A n-oxygenase double site mutant and its use in synthesis of nitrocanine

Abstract

The application relates to an N-oxygenase double-site mutant and application thereof in synthesis of nitrogen mustard, and belongs to the technical field of enzyme engineering. In order to solve the problem that the yield and the yield rate of N-oxygenase in catalyzing 2-aminoimidazole to synthesize nitrogen mustard are low in the prior art, the application provides an N-oxygenase double-site mutant with high catalytic activity. The yield and the yield rate of nitrogen mustard synthesized by the N-oxygenase double-site mutant are 1.68 mM and 42%, which are respectively increased by 2.8 times and 2.3 times compared with those of wild-type N-oxygenase, are the highest level of known biological synthesis of nitrogen mustard at present, and provide a new biological catalysis tool for synthesis of nitrogen mustard.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of enzyme engineering, and particularly relates to a double-site mutant of N-oxygenase and application thereof in synthesis of azomycin. BACKGROUND

[0002] Azomycin, i.e. 2-nitroimidazole, is a nitroimidazole organic compound, and is the first discovered nitroimidazole antibiotic, which has a wide application in the medical field, has been proved to have good resistance to Trichomonas vaginalis, can be used as a radiosensitizer in tumor treatment, and can be used for synthesizing some polynitroimidazole explosives. At present, azomycin is mainly prepared by using a traditional chemical synthesis method. In the process, S-methyl isothiourea sulfate or O-methyl isourea sulfate and aminoacetaldehyde dimethyl acetal are used as initial raw materials to synthesize 2-aminoimidazole sulfate, and then copper sulfate is used as a catalyst to synthesize the end product azomycin under acidic conditions. However, this synthesis method is complex, a large amount of organic reagents, including ethyl acetate, ethanol, etc., are used, and a large amount of HCl, HBF4 waste acid and metal wastewater are generated, which brings danger to operation and use; at the same time, the yield of this synthesis method is low, only about 30%.

[0003] Under the requirement of green chemistry, a new method for synthesizing azomycin is urgently needed. In recent years, biocatalysis (enzyme catalysis) as a sustainable technology has been popularized. The biological synthesis method is green and environmentally friendly, the reaction conditions are mild, no concentrated acid, organic solvent or metal catalyst is used, the product specificity is good, and the by-product is less. Studies have shown that N-oxygenase (RohS) from Streptomyces cattleya DSMZ 46488 can catalyze the oxidation of 2-aminoimidazole to azomycin, but its catalytic efficiency is very low (recorded in Hedges, Jason B, Ryan, Katherine S. In vitro Reconstitution of the Biosynthetic Pathway to the Nitroimidazole Antibiotic Azomycin. [J]. Angewandte Chemie International Edition. 2019, Vol. 58 (No. 34): 11647-11651.). SUMMARY

[0004] In order to solve the problem of low yield and low yield of N-oxygenase in the process of catalyzing 2-aminoimidazole to synthesize azomycin in the prior art, the application provides a double-site mutant of N-oxygenase and application thereof in synthesis of azomycin.

[0005] The specific technical scheme of the application is as follows:

[0006] One of the purposes of the present application is to provide a N-oxygenase double site mutant, the amino acid sequence of which is shown in SEQ ID NO. 1.

[0007] The second purpose of the present application is to provide a N-oxygenase double site mutant, the coding sequence of which is shown in SEQ ID NO. 2.

[0008] The third purpose of the present application is to provide an expression vector containing the above-mentioned coding sequence.

[0009] Further limitation, the starting plasmid for constructing the expression vector is pETDuet-1.

[0010] The fourth purpose of the present application is to provide a recombinant bacterium containing the above-mentioned expression vector.

[0011] Further limitation, the host bacterium for constructing the recombinant bacterium is Escherichia coli.

[0012] The fifth purpose of the present application is to provide the use of the above-mentioned N-oxygenase double site mutant, coding sequence, expression vector or recombinant bacterium in the synthesis of nitrogenase.

[0013] The sixth purpose of the present application is to provide a method for synthesizing nitrogenase, which is synthesized by adding 2-aminoimidazole and the above-mentioned recombinant bacterium containing N-oxygenase double site mutant in a reaction system containing FeSO4·7H2O, phenazine methosulfate, NADH and HEPES buffer solution.

[0014] Further limitation, the concentration of the recombinant bacterium is 10-100 OD 600 .

[0015] Further limitation, the concentration of 2-aminoimidazole is 2-20 mM.

[0016] Further limitation, the concentration of FeSO4·7H2O is 1-10 mM.

[0017] Further limitation, the concentration of phenazine methosulfate is 50 μM.

[0018] Further limitation, the concentration of NADH buffer solution is 5-50 mM.

[0019] Further limitation, the concentration of HEPES buffer solution is 20 mM.

[0020] Further limitation, the mass percentage of 2-aminoimidazole, FeSO4·7H2O, phenazine methosulfate, NADH and HEPES buffer solution is 1:0.5-5:2.5-25:2.5-25:1-10.

[0021] Further limitation, the reaction temperature in the reaction system is 20-40℃.

[0022] Further limitation, the reaction time in the reaction system is 10-72h.

[0023] Further limitation, the reaction pH in the reaction system is 4.5-7.5.

[0024] The beneficial effects of the present application are:

[0025] (1) The N-oxygenase double site mutant provided by the present application has greater interaction force with the substrate than the wild type N-oxygenase, improves the binding free energy and the affinity with the substrate, and proves to have higher catalytic activity. The yield of nitrogen mycin synthesized by the N-oxygenase double site mutant provided by the present application is 1.68mM, which is 2.8 times higher than that of the wild type N-oxygenase. The yield can reach 42%, which is 2.3 times higher than that of the wild type N-oxygenase.

[0026] (2) Compared with the traditional chemical method, the method is green and environmentally friendly, has small environmental pollution, simple synthesis process, mild reaction conditions and high safety. DETAILED DESCRIPTION

[0027] Those skilled in the art can improve the process parameters as appropriate based on the content herein. It should be particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are considered to be included in the present application. The method and application of the present application have been described by the preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content and scope of the present application, to realize and apply the present application technology.

[0028] In order to make the purpose, technical scheme and advantages of the present application more clear, the present application will be further described in detail below in combination with specific embodiments. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, methods and instruments used are conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained by commercial channels by those skilled in the art.

[0029] The culture medium used in the present application is prepared as follows:

[0030] LB liquid medium: 5g / L yeast powder, 10g / L NaCl, 10g / L peptone, 1mL 1mol / L sodium hydroxide aqueous solution to adjust pH=7, and deionized water to 1L, high pressure steam sterilization for 20min;

[0031] LB solid medium: 5 g / L yeast powder, 10 g / L NaCl, 10 g / L peptone, 15 g / L agar, 1 mL 1 mol / L sodium hydroxide aqueous solution to adjust pH = 7, constant volume to 1 L with deionized water, high-pressure steam sterilization for 20 min;

[0032] Shaking flask fermentation medium: 20 g / L glucose, 5 g / L yeast powder, 10 g / L NaCl, 10 g / L peptone, 1 mL 1 mol / L sodium hydroxide aqueous solution to adjust pH = 7, constant volume to 1 L with deionized water, high-pressure steam sterilization for 20 min.

[0033] Example 1: A double-site mutant of N-oxygenase and a coding sequence thereof

[0034] The present example provides a double-site mutant of N-oxygenase for improving the yield and productivity of nitrogenase, and the amino acid sequence of the mutant is shown in SEQ ID NO. 1.

[0035] The double mutation in the above-mentioned double-site mutant refers to: based on the amino acid sequence of N-oxygenase SaRohS derived from Saccharothrix sp. (as shown in SEQ ID NO. 3), the glycine (G) at position 95 is mutated to alanine (A), and the lysine (K) at position 115 is mutated to threonine (T) to obtain the double-site mutant of N-oxygenase.

[0036] The present example also provides a coding sequence of the above-mentioned double-site mutant of N-oxygenase, and the coding sequence of the mutant is shown in SEQ ID NO. 2.

[0037] The double mutation in the above-mentioned mutant coding sequence refers to: based on the coding sequence of N-oxygenase SaRohS derived from Saccharothrix sp. (as shown in SEQ ID NO. 4), the guanine (G) at position 282 is mutated to cytosine (C), and the adenine (A) at position 344 is mutated to cytosine (C).

[0038] Example 2: A preparation method of an expression vector containing the mutant of Example 1

[0039] S1: The gene sequence of N-oxygenase (SaRohS) derived from Saccharothrix sp. is codon-optimized, and the SaRohS gene (as shown in SEQ ID NO. 4) is synthesized by Suzhou Jinweizhi Company, and pETDuet-1 is used as the starting plasmid to obtain the pETDuet-SaRohS expression vector;

[0040] S2: Using SaRohS gene synthesized in S1 as a template, designing primers, and using Novagen Fast Mutagenesis Kit V2 kit to perform site-directed mutagenesis on SaRohS;

[0041] S3: Using pETDuet-SaRohS expression vector obtained in S1 as a template, using G95A-F: AAACACGCGCTTAAACGGGACCTACCG (as shown in SEQ ID NO. 5) and G95A-R: CGTTTAAGCGCGTGTTTTGACGCTTTG (as shown in SEQ ID NO. 6) as upstream and downstream primers, and amplifying to obtain pETDuet-SaRohS G95A The PCR amplification system was performed in a total volume of 49.3 uL, and the PCR amplification system was 0.5 uL of template, 1 uL of each of the upstream and downstream primers, 1 uL of Dntp max, 1 uL of Phanta max, 25 uL of Max buffer, and 20.8 uL of ddH2O. The PCR amplification program was 95°C for 5 min, 30 cycles (95°C for 30 s, 65°C for 30 s, 72°C for 5 min), 72°C for 10 min, and 12°C for 10 min.

[0042] S4: Using pETDuet-SaRohS G95A The recombinant plasmid was transformed into E. coli DH5a, and LB solid plates containing 100 ug / mL -1 amoxicillin were cultured in a 37°C constant temperature incubator, and single colonies were selected for culture and plasmid extraction for sequencing confirmation to obtain pETDuet-SaRohS G95A expression vector;

[0043] S5: Using pETDuet-SaRohS G95A expression vector as a template, using K115T-F: GCCGATTACAAGCCAAATGGCGCTGATGCGCG (as shown in SEQ ID NO. 7) and K115T-R: TTTGGCTTGTAATCGGCACGCGCATCACCGCC (as shown in SEQ ID NO. 8) as upstream and downstream primers, and amplifying to obtain pETDuet-SaRohS G95A / K115T recombinant plasmid, amplification system and program as above;

[0044] S6: Using pETDuet-SaRohS G95A / K115T The recombinant plasmid was transformed into E. coli DH5a, and LB solid plates containing 100 ug / mL -1LB solid plate of ampicillin was incubated in a constant temperature incubator at 37℃, and single colonies were screened and cultured to extract plasmid for sequencing confirmation, obtaining pETDuet-SaRohS G95A / K115T Expression vector.

[0045] Example 3: A preparation method of recombinant bacteria containing the expression vector of Example 2

[0046] S1: The pETDuet-SaRohS G95A / K115T The expression vector was introduced into E. coli BL21 (DE3) competent cells, and LB liquid medium containing 100 μg·mL-1 ampicillin was used for activation culture at 37℃ and 200 rpm for 10 h. -1 LB solid plate of ampicillin was incubated in a constant temperature incubator at 37℃, and single colonies were screened and cultured to extract plasmid for sequencing confirmation, obtaining pETDuet-SaRohS G95A / K115T );

[0047] S2: The single colony of E. coli BL21 (pETDuet-SaRohS G95A / K115T ) obtained in S1 was inoculated into LB liquid medium containing 100 μg·mL-1 ampicillin, and activation culture was carried out at 37℃ and 200 rpm for 10 h to obtain seed liquid. -1

[0048] S3: The seed liquid obtained in S2 was inoculated into a flask fermentation medium containing 100 μg·mL-1 ampicillin at an inoculation amount of 10%, and culture was carried out at 37℃ and 200 rpm until OD -1 reached 0.6, then the temperature was adjusted to 16℃, and 0.05 mM IPTG was further added for induction, and culture was continued for 16 h. 600 The bacteria were collected by centrifugation at 4℃ and 8000 rpm for 5 min to obtain SaRohS G95A / K115T Recombinant bacteria.

[0049] Example 4: Application of N-oxygenase double-site mutant in synthesis of nitrogen mustard and content determination

[0050] The SaRohS​G95A / K115T The recombinant bacteria were resuspended in HEPES buffer (20 mM) at pH = 7.4 to make the concentration of the bacteria 20 OD 600 Then 2-aminoimidazole (4 mM), FeSO4·7H2O (2 mM), phenazine methosulfate (50 μM) and NADH (5 mM) were added, and the reaction was carried out at 25 °C and pH = 5.5 for 12 h to obtain the nitramine reaction solution.

[0051] Nitramine content determination:

[0052] 1 mL of the nitramine reaction solution obtained in Example 4 was centrifuged at 10,000 rpm for 10 min, and the supernatant was reserved. The supernatant was analyzed for content by high performance liquid chromatography. The liquid chromatography detection conditions were as follows: the chromatographic column was Luna Cl, the ultraviolet detector was 325 nm, the mobile phase A was water and 0.1% TFA, and the mobile phase B was acetonitrile and 0.1% TFA; the elution program was as follows: 0-5 min 90:10, 5-6 min 90:10 to 0:100, 6-10 min 0:100, 10-15 min 90:10, the flow rate was 0.5 ml / min, the injection volume was 5 μL, and finally the yield of the nitramine was determined to be 1.68 mM, and the yield was 42%.

[0053] Comparative Example: Application of wild-type N-oxygenase in synthesis of nitramine and content determination

[0054] The wild-type N-oxygenase expression vector pETDuet-SaRohS obtained from Example 2 was introduced into E. coli BL21 (DE3) competent cells according to the method of Example 3, and after cultivation, the recombinant bacteria containing the wild-type N-oxygenase SaRohS were obtained. Then, the reaction was carried out for 24 h according to the method of Example 4 to synthesize nitramine, and the content of the nitramine was determined according to the method of Example 4. Finally, the yield of the nitramine was determined to be 0.6 mM, and the yield was 18%.

[0055] The content not described in detail in the specification of the present application is the technology known to those skilled in the art. Although the present application has been disclosed with reference to the preferred embodiments above, it is not intended to limit the present application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application. Therefore, the protection scope of the present application should be defined by the claims.

Claims

1. A method of synthesizing a nitrogenase enzyme, comprising, The method is that 2-aminoimidazole and recombinant bacteria are added in a reaction system containing FeSO4.7H2O, phenazine methosulfate, NADH and HEPES buffer solution to synthesize azomycin. The concentration of the recombinant bacteria is 10-100 OD 600 2-aminoimidazole is 2-20 mM, FeSO4-7H2O is 1-10 mM, phenazine methosulfate is 50 μM, NADH is 5-50 mM, and HEPES is 20 mM. The reaction temperature is 20-40 DEG C, the reaction time is 10-72 h, and the reaction pH is 4.5-7.

5. The recombinant bacteria contain an expression vector with a starting plasmid pETDuet-1, and the expression vector contains a coding sequence as shown in SEQ ID NO. 2.