SIRT1 modified engineered mesenchymal stem cell exosome and application thereof

Abstract

The invention discloses an SI RT1 modified engineered mesenchymal stem cell exosome and application thereof, the exosome expresses SI RT1 protein through an SI RT1 gene, and an aptamer VEGF-Cho l is inserted. The exosome has a targeting function module and a functional protein module, can specifically target vascular endothelial cells (VECs), after targeted aggregation around the mesenchymal VECs, the engineering exosome is absorbed by the VECs, loaded SI RT1 is released into the VECs, and the SI RT1 regulates an oxidative stress reaction by activating a nuclear factor-erythroid 2 related factor 2 (Nrf2) to effectively reverse VECs-EndMT. The targeting effect of accurately treating AS is achieved, EndMT is reversed, the inflammatory response of atherosclerotic plaques is reduced, and the curative effect of treating atherosclerosis is achieved.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a SIRT1-modified engineered mesenchymal stem cell exosome and an application thereof. Background Art

[0002] Atherosclerosis (AS) is a common vascular disease that poses a major threat to global health and can lead to multiple serious complications, such as coronary heart disease, myocardial infarction, stroke, and peripheral arterial disease. A key pathogenic mechanism of AS is endothelial-mesenchymal transition (EndMT), which is characterized by the transdifferentiation of vascular endothelial cells (VECs) to a mesenchymal phenotype. This transition plays a central role in the development and resolution of plaques during AS progression. VECs that undergo EndMT (VECs-EndMT) contribute significantly to vascular inflammation and plaque formation. The role of EndMT in plaque stability and disease progression has been well established, highlighting its key role in AS. Therefore, targeted reversal of EndMT has become a promising therapeutic strategy for the prevention and treatment of AS.

[0003] Exosomes are nanoscale extracellular vesicles ranging in size from 30 to 100 nanometers, which are secreted into the extracellular environment by the exocytosis of various cell types. Exosomes from bone marrow mesenchymal stem cells (BMSCs) not only have the unique advantages of low immunogenicity and high drug resistance, but also inherit the repair and anti-inflammatory properties of BMSCs, which have important potential for the treatment of AS. However, natural BMSC-derived exosomes lack sufficient targeting ability for the regulation of VECs-EndMT and are easily absorbed by non-targeted cells. In addition, natural exosomes cannot achieve effective therapeutic effects because they cannot provide sufficient load content to targeted cells. In order to solve the above challenges, engineered exosomes, as a natural nanoscale delivery platform, provide new ideas for drug delivery, therapeutic intervention and biomedical research. Engineered exosomes have been developed to express functional proteins on the surface through genetic and chemical engineering strategies, which significantly improves their targeting accuracy and therapeutic effect. To date, engineered exosomes have been widely used in the diagnosis and treatment of various diseases, such as cancer and musculoskeletal diseases, but few studies have been conducted in cardiovascular and cerebrovascular diseases.

[0004] In order to improve the prevention and treatment effect of AS, the functional proteins overexpressed on the surface of engineered exosomes need to be deliberately selected. Silent information regulator 2-related enzyme 1 (SIRT1) is a key member of the histone deacetylase family. It can be considered that it regulates a series of pathophysiological processes, including DNA repair, apoptosis, and oxidative stress, by coordinating protein acetylation / deacetylation events in signaling cascades. Studies have shown that SIRT1 can attenuate shear stress-mediated EndMT in endothelial cells by regulating the expression of adenosine 5'-monophosphate-activated protein kinase. Based on these findings, we speculate that overexpression of SIRT1 on the surface of exosomes derived from bone marrow mesenchymal stem cells can effectively regulate VECs-EndMT in AS lesions through engineering methods. Summary of the invention

[0005] The purpose of the present invention is to provide an engineered mesenchymal stem cell exosome modified by SIRT1, which has a protein module SIRT1 and a targeting module cholesterol-modified aptamer, which can target vascular endothelial cells (VECs) and block their transdifferentiation into a mesenchymal phenotype, thereby achieving the purpose of preventing and treating atherosclerosis.

[0006] To achieve the purpose of the present invention, the following embodiments are provided.

[0007] In one embodiment, the SIRT1-modified engineered mesenchymal stem cell exosomes of the present invention comprise bone marrow mesenchymal stem cell exosomes, SIRT1 protein expressed on the exosomes, and a modified aptamer (VEGF-Chol), wherein the aptamer (VEGF) has the gene sequence shown in SEQ ID NO.1, and has cholesterol CHol connected to the 3' end.

[0008] SEQ ID NO.1 5'-CCATACCGGACGCCTAAAACC GACCGTAGAAAAAA-3'-Chol.

[0009] In the above-mentioned engineered mesenchymal stem cell exosomes, the gene encoding SIRT1 protein has the gene sequence shown in SEQ ID NO.2.

[0010] In another embodiment, the present invention also provides a method for preparing SIRT1-modified engineered mesenchymal stem cell exosomes, comprising the following steps:

[0011] 1) Cultivate BMSCs cells to 50% confluence and replace the culture medium;

[0012] 2) adding the recombinant SIRT1 gene adenovirus and the infection-aiding agent to the culture medium replaced in the previous step for culturing;

[0013] 3) SIRT1 gene adenovirus was transmitted into BMSCs cells, the culture medium was changed, and the culture was continued;

[0014] 4) When the BMSCs cells are cultured in a medium containing normal serum to a confluence of 60%-70%, they are replaced with a fresh medium containing exosome-free serum, and the culture is continued. The cell supernatant is collected, centrifuged to remove larger cell debris, and then centrifuged again to remove the cell debris completely;

[0015] 5) The supernatant after removing the cell debris is centrifuged to remove the large vesicles, and the supernatant is used to precipitate the exosomes by high-speed centrifugation;

[0016] 6) Further purifying the exosomes obtained in the previous step to obtain pure exosomes;

[0017] 7) The exosomes were resuspended in PBS, and the cholesterol-modified aptamer (VEGF-Chol) was added for co-incubation. After the incubation was completed, the mixture was centrifuged to obtain the engineered bone marrow mesenchymal stem cell exosomes overexpressing SIRT1 connected to the aptamer.

[0018] Preferably, in the preparation method of the present invention, the SIRT1 gene (i.e., the gene encoding the SIRT1 protein) in step 2) has the sequence shown in SEQ ID NO.2,

[0019] ATGTTTGATATTGAATATTTCAGAAAAGATCCAAGACCATTCTTCAAGTTTGCAAAGGAAATATATCCTG

[0020] GACAATTCCAGCCATCTCTCTGTCACAAATTCATAGCCTTGTCAGATAAGGAAGGAAAACTACTTCGCAA

[0021] CTATACCCAGAACATAGACACGCTGGAACAGGTTGCGGGAATCCAAAGGATAATTCAGTGTCATGGTTCC

[0022] TTTGCAACAGCATCTTGCCTGATTTGTAAATACAAAGTTGACTGTGAAGCTGTACGAGGAGATATTTTTA

[0023] ATCAGGTAGTTCCTCGATGTCCTAGGTGCCCAGCTGATGAACCGCTTGCTATCATGAAACCAGAGATTGT

[0024] GTTTTTTGGTGAAAATTTCACGAACAGTTTCATAGAGCCATGAAGTATGACAAAGATGAAGTTGACCTC

[0025] CTCATTGTTATTGGGTCTTCCCCTCAAAGTAAGACCAGTAGCACTAATTCCAAGTTCCATACCCCATGAAG

[0026] TGCCTCAGATATTAATTAATAGAGACCTTTGCCTCATCTGCATTTTGATGTAGAGCTTCTTGGAGACTG

[0027] TGATGTCATAATTAATGAATTGTGTCATAGGTTAGGTGGTGAATATGCCAAACTTTGCTGTAACCCTGTA

[0028] AAGCTTTCAGAAATTACTGAAAAAACCTCCACGAACACAAAAGAATTGGCTTATTTGTCAGAGTTGCCAC

[0029] CCACACCTCTTCATGTTTCAGAAGACTCAAGTTCACCAGAAAAAGACTTCACCACCAGATTCTTCAGTGAT

[0030] TGTCACACTTTTAGACCAAGCAGCTAAAGTAATGATGATTTAGATGTGTCTGAATCAAAAGGTTGTATG

[0031] GAAGAAAAACCACAGGAAGTACAAACTTCTAGGAATGTTGAAAGTATTGCTGAACAGATGGAAAATCCGG

[0032] ATTTGAAGAATGTTGGTTCTAGTACTGGGGAGAAAAATGAAAGAACTTCAGTGGCTGGAACAGTGAGAAA

[0033] ATGCTGGCCTAATAGAGTGGCAAAGGAGCAGATTTAGTAGGCGGCTTGATGGTAATCAGTATCTGTTTTTG

[0034] CCACCAAATCGTTACATTTTCCATGGCGCTGAGGTATATTCAGACTCTGAAGATGACGTCTTATCCTCTA

[0035] GTTCTTGTGGCAGTAACAGTGATAGTGGGACATGCCAGAGTCCAAGTTTAGAAGAACCCATGGAGGATGA

[0036] AAGTGAAATTGAAGAATTCTACAATGGCTTAGAAGATGAGCCTGATGTTCCAGAGAGAGCTGGAGGAGCT

[0037] GGATTTGGGACTGATGGAGATGATCAAGAGGCAATTAATGAAGCTATATCTGTGAAACAGGAAGTAACAG

[0038] ACATGAACTATCCATCAAACAAATCATAG.

[0039] Preferably, in the preparation method of the present invention, the infection-aiding agent in step 2) is Polybrene.

[0040] Preferably, in the preparation method of the present invention, the culture is continued as described in step 3), and the liquid is replaced every 3 days as usual.

[0041] Preferably, in the preparation method of the present invention, the continued cultivation in step 4) is 48 hours, and the infection efficiency is optionally detected by qRT-PCR and western blotting.

[0042] Preferably, in the preparation method of the present invention, the further purification in step 6) refers to filtering the resuspended exosomes with a 0.22 μm filter and centrifuging at 100,000×g at 4°C for 90 min.

[0043] The co-incubation in step 7) is to add 250 μL of exosome suspension (4×10 9 particles / mL) were incubated with 250 μL of aptamer (10 nM) for 30 min.

[0044] In another embodiment, the present invention provides a use of SIRT1-modified engineered mesenchymal stem cell exosomes in the preparation of a drug for treating atherosclerosis.

[0045] In a specific embodiment, a SIRT1-modified engineered mesenchymal stem cell exosome of the present invention comprises the following steps:

[0046] 1. Culture BMSCs cells in high-glucose DMEM medium containing 10% fetal bovine serum;

[0047] 2. BMSCs cells were inoculated into 6-well cell culture plates, with 1×10 cells per well. 4 The cells were maintained in a humidified atmosphere at 37°C and 5% CO2;

[0048] 3. When the BMSCs cells reach 50% confluence, prepare to change the medium before infection, discard the old medium, rinse twice with PBS, and add 1 mL of medium;

[0049] 4. After the recombinant SIRT1 virus melted in an ice bath, add 1.5×10 7 Plaque-forming units / mL recombinant SIRT1 adenovirus and co-infection reagent Polybrene (5ug / mL). The cells were maintained in a humidified environment at 37°C and 5% CO2;

[0050] 5. Add 1 mL of culture medium after 4 hours, change the medium after 7 hours, and then change the medium every 3 days;

[0051] 6. When the BMSCs cells were cultured in a medium containing normal serum to a confluence of 60%-70%, the old medium was discarded, the cells were rinsed twice with PBS, and replaced with fresh medium containing exosome-free serum, and cultured for another 48 h;

[0052] 7. After 48 hours, qRT-PCR and western blotting were used to detect the infection efficiency;

[0053] 8. After 48 h, collect the cell supernatant and centrifuge at 300 × g at 4 °C for 10 min to remove larger cell debris;

[0054] 9. Centrifuge at 2000×g for 20 min at 4°C to remove cell debris;

[0055] 10. Then centrifuge at 10,000 × g at 4°C for 30 min to remove large vesicles;

[0056] 11. Transfer the treated cell supernatant to a new ultracentrifuge tube and centrifuge at 100,000 × g at 4°C for 90 min to precipitate exosomes.

[0057] 12. After centrifugation, remove the supernatant, retain the exosomes in the precipitate, and resuspend the precipitate with PBS.

[0058] 13. Filter the resuspended exosomes with a 0.22 μm filter and centrifuge again at 100,000 × g at 4 °C for 90 min to further purify the exosomes;

[0059] 14. Add 250 μL of exosome suspension (4×10 9 particles / mL) were incubated with 250 μL of cholesterol-modified aptamer (10 nM) for 30 min, during which the incubation centrifuge tube was stirred and rotated at a low speed on a stirrer;

[0060] 15. Place the suspension in a 15 ml 100 kd ultrafiltration tube and centrifuge at 3000 × g at 4°C for 10 min to obtain exosomes of engineered bone marrow mesenchymal stem cells overexpressing SIRT1 that bind to the cholesterol aptamer;

[0061] 16. Optionally, label the aptamer with Cy5 and the exosomes with PKH67, and observe their successful binding under a confocal microscope.

[0062] The cholesterol-modified aptamer (VEGF-Chol) is SEQ ID NO.1

[0063] 5'-CCATACCGGACGCCTAAAACC GACCGTAGAAAAAA-3'-Chol.

[0064] Technical effects of the present invention:

[0065] The SIRT1-modified engineered bone marrow mesenchymal stem cell exosomes of the present invention are designed into two modules: a functional SIRT1 protein module and a targeting module. In the functional protein module, overexpression of SIRT1 protein is achieved in BMSCs by infection with recombinant SIRT1 adenovirus, so that the exosomes are enriched with overexpressed SIRT1 protein. In the targeting module, in order to specifically target VECs cells, cholesterol-modified aptamers of VECs cell-specific protein vascular endothelial growth factor (VEGF) are assembled onto engineered exosomes. The specific binding of the aptamer to VECs cells causes the engineered exosomes to aggregate around the mesenchymal VECs cells. These aggregated exosomes are then taken up by VECs cells and the loaded SIRT1 is released into VECs cells, providing a new option for the prevention and treatment of atherosclerosis (AS) by reversing EndMT and reducing inflammation in atherosclerotic plaques.

[0066] The SIRT1-modified engineered bone marrow mesenchymal stem cell exosomes of the present invention not only have the unique advantages of low immunogenicity and high drug tolerance, but also inherit the repair and anti-inflammatory properties of BMSCs. The aptamer-modified exosomes, whose surface overexpresses SIRT1, can effectively and targetedly regulate VECs-EndMT in AS lesions. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 In the figure, (A) is a schematic diagram of the collection and separation of SIRT1 overexpressed exosomes and Chol-VEGF aptamers, (B) and (C-D) are the results of qRT-PCR detection and Western Blot detection of SIRT1 mRNA and protein levels in BMSCs, BMSCs+Ad vector or BMSCs+Ad-SIRT1 w, respectively, (E) is a TEM image of Exos and Exos-SIRT1, (F) is a size distribution diagram of Exos and Exos-SIRT1 captured by the NTA system, (G) is a Western Blot detection of MSCs, Exos or Exos-SIRT1 and exosomal marker proteins such as CD9, CD63 and TSG101 protein levels, (H) is a confocal microscopy image of the binding of Exos-SIRT1 and Chol-VEGF aptamers.

[0068] Figure 2 Figure 2 is the in vitro anti-fibrotic effect diagram of Exos-SIRT1, where (A) is a schematic diagram of Exos-SIRT1 reversing EndMT in vitro, (B) is CCK-8 detection showing the role of TGF-β in the effectiveness of MAECs, (CE) is qRT-PCR and Western Blot analysis showing the expression levels of vimentin and ve-cadherin in MAECs under different concentrations of TGF-β, (FG) are PBS, TGF-β, TGF-β+Exos and TGF-β+Exos -SIRT1 affects tube formation in MAECs, (HJ) qRT-PCR and Western Blot analysis showed the expression levels of vimentin and VE-cadherin in MAECs treated with PBS, TGF-β, TGF-β+Exos, and TGF-β+Exos-SIRT1, (KL) immunofluorescence double staining analysis of the expression of vimentin and VE-cadherin in MAECs treated with PBS, TGF-β, TGF-β+Exos, and TGF-β+Exos-SIRT1.

[0069] Figure 3 The figures show the effect of Exos-SIRT1 on activating Nrf2 in MAECs, where (AC) are Western Blot and qrt-PCR analysis showing the expression levels of SIRT1, KEAP1, Nrf2, NQO-1, HO1 and β-actin in MAECs treated with PBS, TGF-β, TGF-β+Exos and TGF-β+TGF-TGF 1; (DE) are immunofluorescence double staining analysis of the expression levels of vimentin and Nrf2 in MAECs treated with PBS, TGF-β, TGF-β+Exos and TGF-β+Exos-SIRT1.

[0070] Figure 4 Figure 2 is a graph showing the therapeutic effect of Exos-SIRT1-VEGF on APOE- / - mice, wherein (A) is a schematic diagram of Exos-SIRT1-VEGF treatment of AS mice, (B) is a record of the body weight of AS mice during the treatment, (C) is the blood lipid levels of each group at the end of treatment, (D) is the gross ORO staining of the aorta of each group at the end of treatment, (EF) is the ORO, Movet and HE staining of the aortic root sections at the end of treatment, (GH) is an immunofluorescence double staining analysis of the expression of vimentin and ve-cadherin in the aortic root sections at the end of treatment, and (IJ) is an immunofluorescence staining analysis of SIRT1 expression in aortic sections at the end of treatment. DETAILED DESCRIPTION

[0071] The following examples are representative and are used to further understand and illustrate the spirit of the present invention, but are not intended to limit the scope of the present invention in any way.

[0072] Material:

[0073] High-glucose Dulbecco's modified Gagle's medium (Gibco, USA),

[0074] Fetal bovine serum (Gibco, USA),

[0075] Adenovirus reverse transfection system (Sagoon Biotechnology, China),

[0076] EZ-10 Total RNA Mini Prep Kit (Sangon Biotech, China),

[0077] AMV first-strand cDNA synthesis kit (Sangon Biotech, China),

[0078] RIPA buffer (Beyotime, China),

[0079] 2×SYBR qPCRMix (Sangon Biotech, China),

[0080] hBMMSCs conditioned medium (OriCell, Australia),

[0081] Aptamers: VEGF-Chol / Cy5-VEGF-Chol (synthesized by Sagon Biotechnology, China), PBS (Gibco, USA).

[0082] In the following examples, the schematic diagram of the collection and separation process of SIRT1 overexpressed exosomes and Chol-VEGF aptamers is shown in Figure 1 (A).

[0083] Example 1 Preparation of SIRT1-modified engineered bone marrow mesenchymal stem cell exosomes

[0084] 1. Construction of SIRT1 adenovirus

[0085] 1) Plasmid construction: SIRT1 gene (SEQ ID NO. 2) was amplified by PCR and cloned into an adenovirus expression vector to form a recombinant adenovirus expression plasmid.

[0086] (PCR primers F: AGCTCAAGCTTCGAATTCGCCACCATGGCGGACGAGGCGGCC; R: TGATTTGTTTGATGGATAGTTC)

[0087] 2) Plasmid verification: The correctness of the SIRT1 gene sequence was verified using restriction endonuclease digestion and DNA sequencing.

[0088] 3) Virus packaging: The recombinant plasmid and the adenovirus backbone plasmid were co-transfected into HEK293 cells to generate recombinant adenovirus by homologous recombination.

[0089] 4) Virus titer determination: The virus titer was determined by plaque forming unit (PFU) assay to ensure the infection efficiency of the virus.

[0090] 5) Virus purification: The recombinant adenovirus was purified using CsCl gradient centrifugation to ensure the purity and concentration of the virus.

[0091] 6) Virus titer determination: The titer of the concentrated virus containing SIRT1 in the present invention is 6.79×10 10 (IFU / mL).

[0092] 2. Adenovirus infection of bone marrow mesenchymal stem cells

[0093] 1) Cell culture: Bone marrow mesenchymal stem cells (BMSCs) were cultured in high-glucose DMEM medium containing 10% fetal bovine serum to ensure an optimal environment for cell growth.

[0094] 2) Cell seeding and culture: BMSCs cells were seeded in 6-well cell culture plates, with 1×10 cells per well. 4 cells to achieve uniform growth and confluence.

[0095] 3) Culture environment maintenance: Cells were maintained in a humidified environment at 37°C and 5% CO2 to simulate in vivo conditions and promote cell growth and differentiation.

[0096] 4) Change medium before infection: When the BMSCs cells reach 50% confluence, discard the old medium, rinse twice with PBS, and add 1 mL of fresh medium to prepare for viral infection.

[0097] 5) Virus infection: After the recombinant SIRT1 virus was thawed in an ice bath, 1.5×10 7 Plaque-forming units / mL recombinant SIRT1 adenovirus and the infection-aiding reagent Polybrene (5 μg / mL) were added to improve the infection efficiency.

[0098] 6) Medium supplementation and replacement: 1 mL of medium was added after 4 hours, and the medium was replaced after 7 hours. Thereafter, the medium was replaced every 2 days as usual to maintain cell growth and viral expression.

[0099] 7) Infection efficiency detection: 48 hours after infection, qRT-PCR and western blotting were used to detect infection efficiency. The results are shown in Figure 1 B-1D. The results showed that the untreated and transfected cells were compared with the GFP encoding adenoviral vector (ad vector). After transfection with the ad-SIRT1 vector, the increased SIRT1 expression was 10.51±2.06 times.

[0100] 3. Extraction and identification of exosomes overexpressing SIRT1

[0101] 1) Culture without exosome serum: When BMSCs cells were cultured in a medium containing normal serum to a confluence of 60%-70%, the old medium was discarded, the cells were rinsed twice with PBS, and replaced with fresh medium containing exosome-free serum, and cultured for another 48 hours.

[0102] 2) Collection and purification of exosomes: After 48 hours, collect the cell supernatant and centrifuge at 300×g at 4℃ for 10 minutes to remove larger cell debris. Centrifuge at 2000×g at 4℃ for 20 minutes to remove the cell debris. Then centrifuge at 10,000×g at 4℃ for 30 minutes to remove large vesicles. Transfer the treated cell supernatant to a new ultracentrifuge tube and centrifuge at 100,000×g at 4℃ for 90 minutes to precipitate the exosomes.

[0103] 3) Exosome resuspension and filtration: After centrifugation, remove the supernatant, retain the exosomes in the precipitate, and resuspend the precipitate with PBS. After filtering the resuspended exosomes with a 0.22μm filter, centrifuge again at 100,000×g at 4℃ for 90 minutes to further purify the exosomes.

[0104] 4) Exosome characterization: Exosomes were resuspended in an appropriate amount of PBS, and the morphology and particle size distribution of exosomes were recorded using a TEM transmission electron microscope and an NTA nanoparticle tracking analyzer. Western blotting was used to detect the expression of SIRT1 and exosome marker proteins. The test results are shown in Figure 1 E-1G.

[0105] 5) Exosome preservation: Record the time and concentration on the preservation tube and store the exosomes in a -80°C refrigerator to maintain their stability and activity.

[0106] Through transmission electron microscopy (TEM, Figure 1 E), nanoparticle tracking analysis (NTA, Figure 1 F) and WB( Figure 1 G) Exos-SIRT1 and exosomes (Exos) from untreated BMSCs were characterized. The results showed that there were no significant differences in shape, size, and concentration distribution between Exos-SIRT1 and Exos. Typical positive exosomal biomarkers (CD9, CD63, and TSG101) and negative exosomal biomarkers (GM130) were observed in Exos-SIRT1 and Exos. However, the level of SIRT1 was significantly higher than that of Exos and cells. This indicates that SIRT1 has been successfully expressed on BMSCs exosomes, namely, SIRT1-overexpressing exosomes (Exos-SIRT1).

[0107] 4. Binding of SIRT1-overexpressing exosomes to cholesterol aptamers

[0108] 1) Aptamer modification: The cholesterol-linked aptamer (abbreviated as "VEGF-Chol", the gene sequence of which is shown in SEQ ID NO. 1) is fluorescently labeled with Cy5 for subsequent fluorescence detection.

[0109] 2) Exosome labeling: Exosomes were labeled with PKH67 fluorescent dye to achieve visual tracking of exosomes.

[0110] 3) Incubation of aptamers and exosomes: 250 μL of exosome suspension (4×10 9 Particles / mL) were incubated with 250 μL of aptamer (10 nM) for 30 minutes, during which the incubation centrifuge tube was stirred and rotated at a low speed on a stirrer.

[0111] 4) Collecting the conjugate by ultrafiltration: The suspension was placed in a 15 ml 100 kd ultrafiltration tube and centrifuged at 3000×g at 4°C for 10 minutes to allow the cholesterol aptamer to bind to the exosomes of bone marrow mesenchymal stem cells overexpressing SIRT1.

[0112] Fluorescence labeling and confocal microscopy observation: Their successful binding was observed under a confocal microscope. Figure 1 H. The superposition of yellow fluorescence, green fluorescence, and red fluorescence confirmed that the Cy3-VEGF aptamer was successfully coupled to Exos-SIRT.

[0113] Gene sequence of cholesterol-modified aptamer (VEGF-Chol):

[0114] SEQ ID NO.1 5'-CCATACCGGACGCCTAAAACC GACCGTAGAAAAAA-3'-Chol.

[0115] Example 2 Characterization and effect experiments

[0116] Test methods and tools used in effect or characterization experiments:

[0117] qRT-RCR

[0118] Total RNA was extracted from cultured cells using the EZ-10 Total RNA Mini Prep Kit (Sangon Biotech, China). For cDNA synthesis, RNA was reverse transcribed using the AMV First-Strand cDNA Synthesis Kit (Sangon Biotech, China). qRT-PCR was performed using 2×SYBR qPCRMix (Sangon Biotech, China). Relative mRNA expression was analyzed using 2 methods—the ΔΔCT method. All primer sequences are shown in Table 1.

[0119] Table 1. Primer sequences for qRT-PCR experiments

[0120]

[0121]

[0122] Western blotting (WB)

[0123] Exosomes or cells were lysed in RIPA buffer (Beyotime, China). Protein samples were separated with 10% separation gel and transferred to polyvinylidene fluoride membrane (Microsporidium, China, USA). After blocking with 5% skim milk at room temperature for 1 hour, the membranes were incubated at 4 °C overnight with: anti-SIRT1 (antibody 32441, 1, 1:1000), 101), 1:1000), 101, 72312, 1:1000), anti-vimentin (HUABIO, ET1610-39, 1:1000), 1:1000) (Am168, AF301136, 1:1000), anti-ho1 (66743-1, 1:1000). Subsequently, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody (protein protein, 1:2000) at room temperature for 1 hour. Protein bands were visualized using enhanced chemiluminescence reagents and analyzed using ImageJ software.

[0124] Tube formation assay

[0125] Matrix gel (Corning, USA) was added to 96-well plates at 505L per well and allowed to set for 2 hours. After 2 hours, MAECs were spread at a density of 1.5×104 cells / 505L / well. After 12 hours, cells were observed to be arranged in tubes. Calcein AM (China Time) was then added to 96-well plates at 1005L per well and incubated at 37°C away from light for 30 minutes. The number of tubes formed was counted using ImageJ software.

[0126] Low molecular weight fluorescent staining

[0127] MAECs were fixed in 4% paraformaldehyde (Bioss, China) for 10 min, permeabilized with 0.1% Triton-100 PBS (China) for 5 min, and blocked with 10% normal goat serum (China) and 0.1% Triton-X100 PBS for 1 h at room temperature. Cells were incubated with primary antibodies: VE-cadherin (14-1449-82, 1:100), vimentin (HUABIO, ET1610-39, 1:100), and Nrf2 (protein protein, 80593-1-RR, 1:100) at 4 °C overnight, followed by secondary antibodies: goat Illumina 649 (Aberkin, A23620, 1:200) or goat FITC (Aberkin, A22110, 1:200) at room temperature for 1 h. Images were observed with a laser confocal microscope (LSM880, Germany).

[0128] Oil Red O staining

[0129] The tissue sections were washed with stain for 20 seconds, and then an appropriate amount of Oil Red O (Beyotime, China) staining solution was added for 20 minutes. The sections were washed with staining detergent for 30 seconds, and then washed with PBS for 30 seconds. The tissues were observed under a microscope.

[0130] Blood oxygen lysine staining

[0131] The tissue sections were placed in xylene I for 20 min, xylene for 20 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, anhydrous ethanol III for 5 min, and then washed in tap water for 2 minutes. The sections were stained with hematoxylin dye (China Bio-Xia Li) solution for 5 minutes, 1% hydrochloric acid alcohol differentiation for a few seconds, 1% ammonia solution turned blue for a few seconds, and then washed for 2 minutes. The sections were dehydrated in 85% and 95% graded alcohols, and then stained with eosin dye for 5 minutes. Finally, the sections were placed in anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, anhydrous ethanol III for 5 minutes, xylene I for 5 minutes, xylene for 5 minutes, and then sealed with neutral glue. The tissue was observed under a microscope and analyzed using ImageJ software.

[0132] CCK-8 assay

[0133] The cell suspension (100ul / well) was inoculated into 96-well plates with different treatment methods. 10ul CCK-8 solution (APE×BIO, USA) was added to each well of the culture plate and incubated at 37°C for 1 hour. The absorbance value at 450nm was measured using a microplate reader (Varioskan LUX, USA). The results were analyzed using GraphPad Prism 10 software.

[0134] Statistical analysis

[0135] All data are presented as mean ± standard error. One-way analysis of variance was used to evaluate the differences among the groups. All statistical values ​​were calculated using GraphPad 10.1.1 statistical software (GraphPad Software Inc., San Diego, CA). P < 0.05 was considered statistically significant.

[0136] All data are presented as mean ± standard error. One-way analysis of variance was used to evaluate the differences among the groups. All statistical values ​​were calculated using GraphPad 10.1.1 statistical software (GraphPad Software Inc., San Diego, CA). P < 0.05 was considered statistically significant.

[0137] Characterization of Exos-SIRT1-VEGF

[0138] The exosomes (Exos-SIRT1) overexpressing sirt1 obtained in Example 1 were observed under a fluorescence microscope and the optimal infection multiplicity (MOI) was determined to be 35 plaque-forming units / cell. Under the optimal MOI condition, fluorescence and real-time quantitative polymerase chain reaction (qRT-PCR, Figure 1 B) and Western blot (WB, Figure 1 C and 1D) to evaluate the transfection efficiency and compare with untreated and transfected with GFP encoding adenoviral vector (ad vector). After transfection with ad-SIRT1 vector, the increased SIRT1 expression produced 10.51±2.06 times.

[0139] Exos-SIRT1 was obtained by differential centrifugation of bone marrow mesenchymal stem cells overexpressing sirt1 (SIRT1-BMSCs). Figure 1 E), nanoparticle tracking analysis (NTA, Figure 1 F) and WB( Figure 1G) Exos-SIRT1 and exosomes from untreated BMSCs (Exos) were characterized. There were no significant differences in shape, size, and concentration distribution between Exos-SIRT1 and Exos. Typical positive exosomal biomarkers (CD9, CD63, and TSG101) and negative exosomal biomarkers (GM130) were observed in Exos-SIRT1 and Exos. However, the level of SIRT1 was significantly higher than that of Exos and cells.

[0140] To improve the targeting ability of Exos-SIRT1, we modified exosomes by attaching a cholesterol-modified VEGF aptamer (VEGF-Chol) to the targeted VEGF, thereby improving the precision of AS treatment. Exos-SIRT was labeled with PKH67 green fluorescent membrane dye, and the cholesterol-modified VEGF aptamer was labeled with Cy3 dye (Cy3-VEGF-Chol aptamer). The combined yellow fluorescence, green fluorescence, and red fluorescence superposition confirmed that the Cy3-VEGF-Chol aptamer was successfully coupled to Exos-SIRT ( Figure 1 H). It indicates that Exos-SIRT1-VEGF-Chol (i.e., the exosomes of the present invention overexpressing the SIRT1 enzyme and modified with the aptamer VEGF-Chol) are obtained.

[0141] Specific effect experimental projects:

[0142] 1. In vitro anti-endmt effect of Exos-SIRT1

[0143] The endmt effect of Exos-SIRT1 (exosome-SIRT1) was verified and the incubation time of Exos-SIRT1 with VECs was optimized. Mouse aortic endothelial cells (MAECs) were used as a VECs model. Confocal microscopy showed that the fluorescence intensity increased with the extension of incubation time and reached a plateau at 12h. Therefore, 12h was selected as the optimal incubation time. In addition, Exos and Exos-SIRT1 (PKH67 labeled) were taken up by MAECs at a culture time of 12h.

[0144] Next, the EndMT model of MAECs was established by treating them with 0, 5, 10, and 20 ng / mL TGF-β for 48 h, and was verified by upregulating the expression of mesenchymal cell marker vimentin and downregulating the expression of endothelial cell marker vascular endothelial cadherin (VE-cadherin). Under the treatment of different TGF-β concentrations, the viability of all cells was above 90% ( Figure 2 B). qRT-PCR and WB results showed that EndMT of MAECs was most significant under 20 ng / mL TGF-β treatment ( Figure 2 C and 2D). Therefore, the subsequent EndMT model was treated with 20 ng / mL TGF-β.

[0145] To investigate the efficacy of Exos-SIRT1 against vECs-endmt in MAECs, we pretreated MAECs with TGF-β and then treated them with Exos or Exos-SIRT1. Figure 2 E and 2F) showed that Exos-SIRT1 greatly improved the tube-forming ability of MAECs. qRT-PCR results showed that after Exos-SIRT1 treatment, the mRNA level of vimentin in MAECs-EndMT decreased, while the mRNA level of ve-cadherin increased ( Figure 2 G). Similar results were observed in WB ( Figure 2 H). Immunofluorescence images showed that the number of vimentin-positive cells in the TGF-β group increased significantly, while the number of VE-cadherin-positive cells decreased significantly compared with the PBS group ( Figure 2 I). In addition, the number of vimentin-positive cells was significantly decreased, while the number of VE-cadherin-positive cells was significantly increased after Exos-SIRT1 treatment compared with the untreated group (TGF-β group). There was no statistically significant difference between the Exos-treated group and the untreated group (TGF-β group). In summary, the above results collectively indicate that Exos-SIRT1 significantly inhibits EndMT in MAECs by delivering SIRT1 in vitro.

[0146] 2. Exos-SIRT1 activates Nrf2 in MAECs

[0147] Studies have shown that Nrf2 can inhibit EndMT in endothelial cells. To investigate whether Exos-SIRT1 activates the Nrf2 pathway through SIRT1, we used WB ( Figure 3 A and 3B) and qRT-PCR were used to detect the expression of SIRT1, Nrf2, and Nrf2 downstream pathway factors (Keap1, HO1, and NQO-1). The results confirmed that compared with the PBS group, the mRNA and protein levels of SIRT1, Nrf2, HO1, and NQO-1 in the TGF-β and Exos groups were significantly decreased, while those in the Keap1 group were significantly increased. In addition, compared with the TGF-β group, the expression levels of SIRT1, Nrf2, HO1, and NQO-1 in the Exos-SIRT1 group were upregulated, while the expression level of Keap1 was simultaneously downregulated.

[0148] Immunofluorescence images further confirmed that compared with the TGF-β group, the fluorescence signal of vimentin in the Exos-SIRT1 group was lower and the fluorescence signal of Nrf2 was higher ( Figure 3 D). The expression level of Nrf2 was negatively correlated with the mesenchymal marker vimentin. This suggests that the anti-oxidative stress pathway was inhibited in MAECs undergoing EndMT. After Exos-SIRT1 treatment, the anti-oxidative stress pathway was activated, while EndMT was inhibited, suggesting that Exos-SIRT1 may activate the Nrf2 pathway by delivering SIRT1 in MAECs.

[0149] 3. Study on the efficacy of Exos-SIRT1-VEGF in vivo

[0150] The effects of Exos-SIRT1-VEGF on AS model were investigated. APOE- / - mice were fed a high-fat diet for 12 weeks and injected with Exos, Exos-SIRT1 or Exos-SIRT1-VEGF (1×10 10 particles / mouse) starting from week 9, twice a week for 4 consecutive weeks ( Figure 4 A). The results showed that the body weight of patients in each group was similar during treatment ( Figure 4 B). Compared with the Exos-SIRT1 group, Exos group and PBS group, Exos-SIRT1-VEGF can effectively alleviate lipid metabolism disorders ( Figure 4 C). In addition, OilRed O (ORO) staining of whole aorta showed that Exos-SIRT1-VEGF treatment significantly reduced the area of ​​atherosclerotic lesions compared with Exos-SIRT1, Exos, and PBS groups ( Figure 4 D).

[0151] To further analyze the composition of atherosclerotic lesions, we used ORO, Movet, and hematoxylin-eosin (HE) staining to detect plaque area and aortic root core necrosis. Consistent with previous results, ORO, Movet, and HE staining showed that the Exos-SIRT1-VEGF group had the smallest plaque size, plaque percentage, and collagen content in the necrotic core area ( Figure 4 E and 4F). In addition, compared with the Exos-SIRT1, Exos, and PBS groups, the number of vimentin-positive cells was significantly decreased and the number of VE-cadherin-positive cells was significantly increased after Exos-SIRT1-VEGF treatment ( Figure 4 G and 4H). Subsequently, the number of SIRT1-positive cells in the Exos-SIRT1-VEGF group increased significantly compared with the number of positive cells in the Exos-SIRT1, Exos, and PBS groups ( Figure 4 I and 4J). These results indicate that Exos-SIRT1-VEGF successfully delivered SIRT1 to the aorta via systemic injection and effectively alleviated EndMT in the aorta of APOE- / - mice.

[0152] In order to detect whether systemic administration of exosomes affects in vivo biosafety, HE staining of mouse organs (heart, liver, spleen, lung, and kidney) was performed. The results showed that there were no significant differences in the morphological and structural characteristics of the organs among the groups. In addition, the levels of RBC, HGB, WBC, PLT, ALT, AST, A1b, Cr, and urea in serum were similar among the groups.

Claims

1. A SIRT1-modified engineered mesenchymal stem cell exosome, comprising bone marrow mesenchymal stem cell exosomes, SIRT1 protein expressed on the exosomes, and a modified aptamer (VEGF-Chol), wherein the aptamer has a gene sequence as shown below in SEQ ID NO.1, and a cholesterol CHol is connected to the 3' end, SEQ ID NO.1 5'-CCATACCGGACGCCTAAACC GACCGTAGAAAAA-3'-Chol.

2. The exosome according to claim 1, wherein the gene encoding the SIRT1 protein has the sequence shown in SEQ ID NO.

2.

3. A method for preparing engineered mesenchymal stem cell exosomes according to claim 1 or 2, comprising the following steps: 1) Cultivate BMSCs cells to 50% confluence and replace the culture medium; 2) adding the recombinant SIRT1 gene adenovirus and the infection-aiding agent to the culture medium replaced in the previous step for culturing; 3) SIRT1 gene adenovirus was transmitted into BMSCs cells, the culture medium was changed, and the culture was continued; 4) When the BMSCs cells are cultured in a medium containing normal serum to a confluence of 60%-70%, they are replaced with a fresh medium containing exosome-free serum, and the culture is continued. The cell supernatant is collected, centrifuged to remove larger cell debris, and then centrifuged again to remove the cell debris completely; 5) The supernatant after removing the cell debris is centrifuged to remove the large vesicles, and the supernatant is used to precipitate the exosomes by high-speed centrifugation; 6) Further purifying the exosomes obtained in the previous step to obtain pure exosomes; 7) The exosomes are resuspended in PBS, and the cholesterol-modified aptamer is added for co-incubation. After the incubation is completed, the mixture is centrifuged to obtain the engineered bone marrow mesenchymal stem cell exosomes overexpressing SIRT1 connected to the aptamer.

4. The preparation method according to claim 1, wherein the infection-promoting agent in step 2) is Polybrene.

5. The preparation method according to claim 1, wherein the culture is continued as described in step 3), and the liquid is replaced every 3 days as usual.

6. The preparation method according to claim 1, wherein the continued culturing in step 4) is for 48 hours, and the infection efficiency is optionally detected by qRT-PCR and western blotting.

7. The preparation method according to claim 1, wherein the further purification in step 6) refers to filtering the resuspended exosomes with a 0.22 μm filter and centrifuging at 100,000×g at 4°C for 90 min.

8. The preparation method according to claim 1, wherein the co-incubation in step 7) is to add 250 μL of exosome suspension (4×10 9 particles / mL) were incubated with 250 μL of aptamer (10 nM) for 30 min.

9. Use of the SIRT1-modified engineered mesenchymal stem cell exosomes according to claim 1 or 2 in the preparation of a drug for treating atherosclerosis.

Images