N-oxygenase double-site mutant and application thereof in synthesis of nitromycin

Abstract

The invention discloses an N-oxygenase double-site mutant and application thereof in synthesis of nitromycin, and belongs to the technical field of enzyme engineering. The invention provides an N-oxygenase double-site mutant with high catalytic activity in order to solve the problem that in the prior art, in the process that N-oxygenase catalyzes 2-aminoimidazole to synthesize nitromycin, the yield and the yield of catalytically synthesized nitromycin are low. The N-oxygenase double-site mutant provided by the invention has the advantages that the yield and the yield of the nitromycin synthesized by the N-oxygenase double-site mutant are 1.68 mM and 42% and are respectively increased by 2.8 times and 2.3 times compared with those of wild N-oxygenase, the highest level of the nitromycin synthesized by a known biological method at present is achieved, and a new biological catalysis tool is provided for the synthesis of the nitromycin.

Description

Technical Field

[0001] The invention belongs to the technical field of enzyme engineering, and in particular relates to an N-oxygenase double-site mutant and application thereof in synthesizing nitromycin. Background Art

[0002] Azomycin, or 2-nitroimidazole, is a nitroimidazole organic compound and the first discovered nitroimidazole antibiotic. It is widely used in the medical field and has been shown to have good resistance to Trichomonas vaginalis and the like. It can be used as a radiosensitizer in tumor treatment and can also be used to synthesize some polynitroimidazole explosives. At present, the preparation of azomycin mainly uses the traditional chemical synthesis method, which uses S-methylisothiourea sulfate or O-methylisourea sulfate and aminoacetaldehyde dimethyl acetal as the initial raw materials to synthesize 2-aminoimidazole sulfate, and then uses copper sulfate as a catalyst under acidic conditions to synthesize the final product azomycin. However, this synthesis method is complicated, uses a large amount of organic reagents, including ethyl acetate, ethanol, etc., and produces a large amount of HCl, HBF4 waste acid and metal wastewater, which brings dangers to operation and use; at the same time, this synthesis method has a low yield, only about 30%.

[0003] Under the requirements of green chemistry, a new method for synthesizing nitrogen enzymes is urgently needed. In recent years, biocatalysis (enzyme catalysis) has been popularized as a sustainable technology. The biosynthesis method is green and environmentally friendly, with mild reaction conditions, no concentrated acid, organic solvents, or metal catalysts, good product specificity, and few by-products. Studies have shown that N-oxygenase (RohS) from Streptomyces cattleya DSMZ 46488 can catalyze the oxidation of 2-aminoimidazole to nitromycin, but its catalytic efficiency is extremely low (recorded in Hedges, Jason B, Ryan, Katherine S. In vitro Reconstitution of the Biosynthetic Pathway to the Nitroimidazole Antibiotic Azomycin. [J]. Angewandte Chemie International Edition. 2019, Vol. 58 (No. 34): 11647-11651.). Summary of the invention

[0004] In order to solve the problem of low yield and low production rate of N-oxygenase in the process of catalyzing the synthesis of nitromycin from 2-aminoimidazole in the prior art, the present invention provides an N-oxygenase double-site mutant and its application in the synthesis of nitromycin.

[0005] The specific technical solutions of the present invention are as follows:

[0006] One of the purposes of the present invention is to provide a double-site mutant of N-oxygenase, the amino acid sequence of the mutant is shown in SEQ ID NO.1.

[0007] The second object of the present invention is to provide a double-site mutant of N-oxygenase, the mutant coding sequence is shown in SEQ ID NO.2.

[0008] The third object of the present invention is to provide an expression vector containing the above coding sequence.

[0009] It is further defined that the starting plasmid for constructing the expression vector is pETDuet-1.

[0010] A fourth object of the present invention is to provide a recombinant bacterium containing the above expression vector.

[0011] It is further defined that the host bacteria for constructing the recombinant bacteria is Escherichia coli.

[0012] A fifth object of the present invention is to provide the use of the above-mentioned N-oxygenase double-site mutant, coding sequence, expression vector or recombinant bacteria in the synthesis of nitrogenase.

[0013] The sixth object of the present invention is to provide a method for synthesizing nitrogenase, wherein 2-aminoimidazole and the above-mentioned recombinant bacteria containing the N-oxygenase double-site mutant are added to a reaction system containing FeSO4·7H2O, phenazine methosulfate, NADH and HEPES buffer solution to synthesize nitrogenase.

[0014] Further defined, the concentration of the recombinant bacteria is 10-100 OD 600 .

[0015] It is further defined that the concentration of 2-aminoimidazole is 2-20 mM.

[0016] It is further defined that the concentration of FeSO4·7H2O is 1-10 mM.

[0017] It is further defined that the concentration of phenazine methosulfate is 50 μM.

[0018] It is further defined that the concentration of the NADH buffer solution is 5-50 mM.

[0019] It is further defined that the concentration of the HEPES buffer solution is 20 mM.

[0020] It is further defined that the mass percentages of the 2-aminoimidazole, FeSO4·7H2O, phenazine methosulfate, NADH and HEPES buffer solution are 1:0.5-5:2.5-25:2.5-25:1-10.

[0021] It is further defined that the reaction temperature in the reaction system is 20-40°C.

[0022] It is further defined that the reaction time in the reaction system is 10-72h.

[0023] It is further defined that the reaction pH in the reaction system is 4.5-7.5.

[0024] Beneficial effects of the present invention:

[0025] (1) Compared with the wild-type N-oxygenase, the N-oxygenase double-site mutant provided by the present invention has a greater interaction force with the substrate, improves its binding free energy and affinity with the substrate, and proves that it has a higher catalytic activity. The yield of nitromycin synthesized by the N-oxygenase double-site mutant provided by the present invention is 1.68mM, which is 2.8 times higher than that of the wild-type N-oxygenase; its yield can reach 42%, which is 2.3 times higher than that of the wild-type N-oxygenase.

[0026] (2) Compared with traditional chemical methods, this method is green and environmentally friendly, has little pollution to the environment, simple synthesis process, mild reaction conditions and high safety. DETAILED DESCRIPTION

[0027] Those skilled in the art can refer to the content of this article and appropriately improve the process parameters. It should be particularly noted that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content and scope of the present invention to implement and apply the technology of the present invention.

[0028] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments. The experimental methods used in the following examples are all conventional methods unless otherwise specified, and the materials, reagents, methods and instruments used are all conventional materials, reagents, methods and instruments in the art unless otherwise specified, and those skilled in the art can obtain them through commercial channels.

[0029] The culture medium used in the present invention is prepared as follows:

[0030] LB liquid medium: 5 g / L yeast powder, 10 g / L NaCl, 10 g / L peptone, 1 mL 1 mol / L sodium hydroxide aqueous solution to adjust pH = 7, dilute to 1 L with deionized water, and sterilize under high pressure steam for 20 min;

[0031] LB solid medium: 5 g / L yeast powder, 10 g / L NaCl, 10 g / L peptone, 15 g / L agar, 1 mL 1 mol / L sodium hydroxide aqueous solution to adjust pH = 7, dilute to 1 L with deionized water, and sterilize under high pressure steam for 20 min;

[0032] Shake flask fermentation medium: 20 g / L glucose, 5 g / L yeast powder, 10 g / L NaCl, 10 g / L peptone, 1 mL 1 mol / L sodium hydroxide aqueous solution to adjust pH = 7, dilute to 1 L with deionized water, and steam sterilize under high pressure for 20 min.

[0033] Example 1: A double-site mutant of N-oxygenase and its coding sequence

[0034] This embodiment provides a double-site mutant of N-oxygenase for improving the production and yield of nitrogenase, and the amino acid sequence of the mutant is shown in SEQ ID NO.1.

[0035] The double mutation in the above double-site mutant refers to: based on the amino acid sequence of N-oxygenase SaRohS from Saccharothrix sp. (as shown in SEQ ID NO.3), the glycine (G) at position 95 is mutated to alanine (A), and the lysine (K) at position 115 is mutated to threonine (T) to obtain the N-oxygenase double-site mutant.

[0036] This example also provides the coding sequence of the above-mentioned N-oxygenase double-site mutant, and the coding sequence of the mutant is shown in SEQ ID NO.2.

[0037] The double mutation in the above mutant coding sequence refers to: based on the coding sequence of N-oxygenase SaRohS derived from Saccharothrix sp. (as shown in SEQ ID NO.4), the guanine (G) at position 282 is mutated to cytosine (C), and the adenine (A) at position 344 is mutated to cytosine (C).

[0038] Example 2: A method for preparing an expression vector containing the mutant described in Example 1

[0039] S1: The N-oxygenase (SaRohS) gene sequence from Sacharothrix sp. was codon optimized, and the SaRohS gene (as shown in SEQ ID NO.4) was synthesized by Suzhou GeneWeizhi Company, and pETDuet-1 was used as the starting plasmid to obtain the pETDuet-SaRohS expression vector;

[0040] S2: Using the SaRohS gene synthesized in S1 as a template, primers were designed and site-directed mutagenesis of SaRohS was performed using the Novagen Fast Mutagenesis Kit V2 kit;

[0041] S3: Using the pETDuet-SaRohS expression vector obtained in S1 as a template, using G95A-F:AAACACGCGCTTAAACGGGACCTACCG (as shown in SEQ ID NO.5) and G95A-R:CGTTTAAGCGCGTGTTTTGACGCTTTG (as shown in SEQ ID NO.6) as upstream and downstream primers, amplify and obtain pETDuet-SaRohS G95A Recombinant plasmid; PCR amplification system was carried out in a total volume of 49.3uL, the PCR amplification system was 0.5uL of template, 1uL of upstream and downstream primers, 1uL of Dntp max, 1uL of Phanta max, 25uL of Max buffer, and 20.8uL of ddH2O; the PCR amplification program was 95℃5min, 30 cycles (95℃30s, 65℃30s, 72℃5min), 72℃10min, and 12℃ insulation;

[0042] S4: pETDuet-SaRohS obtained in S3 G95A The recombinant plasmid was transformed into E. coli DH5α and the culture medium containing 100 μg mL -1 The LB solid plate containing ampicillin was cultured in a 37°C constant temperature incubator, and a single colony was selected for culture and then the plasmid was extracted and sequenced to obtain pETDuet-SaRohS G95A Expression vector;

[0043] S5: pETDuet-SaRohS obtained in S4 G95A The expression vector was used as a template, and K115T-F: GCCGATTACAAGCCAAATGGCGCTGATGCGCG (as shown in SEQ ID NO.7) and K115T-R: TTTGGCTTGTAATCGGCACGCGCATCACCGCC (as shown in SEQ ID NO.8) were used as upstream and downstream primers to amplify and obtain pETDuet-SaRohS G95A / K115T The recombinant plasmid, amplification system and procedure were the same as above;

[0044] S6: pETDuet-SaRohS obtained in S5 G95A / K115T The recombinant plasmid was transformed into E. coli DH5α and the culture medium containing 100 μg mL -1The LB solid plate containing ampicillin was cultured in a 37°C constant temperature incubator, and a single colony was selected for culture and then the plasmid was extracted and sequenced to obtain pETDuet-SaRohS G95A / K115T Expression vector.

[0045] Example 3: A method for preparing a recombinant bacterium containing the expression vector described in Example 2

[0046] S1: pETDuet-SaRohS obtained in Example 2 G95A / K115T The expression vector was introduced into E. coli BL21 (DE3) competent cells using a medium containing 100 μg mL -1 The LB solid plate containing ampicillin was cultured in a constant temperature incubator at 37°C to screen out single colonies; then, a single colony was picked and streaked on the solid LB plate, and cultured in a constant temperature incubator at 37°C until a single colony grew again. The single colony grown for the second time was used as a template for colony PCR identification, using F: GATGCGTCCGGCGTAGAGC (as shown in SEQ ID NO.9) and R: GCTAGTTATTGCTCAGCGG (as shown in SEQ ID NO.10) as upstream and downstream primers, and the amplification system and procedure were the same as in Example 2 to obtain Escherichia coli E. coli BL21 (pETDuet-SaRohS G95A / K115T );

[0047] S2: E. coli BL21 (pETDuet-SaRohS G95A / K115T ) A single colony was inoculated in a solution containing 100 μg mL -1 In LB liquid medium containing ampicillin, the cells were activated and cultured at 37°C and 200 rpm for 10 h to obtain seed solution;

[0048] S3: The seed solution obtained in S2 was inoculated at a 10% inoculum into a flask containing 100 μg mL -1 The culture was carried out in shake flask fermentation medium containing ampicillin at 37°C and 200 rpm until OD 600 When the p-value reached 0.6, the temperature was adjusted to 16°C, and 0.05 mM IPTG was added for induction. The culture was continued for 16 h, and the cells were collected by centrifugation at 4°C and 8000 rpm for 5 min to obtain SaRohS containing a double-site mutant of N-oxygenase. G95A / K115T Recombinant bacteria.

[0049] Example 4: Application of N-oxygenase double-site mutant in the synthesis of nitromycin and content determination

[0050] The SaRohS containing the double-site mutant of N-oxygenase obtained in Example 3 wasG95A / K115T The recombinant bacteria were resuspended in HEPES buffer (20 mM) at pH 7.4 to a concentration of 20 OD. 600 Then, 2-aminoimidazole (4 mM), FeSO4·7H2O (2 mM), phenazine methosulfate (50 μM) and NADH (5 mM) were added, and the mixture was reacted at 25°C and pH = 5.5 for 12 h to obtain an nitromycin reaction solution.

[0051] Determination of nitromycin content:

[0052] Take 1 mL of the nitromycin reaction solution obtained in Example 4, centrifuge at 10000 rpm for 10 min, retain the supernatant, and analyze its content by high performance liquid chromatography. The liquid chromatography detection conditions are as follows: the chromatographic column adopts Luna C1, 325 nm ultraviolet detector, mobile phase A is water and 0.1% TFA, and mobile phase B is acetonitrile and 0.1% TFA; the elution program is: 0-5 min 90:10, 5-6 min 90:10 to 0:100, 6-10 min 0:100, 10-15 min 90:10, the flow rate is 0.5 ml / min, the injection volume is 5 μ L, and the final measured nitromycin yield is 1.68 mM, and the yield is 42%.

[0053] Comparative Example: Application of wild-type N-oxygenase in the synthesis of nitromycin and content determination

[0054] The wild-type N-oxygenase expression vector pETDuet-SaRohS obtained in Example 2 was introduced into E. coli BL21 (DE3) competent cells according to the method of Example 3, and the SaRohS recombinant bacteria containing the wild-type N-oxygenase were obtained after culture. Then, the reaction was carried out for 24 hours according to the method in Example 4 to synthesize nitromycin, and the nitromycin content was determined according to the method in Example 4. The final nitromycin production was measured to be 0.6 mM, and the yield was 18%.

[0055] The contents not described in detail in the specification of the present invention are well-known technologies for those skilled in the art. Although the present invention has been disclosed as above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be based on the definition of the claims.

Claims

1. A double-site mutant of N-oxygenase, characterized in that: The amino acid sequence of the mutant is shown in SEQ ID NO.

1.

2. A double-site mutant of N-oxygenase, characterized in that: The mutant coding sequence is shown in SEQ ID NO.

2.

3. An expression vector, characterized in that: The expression vector contains the coding sequence according to claim 2.

4. The expression vector according to claim 3, characterized in that The starting plasmid for constructing the expression vector is pETDuet-1.

5. A recombinant bacterium, characterized in that: The recombinant bacteria contains the expression vector according to claim 3.

6. The recombinant bacterium according to claim 5, characterized in that The host bacteria for constructing the recombinant bacteria is Escherichia coli.

7. Use of the N-oxygenase double-site mutant according to claim 1 or 2, the expression vector according to claim 3 or the recombinant bacterium according to claim 5 in synthesizing nitrogenase.

8. A method for synthesizing nitrogenase, characterized in that: The method comprises the following steps: adding 2-aminoimidazole and the recombinant bacteria according to claim 5 to a reaction system containing FeSO4·7H2O, phenazine methosulfate, NADH and HEPES buffer solution to synthesize nitromycin.

9. The method according to claim 8, characterized in that The recombinant bacteria concentration is 10-100 OD 600 , 2-aminoimidazole concentration was 2-20 mM, FeSO4·7H2O concentration was 1-10 mM, phenazine methosulfate concentration was 50 μM, NADH concentration was 5-50 mM, and HEPES concentration was 20 mM.

10. The method according to claim 8, characterized in that The mass percentages of 2-aminoimidazole, FeSO4·7H2O, phenazine methosulfate, NADH and HEPES buffer solution in the reaction system are 1:0.5-5:2.5-25:2.5-25:1-10; the reaction temperature is 20-40°C, the reaction time is 10-72h, and the reaction pH is 4.5-7.5.