40 h, respectively. The degradation of pathogen mycelium was examined microscopically, and the activity of pathogens in each treatment group and the control group was detected, and the reduction in pathogen activity was calculated (Table 5).

[0138] The preparation method of the PDA liquid culture medium is as follows: weigh 200 g of peeled potatoes and cut them into pieces of about 1 cm 3Put small pieces of celery into appropriate amount of distilled water and boil for 30 min. Then filter the juice with double-layer gauze. Add 20 g of glucose, heat and dissolve, and add water to 1000 mL. Pack separately and sterilize at 121℃ for 30 min.

[0139] Table 4 Co-culture method of KF-B6 and pathogens

[0140]

[0141] Microscopic examination results Figure 5 As shown, the details are as follows:

[0142] (1) The hyphae of the three pathogens in the CK group were thick and grew well ( Figure 5 , 35℃), compared with the CK group, the hyphae cell walls of the three pathogens in treatment I, treatment II, and treatment III began to be degraded 18 hours after co-culture with KF-B6. At 40 hours of culture, the hyphae of the three pathogens all showed signs of coarsening, deformity, breakage, and hollowness, indicating that KF-B6 produced chitinase to degrade the hyphae cell walls of the pathogens.

[0143] (2) Compared with treatments I, II, and III, the pathogen hyphae in treatments V, VI, and VII were broken and hollow, and were degraded faster and more thoroughly. At the same time, some pathogen spores also showed hollowness, indicating that KF-B6 and the chitinase it produced could not only degrade pathogen hyphae, but also destroy pathogen spores, reducing or even losing their activity ( Figure 5 ).

[0144] Table 5 shows the pathogen viability in each treatment group and the control group. As shown in Table 5, KF-B6 exhibited strong degradation activity against the hyphae of all three pathogens, partially or completely inactivating them at different temperatures and co-cultivation methods. KF-B6 showed the strongest degradation activity against Fusarium oxysporum hyphae, completely inactivating them at both 30 and 35°C. Compared with CK, KF-B6 reduced the activity of Fusarium solani by 200-20,000 times, and that of Fusarium moniliforme by 1,300-12,000 times. This suggests that KF-B6 not only inhibits the growth of Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme, the main pathogens of apple continuous cropping problems, but also degrades their hyphae and even spores, partially or completely inactivating them, resulting in significant biocontrol effectiveness.

[0145] Table 5 Pathogen activity in different treatments

[0146]

[0147] 2. Decomposition of chitin by Paenibacillus erythrocytes KF-B6 (qualitative detection)

[0148] (1) Chitin decomposition plate transparent zone method: Use a sterile bamboo stick to inoculate the activated KF-B6 bacteria on the chitin decomposition plate culture medium, and place it in a constant temperature incubator at 28℃, 37℃ and 45℃ for 48 hours. The results show the chitin decomposition transparent zone ( Figure 6 ).

[0149] The chitin culture medium is composed of: K2HPO4·3H2O 0.7g, MgSO4 . 7H2O 0.5g, ZnSO4 . 7H2O 0.001g, KH2PO4 0.5g, FeSO4 0.01g, 40mL colloidal chitin, add distilled water to 1L, and adjust the pH to 7.3-7.5 with 40% NaOH.

[0150] (2) Shake flask chitin decomposition method: Use a sterile bamboo stick to inoculate the activated KF-B6 bacteria into liquid culture medium B, and culture at 40℃ and 200rpm for 18 hours to obtain seed liquid; inoculate the seed liquid into chitin shake flask culture medium at a 1% inoculation rate, and culture at 30℃, 35℃, and 40℃, 200rpm for 40 hours; the chitin shake flask culture medium without seed liquid was used as a control, and the changes in the amount of chitin in the control and the chitin shake flask culture medium inoculated with KF-B6 were observed. As a result, the chitin particles in the shake flask inoculated with KF-B6 bacteria were completely decomposed ( Figure 7 , 35℃).

[0151] The chitin shake flask culture medium is composed of: peptone 10g, K2HPO4·3H2O 0.7g, MgSO4 . 7H2O0.5g, ZnSO4 . 7H2O 0.001g, KH2PO4 0.3g, 40mL colloidal chitin, pH adjusted to 7.3 with 40% NaOH.

[0152] Preparation of the colloidal chitin: Dissolve 5g of chitin in 200mL of 4°C precooled concentrated hydrochloric acid, stir on a magnetic stirrer for 2 hours, and let stand at 4°C for 24 hours. Add the chitin to 1000mL of 4°C precooled 95% ethanol, stir for 2 hours, and let stand at room temperature overnight. Discard the supernatant, centrifuge at 4000 rpm for 20 minutes, collect the white precipitate, and dissolve it in 100mL of distilled water to form a colloidal chitin solution with a 5% chitin content.

[0153] 3. Detection of chitinase activity produced by Paenibacillus erythrocyticus KF-B6

[0154] The fermentation broth of the KF-B6 CK group in Table 4, the mixed fermentation broth of different treatments I-VII of co-culture of KF-B6 and pathogens, and the fermentation broth of the chitin shake flask culture medium mentioned above were sterilized by filtration using a 0.22 μm microporous filter membrane to obtain a sterile filtrate. The sterile filtrate was added to a punched chitin-degrading plate and placed at 37°C for 24 h. As a result, a transparent zone of degraded chitin appeared in all the filtrates, indicating that the filtrates from different treatments contained chitinase.

[0155] The sterile filtrate of different test treatments was appropriately diluted, and the chitinase activity in the dilution was determined using the chitinase reagent kit of Shanghai Fenxi Biotechnology Co., Ltd. The chitinase activity of the original solution was obtained by multiplying the result by the dilution multiple. The chitinase standard curve is y=18.457x-1.1636 (where x is OD 450 , y is chitinase activity U / L), standard curve R 2 =0.9956, the linear relationship is good.

[0156] The results are shown in Table 6:

[0157] (1) The chitinase activity in the sterile filtrate of the KF-B6 CK group was 11.51-13.54 U / mL, indicating that Paenibacillus eihime KF-B6 can produce chitinase without the induction of exogenous chitin or pathogenic mycelium.

[0158] (2) The chitinase activity of the fermentation broth in the chitin shake flask culture medium was 13.71-17.40 U / mL, which was higher than that in the CK group, indicating that exogenous chitin induced KF-B6 to produce higher chitinase activity.

[0159] (3) The chitinase activity in the sterile filtrates of treatments I to VII was higher than that in the KF-B6 CK group, indicating that the pathogenic fungus hyphae became exogenous chitin, which could induce KB-B6 to produce more chitinase, and the enzyme activity was the highest during the degradation of Fusarium oxysporum, reaching 17.88 U / mL.

[0160] (4) KF-B6 is a strain that produces a high amount of chitinase and can effectively degrade the mycelium and spores of pathogens, rendering them partially or completely inactive. It has the potential to exert a strong biocontrol effect.

[0161] Table 6 Chitinase activity in different treatments

[0162]

[0163] 4. Detection of the antibacterial rate of volatile antibacterial substances of Paenibacillus erythrorhizium KF-B6 against the main pathogens of apple continuous cropping problems, Fusarium oxysporum, Fusarium solani and Fusarium moniliforme

[0164] The specific method is:

[0165] (1) Inoculation of bacteria on a plate: Inoculate the bacterial cakes of three pathogenic bacteria in the center of the PDA culture medium; use a sterilized bamboo stick to streak the KF-B6 bacteria on the NA culture medium.

[0166] (2) The antibacterial effect of KF-B6 volatile substances was measured by the plate-to-plate method: the NA culture medium inoculated with KF-B6 bacteria and the PDA plate inoculated with pathogens were placed on top of each other, and the plates were sealed with sealing film. This was the treatment group, with 3 replicates for each treatment. At the same time, an empty NA culture medium without KF-B6 bacteria and a PDA plate inoculated with pathogens were placed on top of each other as the control group. The plates were cultured at 30°C. When the pathogens in the control group filled the plates, the antibacterial effect of KF-B6 on the pathogens in the treatment group was observed, and the antibacterial rate was calculated.

[0167] Inhibition rate % = (9cm-diameter of pathogens in the treatment group) / 9cm×100%

[0168] The results are as follows Figure 8 As shown in Table 7, the volatile antibacterial substances produced by KF-B6 have an inhibition rate of 91.11%, 87.78% and 86.67% against three pathogens, namely Fusarium oxysporum, Fusarium solani and Fusarium moniliforme, respectively, and the antibacterial effect is extremely significant.

[0169] Table 7 Inhibition rate of KF-B6 volatile antibacterial substances against three pathogenic bacteria

[0170]

[0171] 5. Determination of the broad-spectrum antibacterial effect of Paenibacillus Ehime KF-B6

[0172] The antibacterial activity of KF-B6 against other fruit and vegetable disease pathogens was evaluated using a plate confrontation test (the method is the same as the multiple screening method).

[0173] The results are as follows Figure 9 As shown in Table 8, KF-B6 not only has a high antagonistic effect on the main pathogens of apple continuous cropping problems, but also has antagonistic effects on other apple disease pathogens, such as apple black rot (apple tree rot), Alternaria alternata (apple leaf spot disease), Botrytis cinerea (apple ring rot), Alternaria solani (tomato early blight), Pyricularia oryzae (rice blast), Helminthosporium maxima (corn leaf spot disease), and other vegetable and field crop pathogens ( Figure 9 ), the inhibition rates were 59.84%-82.54% (Table 8).

[0174] Table 8 Inhibition rate of KF-B6 against other pathogens

[0175]

[0176] 6. Ehime Paenibacillus KF-B6's ability to rapidly and efficiently produce EPS

[0177] (1) Bacteria activation

[0178] KF-B6 bacteria were inoculated onto the slant of NA culture medium using a sterile inoculating loop and cultured at 45°C for 72 h. Microscopic examination revealed that all the bacteria were spores.

[0179] (2) Inoculation and cultivation

[0180] Slant inoculation: Add 10 mL of sterile water to the slant of NA medium containing bacteria, scrape the spores into distilled water with a sterile inoculating loop to prepare an inoculum suspension, and inoculate it into EPS-producing liquid medium A at a 1% inoculum size. Take liquid medium A without KF-B6 bacteria as CK, and culture at 200 rpm and 45°C for 2 / 4 / 6 / 8 / 12 / 16 / 20 / 24 / 28 / 32 / 40 / 48 h. Repeat 3 times for each time period. Take out the shake flasks at different times and observe the viscosity. Store in a refrigerator at 4°C. After all time periods are completed, measure the EPS yield at the same time.

[0181] (3) EPS production detection method is as follows

[0182] ①Precipitation of crude polysaccharides

[0183] EPS was extracted from the fermentation broth using a low-temperature alcohol precipitation method. 10 mL of KF-B6 EPS fermentation broth from different incubation times was placed in a boiling water bath for 10 minutes to denature the protein. After cooling naturally, the broth was centrifuged at 10,000 rpm at 4°C for 15 minutes to remove the protein, and the supernatant was retained. 2.0 mL of the supernatant was added to 6 mL of anhydrous ethanol and subjected to low-temperature extraction at 4°C for 24 hours to fully precipitate the EPS. The supernatant of the precipitated EPS was centrifuged at 10,000 rpm at 4°C for 15 minutes, and the supernatant was removed, retaining the EPS precipitate. The centrifuge tube containing the EPS precipitate was dried in an oven at 50°C. The dried precipitate was dissolved in 20 mL of distilled water to prepare the test solution.

[0184] ② Make a standard curve

[0185] Prepare 100 mg / L (100 μg / mL) glucose standard solution. Take 0.2, 0.4, 0.6, 0.8, and 1.0 mL of the standard solution into 20 or 25 mL stoppered test tubes, respectively. Make up the volume less than 1 mL with water. Add 1.0 mL of 6% phenol and 5.0 mL of concentrated sulfuric acid to each tube. Let it stand for 10 minutes, vortex to mix, and place in a 30°C water bath for 20 minutes. Measure the optical density at 490 nm. Use 1.0 mL of water as a blank according to the same color development. The optical density value OD 490 The standard curve is drawn with the glucose content as the horizontal axis and the glucose content as the vertical axis ( Figure 10 ).

[0186] Table 9 Glucose standard curve

[0187]

[0188] ③ Sample content determination

[0189] The sample was diluted at different times according to its viscosity, and the optical density of the sample solutions at different dilution times was determined by the same color development method as above, and the polysaccharide content was calculated using the standard curve.

[0190] ④ Calculation method of extracellular polysaccharides

[0191]

[0192] Where:

[0193] m1 - the sugar content in the sample solution obtained from the standard curve, in micrograms (μg)

[0194] V1--sample fixed volume, in milliliters (mL)

[0195] V2--The volume transferred for colorimetric determination, in milliliters (mL)

[0196] V3--sample volume, in milliliters (mL)

[0197] 0.9 - Correction factor for converting glucose to dextran.

[0198] The calculation result is rounded to two decimal places.

[0199] (4) EPS production results at different cultivation times

[0200] The results are shown in Table 10. It can be seen that the fermentation broth of Paenibacillus Ehime KF-B6 has a slight viscosity when it is cultured for 6 hours. The EPS production is 21.80μg / mL after testing, indicating that EPS has been produced in 6 hours. Therefore, Paenibacillus Ehime KF-B6 is the fastest reported strain producing EPS. The viscosity of the fermentation broth increased after 12 hours of culture, and the viscosity increased significantly after 16 hours. The yield reached 978.41μg / mL, and the highest yield of 4307.39μg / mL was reached in 24 hours (Table 10). The yield remained stable after 24 hours. The EPS content in the fermentation broth is high, and the amount of EPS precipitated with anhydrous ethanol is large ( Figure 11 Medium A), and EPS has high viscosity ( Figure 11 B), indicating that it has a high molecular weight and good adhesion, which is conducive to promoting the formation of soil aggregates. Therefore, Paenibacillus eihime KF-B6 is the fastest-producing EPS strain reported so far, and its EPS yield is also at a relatively high level.

[0201] Table 10 EPS production of KF-B6 bacteria at different times

[0202]

[0203] 7. Nutritional conversion ability of Paenibacillus Ehime KF-B6 in decomposing macromolecular organic matter

[0204] (1) Determination of starch decomposition ability

[0205] The KF-B6 strain was activated and inoculated onto Gow's medium I using a sterile inoculation needle. The cells were cultured at 28 / 37 / 45 / 50°C for 72 h, respectively. The cells were stained with Lugol's iodine solution (the stock solution was diluted 25-fold), and the size of the clear zone around the colony of the KF-B6 strain was measured.

[0206] (2) Determination of protein decomposition ability

[0207] The KF-B6 strain was activated and inoculated onto the protein decomposition function test medium using a sterile inoculation needle. The culture was performed at 28 / 37 / 45 / 50℃ for 72h, and the size of the transparent zone around the colony of the strain KF-B6 was measured.

[0208] (3) Determination of cellulose decomposition ability

[0209] The KF-B6 strain was activated and inoculated onto the cellulolysis function test medium using a sterile inoculation needle. The culture was performed at 28 / 37 / 45 / 50°C for 72 h, and the size of the transparent zone around the colony of the strain KF-B6 was measured.

[0210] (4) Determination of fat decomposition ability

[0211] The KF-B6 strain was activated and inoculated onto the lipolytic function test medium using a sterile inoculation needle. The strain was cultured at 28 / 37 / 45 / 50°C for 72 h, and the size of the halo around the colony of the KF-B6 strain was measured.

[0212] (5) Determination of nitrogen fixation capacity

[0213] The KF-B6 strain was activated and streaked onto nitrogen-fixing medium (Ash-Bailey medium) and silicate bacterial culture medium using a sterile inoculation loop. The culture was cultured at 28 / 37 / 45 / 50°C for 72 hours, respectively. The growth of the bacteria was observed. If the bacteria reproduced quickly and grew well, it indicated that the bacteria had a strong nitrogen-fixing ability.

[0214] The method for preparing the protein decomposition function test medium comprises the following steps: weighing 2.0 g of casein, moistening it with 5 mL of 0.5 mol / L NaOH, adding 150 mL of distilled water, stirring in a boiling water bath until completely dissolved, replenishing the volume with distilled water to 800 mL, then adding 3.0 g of beef extract, 5.0 g of NaCl, and 0.1 g of CaCl2·2H2O, fully dissolving and mixing the mixture, adjusting the volume to 1 L with distilled water, adjusting the pH to natural, and adding 20.0 g of agar powder.

[0215] The fiber decomposition function test medium is composed of: 1.0 g sodium nitrate, 1.2 g Na2HPO4·12H2O, 0.9 g KH2PO4, 0.5 g MgSO4·7H2O, 0.5 g KCl, 0.5 g yeast extract powder, 0.5 g acid hydrolyzed casein, 0.2 g Congo red, 10 g sodium carboxymethyl cellulose, 1 L distilled water, pH 7.0±1, and 20 g agar powder.

[0216] The lipolytic function test medium is prepared by weighing 10.0 g of peptone, 5.0 g of NaCl, and 0.1 g of CaCl2·2H2O in 800 mL of distilled water, fully dissolving the mixture, adding 20.0 g of agar, adjusting the pH to 7.2, and adjusting the volume to 1 L. The mixture is sterilized at 121° C. for 30 minutes, cooled to 65° C., and 10 mL of Tween80, Tween60, or Tween40 sterilized separately at 121° C. for 30 minutes is added and mixed evenly.

[0217] The nitrogen-fixing medium (Ash-Bailey medium) is composed of: 10 g of mannitol, 0.2 g of KH2PO4, 0.2 g of NaCl, 0.2 g of MgSO4·7H2O, 0.1 g of CaSO4·7H2O, 5 g of CaCO3, 1 L of distilled water, pH 6.8-7.0, and 20 g of agar powder.

[0218] The silicate bacterial culture medium is composed of: 5 g of sucrose, 2 g of Na2HPO4·12H2O, 0.1 g of CaCO3, 0.5 g of MgSO4·7H2O, 1 mL of 0.5% FeCl3·6H2O solution, 1 L of distilled water, pH 7.0-7.2, and 20 g of agar powder.

[0219] Table 11 Nutritional transformation function of KF-B6 bacteria in decomposing macromolecular organic matter

[0220]

[0221] The results are as follows Figure 12 As shown in Table 11, it can be seen that KF-B6 bacteria have the ability to produce cellulase, amylase, protease, lipase and nitrogenase at different temperatures ( Figure 12 ), and its function is strongest in the medium and high temperature range of 37-45℃; it can be seen that the bacteria has the ability to decompose cellulose-rich organic matter such as crop straw and raw materials containing starch, protein and fat such as corn flour and soybean meal into disaccharides, monosaccharides and small peptides, amino acids, fatty acids and other small molecule organic nutrients, thereby balancing the small molecule organic nutrients in the soil, which is beneficial to plant absorption and utilization, and at the same time provides nutrition for other microorganisms and increases the microbial diversity in the soil.

[0222] At the same time, the bacteria can grow well in both Asu-Bai's medium and silicate bacterial medium, indicating that it has a strong nitrogen fixation ability ( Figure 13 , left: Ashby's medium, right: silicate bacterial medium), can increase the supply of nitrogen nutrition for plants.

[0223] 8. Determination of the growth-promoting properties of Paenibacillus Ehime KF-B6

[0224] (1) After KF-B6 bacteria were activated, they were inoculated into liquid culture medium B and cultured at 40°C and 200 rpm for 18 h to obtain seed solution;

[0225] (2) Inoculate the seed liquid into the IAA-producing fermentation medium at a 10% inoculation rate, and culture at a constant temperature of 40°C and 200 rpm for 24 hours to obtain the fermentation liquid.

[0226] The IAA production fermentation medium is composed of: 5.0 g yeast extract powder, 5.0 g soybean meal powder, 1.0 g K2HPO4▪3H2O, 0.5 g MnSO4▪H2O, 0.6 g NaCl, 0.4 g MgSO4▪7H2O, 0.2 g KCl, 1 g sucrose, 2 g CaCO3, 1 L distilled water, natural pH, and 200 mg / L of filter-sterilized L-tryptophan solution is added after sterilization.

[0227] (3) Determination of the ability to produce indoleacetic acid

[0228] ① Determination of IAA standard curve

[0229] Prepare IAA standard solutions with concentrations of 0, 20, 40, 60, 80, and 100 μg / mL, and mix them with Salkowski colorimetric solution at a volume ratio of 1:1. Place them in the dark at room temperature for 30 minutes, and then measure the OD of each concentration. 530 (A 1:1 mixture of distilled water and Salkowski colorimetric solution was used as a blank control). 530 Plot the IAA concentration as the horizontal axis and the IAA concentration as the vertical axis to obtain the IAA standard curve.

[0230] ② Determination of IAA concentration in bacterial solution

[0231] KF-B6 fermentation broth was centrifuged at 6000 rpm for 15 minutes, and then 4 mL of the supernatant was mixed with an equal volume of Salkowski colorimetric solution. The supernatant was placed in the dark at room temperature for 30 minutes to see if it turned red. If it turned red, it indicated that the bacteria had a certain ability to produce IAA, and its OD was further measured. 530 The value was obtained by comparing the IAA concentration with the OD 530The corresponding IAA concentration was calculated based on the standard relationship curve.

[0232] Finally, after culturing at 45°C for 24 hours, the IAA production of the strain was determined to be 26.84 μg / mL. Therefore, the strain has the potential to promote plant root and plant growth.

[0233] Example 5 Effect of Rapid and High-yielding EPS Paenibacillus Ehime KF-B6 on Soil Water Stability Aggregates

[0234] The test soil was sandy loam, passed through a 0.25 mm sieve, and sterilized at 121°C for 40 min. KF-B6 was cultured in liquid medium A to obtain a KF-B6 fermentation broth containing EPS (EPS content = 3500.65 μg / mL, bacterial activity = 550 million / mL). This fermentation broth was inoculated at a 5% (v / w) inoculum into 80.0 g of soil sample in a Petri dish. The soil sample inoculated with an equal volume of sterile water was designated CK1, and the soil sample inoculated with liquid medium A was designated CK2. Six replicates were used for each treatment. The Petri dishes were incubated in a 40°C incubator for 30 days, with sterile water added regularly to maintain relative moisture on the soil surface. The proportion of water-stable aggregates >0.25 mm was determined every 10 days using the wet sieving method (referring to NYT 1121.19-2008 Soil Testing Sections 19 and 20).

[0235] Results: As Figure 14 As shown in Table 12, the proportion of water-stable aggregates (>0.25 mm) in the KF-B6 fermentation liquid treatment group was significantly increased after 10 days of inoculation, reaching 21.38%, 5.4 times that of the CK1 sterile water treatment group, and the proportion of aggregates with a particle size greater than 3 mm was 9.45%. After 20 days of incubation, the proportion of water-stable aggregates >0.25 mm reached a maximum of 32.97%, 6.6 times that of the CK1 sterile water treatment group. The proportion of water-stable soil aggregates after 30 days of incubation was not much different from that after 20 days of incubation. The proportion of particles with a size greater than 3 mm gradually decreased, and the particle size became more stable between 0.25 and 3 mm, indicating that the soil structure tended to stabilize after 20 days. However, the proportion of water-stable aggregates in the CK2 group inoculated with liquid culture medium did not increase significantly compared with CK1 ( Figure 14 ), indicating that KF-B6 and the EPS it produces promote the formation of water-stable soil aggregates. Furthermore, the aggregate formation efficiency is high and the soil aggregates are highly stable. Therefore, KF-B6 has the function of highly efficient soil improvement.

[0236] Table 12 Effects of different treatments on the proportion of water-stable aggregates at each level (%)

[0237]

[0238] Example 6 Preparation of KF-B6 Paenibacillus Ehime Agent and Composite Microbial Fertilizer

[0239] 1. Preparation of KF-B6 liquid microbial agent

[0240] (1) Preparation of spore suspension on slant: streak the activated KF-B6 on the slant of NA culture medium with a sterile inoculation loop, culture at 45℃ for 3 days, and observe the spore rate under the microscope to be greater than 95%. Elute the spores with 10 mL of sterile distilled water into a sterilized and dried inoculation bottle, and incubate in an 80℃ water bath for 5 minutes to obtain a spore suspension inoculant.

[0241] (2) EPS-producing liquid fermentation: The spore suspension was inoculated into the EPS-producing liquid culture medium A at a 10% inoculation rate and cultured at 45°C in a constant temperature shaker at 200 rpm for 48 h. The fermentation liquid was viscous and more than 95% of the spores were detected by microscopic examination, thus obtaining the EPS-containing KF-B6 fermentation liquid.

[0242] (3) Preparation of KF-B6 liquid microbial agent: 15% (w / v) mineral potassium humate, 3.5% (w / v) potassium dihydrogen phosphate, 2% (w / v) seaweed liquid with pH 7.0, 3% (w / v) ethylene glycol, 1.5% (w / v) OP-10, and 0.05% (w / v) sodium dehydroacetate were added to the KF-B6 fermentation broth containing EPS and mixed thoroughly to obtain the KF-B6 liquid microbial agent.

[0243] In the above-mentioned KF-B6 liquid microbial agent: KF-B6 effective viable bacteria count is 550 million / mL, extracellular polysaccharide is 3500.65μg / mL, and pH is 6.0.

[0244] 2. Preparation of KF-B6 compound microbial fertilizer

[0245] (1) Preparation of slant spore suspension: The method is the same as that of KF-B6 liquid microbial agent.

[0246] (2) Inoculate the slant spore suspension into liquid culture medium B at a 10% inoculation rate and culture at 40°C and 200 rpm for 18 h.

[0247] (3) Inoculate the seed liquid into liquid culture medium C at a 10% inoculation rate and culture at 45°C and 200 rpm for 24 h to obtain fermentation liquid. The spore rate in the fermentation liquid is >95%, and the bacterial activity is >600 million / mL.

[0248] (4) Preparation of KF-B6 compound microbial fertilizer: After the fermentation liquid of KF-B6 and the sterilized carrier are mixed evenly in a volume-to-mass ratio of 1:2, the mixture is spread in a 15cm-20cm thickness in a constant temperature culture room at 45℃ and ventilated for 6 days until the moisture content is below 10%, thereby obtaining KF-B6 compound microbial fertilizer.

[0249] The carrier is a mixture of vermiculite, mature cow dung compost, peat, and humic acid in a weight ratio of 1:2:1:1.

[0250] The above-mentioned KF-B6 compound microbial fertilizer contains: organic matter 45.60%, total nutrients (N+P2O5+K2O) 9.26%, water 8.63%, KF-B6 effective viable bacteria count 380 million / g, and pH 7.5.

[0251] Example 7 Potted plant test

[0252] 1. Seedlings used in the experiment: Tissue culture seedlings that have been hardened in the seedling shed for 2 months and are ready for transplanting are M9 T337 rootstock seedlings with the same growth condition.

[0253] 2. Experimental soil: Soil was collected from a 30-year-old, continuously cropped orchard in Zhangjiayuan Town, Qianyang County, Baoji City, Shaanxi Province. Multiple random sampling points were taken from an area 80 cm from the tree trunk and 10-40 cm deep, and the soil was mixed evenly. The soil texture was sandy loam.

[0254] 3. Experimental Design

[0255] Control group (CK): soil CK from a continuous cropping orchard;

[0256] Treatment I (T1): continuous orchard soil + KF-6 compound microbial fertilizer (prepared in Example 6) 2.0 kg / pot, and 10% (v / v) KF-B6 liquid microbial agent (prepared in Example 6) was added to the water when planting in the pots;

[0257] Treatment II (T2): Soil from a continuously cropped orchard plus a carrier (2.0 kg / pot) consisting of a mixture of vermiculite, mature cow dung compost, peat, and humic acid in a weight ratio of 1:2:1:1.

[0258] Thirty pots were transplanted from the nursery into large pots. Each pot was watered regularly with 15 kg of soil from each of the above treatments. The greenhouse humidity was maintained at 65%-70%, with daytime temperatures of 23-26°C and nighttime temperatures of 15-18°C. The greenhouse was ventilated regularly.

[0259] 4. Index determination

[0260] (1) Investigate the tree survival rate and growth after half a year

[0261] The survival rate of seedlings in each treatment was calculated. Twenty leaves from the middle of the outer, normally developing branches of each plant were selected, for a total of 100 leaves per treatment, and the hundred-leaf weight was determined. Plant height, increase in stem circumference at 25 cm from the soil surface, and root activity were measured (methyl blue photoelectric colorimetry).

[0262] Results: As shown in Table 13, the growth and development of rootstock seedlings in both Treatments I (T1) and II (T2) were superior to those in the continuous cropping soil. T1, treated with KF-6 compound microbial fertilizer and microbial agent, exhibited the best growth and a survival rate of 96.67%. However, the survival rate of rootstock seedlings in the continuous cropping soil (CK) treatment was low, at only 63.33%. The trees also showed weak growth and low root activity. Table 13 shows that the increases in leaf weight, plant height, trunk circumference, and root activity in T1 increased by 23.77%, 16.87%, 18.46%, and 38.72%, respectively, compared to the control (CK). All indicators in the T2 treatment were lower than those in the T1 treatment, indicating that the KF-B6 bacteria still possessed resistance to continuous cropping.

[0263] Table 13 Effects of different treatments on the growth of M9 T337 rootstock seedlings

[0264]

[0265] (2) Effects of KF-B6 compound microbial fertilizer and microbial agent on rhizospheric soil enzyme activities of continuously cropped apple trees

[0266] Half a year later, fresh rhizosphere soil from plants in different treatment groups was collected using the five-point sampling method and mixed evenly. The activities of neutral phosphatase, urease, sucrase and catalase were measured according to the instructions of the soil neutral phosphatase, soil urease, soil sucrase and soil catalase test kits, with three replicates for each treatment.

[0267] The results are as follows Figure 15 As shown in the figure, it can be seen that the activities of soil neutral phosphatase, soil urease, soil sucrase and soil catalase in KF-B6 treatment I (T1) were 1.63 times, 1.44 times, 3.81 times and 2.53 times that of continuous cropping soil treatment CK, respectively. Therefore, the application of KF-B6 compound microbial fertilizer and bacterial agent can increase soil enzyme activity, reflecting that it can improve the conversion intensity of soil carbon, nitrogen and phosphorus and promote the metabolic activity of soil microorganisms.

[0268] (3) Detection of culturable soil microorganisms

[0269] Half a year later, the plate count method was used to determine the number of bacteria, fungi, actinomycetes and Fusarium pathogens in the soil. The soil samples were diluted and spread on LB medium, PDA medium and Gao's medium No. 1 to calculate the number of bacteria, fungi, actinomycetes and Fusarium pathogens in the soil.

[0270] Results: As shown in Table 14, after application of KF-6 compound microbial fertilizer and microbial agent, the fungal and bacterial content per gram of soil in Treatment I (T1) was 8.01 times that of the CK group, the actinomycete content was 5.00 times that of the CK group, and the fungal content was 81.56% lower than that of the CK group. Therefore, the application of KF-6 compound microbial fertilizer and microbial agent significantly increased the number of soil bacteria, reduced the fungal content, and increased the bacterial to fungal ratio. This increase in the bacterial to fungal ratio is beneficial for the reconstruction of the soil microbial ecosystem in replanted apple orchards, and is conducive to promoting plant growth.

[0271] Table 14 Effects of KF-B6 compound microbial fertilizer and bacterial agent treatment on soil microorganisms in apple continuous cropping

[0272]

[0273] (4) Detection of culturable soil microorganism KF-B6

[0274] The initial bacterial activity was determined after the colonization treatment, and the effective bacterial activity of KF-B6 in the rhizospheric soil of the rootstock seedlings of treatment I (T1) was detected every one month: the large soil around the roots was shaken off, and the attached soil was retained. 10.00 g was accurately weighed and placed in a conical flask containing 100 mL of sterile saline. Serial dilutions were performed, and 0.1 mL of the dilutions of different concentrations were spread on Gao's medium No. 1 and cultured at 35°C for 72 h. The effective bacterial activity of KF-B6 was calculated by the plate count method.

[0275] The results are shown in Table 15. It can be seen that the initial effective bacterial activity of KF-B6 is 3.20×10 7 CFU / g, close to the theoretical number of 6.00×10 7 CFU / g, the bacterial count detected in the second month decreased by one order of magnitude, and in the fourth month it decreased by 5 times compared with the second month, but the number of viable bacteria measured in the sixth month was not much different from that in the fourth month, indicating that KF-B6 can effectively colonize in the soil and plant roots of continuous cropping, thereby playing the role of preventing and controlling continuous cropping diseases.

[0276] Table 15 Changes in the number of KF-B6 bacteria in rhizosphere soil

[0277]

[0278] Example 8 Field Test

[0279] A planting trial of the new Daphne Red apple variety was conducted in an orchard in Zhangjiayuan Town, Qianyang County, Baoji City, Shaanxi Province. The orchard covers an area of ​​82 mu (apple acres), and the previous crop was a 30-year-old Fuji apple grown on an intermediate rootstock. On March 20, 2022, saplings of the 2-year-old M9 T337 dwarf, self-rooted Daphne Red apple variety were replanted in the original site, with a spacing of 3.8 m x 1 m between rows. The trial consisted of two treatments, each with four replications, with each replication forming a plot. Twenty-five apple trees were planted in each plot.

[0280] 1. Treatment with KF-B6 compound microbial fertilizer and liquid microbial agent. The specific process and anti-repeat test plan are as follows:

[0281] (1) Dig planting trenches before winter 2021

[0282] ① Deep plowing and land preparation: After the fruit is harvested in autumn, old trees are removed, and residual roots and diseased roots are picked out. When plowing the soil, KF-B6 compound microbial fertilizer (prepared in Example 6) is applied to the test plot at a rate of 300 kg / mu;

[0283] ② Dig planting trenches: The planting trenches should be about 80 cm deep and 80 cm wide.

[0284] ③ Backfill the planting ditch in spring (March 6, 2022): Sprinkle 500 kg of KF-B6 compound microbial fertilizer per mu in the planting ditch, mix it with the backfill soil and backfill.

[0285] (2) Treatment of seedlings before planting on March 20, 2022

[0286] Planting seedlings that have not lost water were soaked in a 100-fold diluted solution of KF-B6 liquid microbial agent (prepared in Example 6) for 30 minutes;

[0287] (3) Tree planting on March 20, 2022

[0288] ① When planting, apply 2kg of KF-B6 compound microbial fertilizer to each planting pit and mix it evenly with the soil; when planting, add 20% KF-B6 compound microbial fertilizer and 20% soil to a 100-fold diluted solution of KF-B6 liquid microbial agent to make a slurry, dip the roots of the seedlings in the slurry, and then plant the seedlings in the dug pits.

[0289] ② Covering with soil

[0290] After covering the soil, a 300-fold dilution of KF-B6 liquid microbial agent (prepared in Example 6) was used for root irrigation.

[0291] (4) Management after planting in 2022

[0292] ① Growing season, May-June: Use KF-B6 liquid inoculant (prepared in Example 6) diluted 300 times and irrigate the roots once;

[0293] ② Autumn fertilization: 2 kg KF-B6 compound microbial fertilizer + 0.5 kg commercially available trace elements in Mumei soil per tree.

[0294] 2. Control treatment: The KF-B6 compound microbial fertilizer in the above process and scheme was replaced with farmyard manure (rotted cow dung, dried to a moisture content of less than 30%, and crushed); and the KF-B6 liquid microbial agent was replaced with water.

[0295] Other agricultural operations were identical between the two treatments.

[0296] 3. Detection indicators

[0297] (1) Soil index detection: The five-point sampling method was used to collect rhizosphere soil samples from apple trees in each plot. Six trees were selected in each plot to collect soil samples at fixed points. Five sampling points were set up 0.5 m away from the base of the tree trunk. A soil drill with an inner diameter of 10 cm was used to dig 20-40 cm of soil to collect the root system. The soil attached to the root system was shaken off and the contents of organic matter, total nitrogen, available potassium and available phosphorus in the rhizosphere soil, as well as soil aggregates and soil bulk density, were measured.

[0298] The results, as shown in Table 16, showed increases in soil nitrogen, phosphorus, and potassium content in the KF-B6 compound microbial fertilizer and microbial agent treatment groups. In particular, organic matter content increased by 17.03 g / kg compared to the CK group, improving soil fertility. Furthermore, the treatments promoted the formation of water-stable aggregates, particularly the proportion of large-size aggregates. Water-stable aggregates >2 mm and 1-2 mm increased by 28.01% and 47.64%, respectively, compared to the CK group. The proportion of microaggregates (<0.25 mm) decreased by 48.60% compared to the CK group, and soil bulk density decreased by 6.87%. This suggests that KF-B6 and its agent not only increased soil organic matter but also promoted the formation of water-stable aggregates, reduced soil bulk density, and increased soil structural stability and air permeability, achieving a soil improvement effect.

[0299] Table 16 Effects of KF-B6 compound microbial fertilizer and microbial agent on the physical and chemical properties of rhizosphere soil in continuous apple cropping

[0300]

[0301] (2) Testing of planting survival rate and apple tree growth indicators

[0302] A total of 100 apple trees were planted in four plots in each treatment group. After one year, the number of surviving trees was counted and the survival rate was calculated. Three trees were selected and marked in each plot. Initial plant height and trunk diameter were measured at planting. One year later, the marked trees were measured again as final values. Plant height, trunk diameter, leaf chlorophyll content, and branch number and length were counted.

[0303] The results are shown in Table 17. The survival rate of the Daphne Red Apple seedlings planted in the KF-B6 treatment group was as high as 94.00%, which was 16.05% higher than that in the CK treatment group. The plant height growth rate, stem diameter growth rate, chlorophyll content, branch number, and branch length increased by 31.14%, 30.26%, 11.15%, 24.32%, and 25.14%, respectively. Therefore, KF-B6 bacteria and their inoculants can not only increase the survival rate of the new Daphne Red Apple variety planted in continuous cropping orchards, but also have a significant promoting effect on its growth.

[0304] Table 17 Effects on the survival rate and plant growth of apples in continuous cropping orchards

[0305]

[0306] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. A microbial agent or compound microbial fertilizer comprising Paenibacillus eihime, characterized in that: The Paenibacillus eihime is specifically Paenibacillus eihime ( Paenibacillus ehimensis )KF-B6, the deposit number is CGMCC No.32131.

2. The microbial agent comprising Paenibacillus eihime according to claim 1, wherein The preparation method of the bacterial agent is as follows: a spore suspension of Paenibacillus eihime KF-B6 is inoculated into a fermentation medium for producing exopolysaccharide (EPS), and the culture is carried out until the fermentation liquid becomes viscous and more than 95% of the spores are observed under a microscope, thereby obtaining a KF-B6 fermentation liquid containing EPS; and any one or more of a synergist, an osmotic salt system stabilizer, an antifreeze agent, an emulsifier, and a preservative are added to the fermentation liquid to obtain a bacterial agent containing Paenibacillus eihime KF-B6.

3. The microbial agent comprising Paenibacillus eihime according to claim 2, wherein The EPS-producing fermentation medium comprises: 15.0-25.0 g sucrose, 1.5-2.5 g corn steep liquor powder, 1.5-2.5 g CaCO3, 0.5-1.5 g K2HPO4·3H2O, 0.25-0.75 g MgSO4·7H2O, 0.25-0.75 g MnSO4·H2O, 1 L distilled water, and a pH value of 7.0-7.

3.

4. The microbial agent comprising Paenibacillus eihime according to claim 2, wherein The synergist is: mineral potassium fulvic acid and seaweed liquid; the osmotic salt system stabilizer is: potassium dihydrogen phosphate; the antifreeze is: ethylene glycol; the emulsifier is: OP-10; and the preservative is: sodium dehydroacetate.

5. The microbial agent comprising Paenibacillus eihime according to claim 2, wherein The specific preparation method is as follows: (1) Preparation of spore suspension on slant: streak the activated KF-B6 on the slant of NA culture medium and culture until the spore rate under microscopic examination is greater than 95%. Elute the spores with sterile distilled water and bathe in 80℃ water for 5 min to obtain the spore suspension inoculant. (2) EPS production liquid fermentation: Inoculate the spore suspension into the EPS production liquid medium A at a rate of 5-10%, and culture until the fermentation liquid becomes viscous and more than 95% of the spores are detected by microscopy to obtain the EPS-containing KF-B6 fermentation liquid; The liquid culture medium A is composed of: 15.0-25.0 g sucrose, 1.5-2.5 g corn steep liquor powder, 1.5-2.5 g CaCO3, 0.5-1.5 g K2HPO4·3H2O, 0.25-0.75 g MgSO4·7H2O, 0.25-0.75 g MnSO4·H2O, 1 L distilled water, pH 7.0-7.3; (3) Preparation of KF-B6 liquid microbial agent: Add 10-15% mineral potassium humate, 3.0-4.5% potassium dihydrogen phosphate, 1.5-3.5% seaweed liquid with pH 7.0, 3.0-5.0% ethylene glycol, 1.5-2.5% OP-10, and 0.05-0.1% sodium dehydroacetate to the KF-B6 fermentation liquid containing EPS, and mix thoroughly to obtain the KF-B6 microbial agent.

6. The composite microbial fertilizer comprising Paenibacillus eihime according to claim 1, wherein The preparation method of the composite microbial fertilizer is as follows: inoculating Ehime Bacillus KF-B6 seed liquid into a fermentation medium, culturing until the spore rate in the fermentation liquid is greater than 95% and the number of effective viable bacteria is greater than 600 million / mL to obtain a fermentation liquid; after uniformly mixing the KF-B6 fermentation liquid with a sterilized carrier, thickly spreading it in a constant temperature culture room while ventilating and culturing until the moisture content is less than 10%, thereby obtaining the KF-B6 composite microbial fertilizer.

7. The composite microbial fertilizer comprising Paenibacillus eihime according to claim 6, wherein The fermentation medium is composed of: yeast extract powder 4.0-6.0g, soybean meal powder 4.0-6.0g, K2HPO4·3H2O 0.50-1.50g, MnSO4 . H2O 0.25-0.75g, NaCl 0.5-1.0g, MgSO4 . 7H2O 0.3-0.5g, KCl 0.15-0.35g, sucrose 1.0-2.5g, CaCO3 1.5-3.5g, distilled water 1L, pH natural.

8. The composite microbial fertilizer comprising Paenibacillus erythroides according to claim 6, wherein The carrier is a mixture of vermiculite, mature cow dung compost, peat, and humic acid in a weight ratio of 1:2:1:

1.

9. The composite microbial fertilizer comprising Paenibacillus eihime according to claim 6, wherein The specific preparation method is as follows: (1) Preparation of spore suspension on slant: streak the activated KF-B6 on the slant of NA culture medium and culture until the spore rate under microscopic examination is greater than 95%. Elute the spores with sterile distilled water and bathe in 80℃ water for 5 min to obtain the spore suspension inoculant. (2) Seed liquid culture: Inoculate the slant spore suspension into liquid culture medium B at a 5-10% inoculation rate, and culture at 35-45°C and 150-200 rpm for 16-20 hours to obtain seed liquid; The liquid culture medium B is composed of: yeast extract powder 4.0-6.0g, soybean meal powder 4.0-6.0g, K2HPO4·3H2O 0.50-1.50g, MnSO4 . H2O 0.25-0.75g, NaCl 0.5-1.0g, MgSO4 . 7H2O 0.3-0.5g, KCl 0.15-0.35g, distilled water 1L, natural pH; (3) Fermentation culture: Inoculate the seed liquid into liquid culture medium C at a rate of 5-10% to obtain fermentation liquid with a spore rate >95% and a bacterial viability >600 million / mL; The liquid culture medium C is composed of: yeast extract powder 4.0-6.0g, soybean meal powder 4.0-6.0g, K2HPO4·3H2O 0.50-1.50g, MnSO4 . H2O 0.25-0.75g, NaCl 0.5-1.0g, MgSO4 . 7H2O 0.3-0.5g, KCl 0.15-0.35g, sucrose 1.0-2.5g, CaCO3 1.5-3.5g, distilled water 1L, pH natural; (4) Preparation of KF-B6 compound microbial fertilizer: After the fermentation liquid of KF-B6 and the sterilized carrier are mixed evenly in a volume-to-mass ratio of 1:2-1:3, the mixture is spread to a thickness of 15 cm-20 cm in a constant temperature culture room at 35-45°C and ventilated for 5-7 days until the moisture content is below 10%, thereby obtaining KF-B6 compound microbial fertilizer; The carrier is a mixture of vermiculite, mature cow dung compost, peat, and humic acid in a weight ratio of 1:2:1:

1.

10. Use of the microbial agent or compound microbial fertilizer comprising Paenibacillus erythrix according to claim 1 in preventing and controlling apple continuous cropping problems.

Images