Application of miR-31-5p mimics in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci

Abstract

The present invention discloses the application of miR-31-5p mimics in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, and belongs to the technical field of biological control of Bemisia tabaci. The present invention reversely regulates the expression of genes related to the immunity, metabolism, and redox pathways of Bemisia tabaci by feeding the miR-31-5p mimics synthesized by Bemisia tabaci, and enhances the killing effect of Metarhizium anisopliae on Bemisia tabaci by weakening the immune system and metabolic capacity of Bemisia tabaci, thereby providing a new and effective strategy for biological control of Bemisia tabaci under natural conditions; feeding the miR-31-5p mimics provided by the present invention can significantly reduce the survival rate of Bemisia tabaci infected with Metarhizium anisopliae, while the survival rate of Bemisia tabaci infected by feeding a miR-31-5p antagonist is significantly increased, indicating that the miR-31-5p mimics provided by the present invention can significantly enhance the killing effect of Metarhizium anisopliae on Bemisia tabaci.

Description

Technical Field

[0001] The present invention relates to the technical field of biological control of Bemisia tabaci, and in particular to the application of a miR-31-5p mimic in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci. Background Art

[0002] The whitefly (Bemisia tabaci) is a highly invasive global agricultural pest that damages plants by sucking plant sap, secreting honeydew, and transmitting plant viruses. Current control of whiteflies relies primarily on chemical pesticides. However, repeated exposure to pesticides and biotype variations have led to the rapid development of pesticide resistance, making outbreaks difficult to control. This increases manual control costs and pesticide usage, while simultaneously increasing pesticide resistance. Therefore, it is urgent to explore new, green control methods to control whiteflies and reduce reliance on pesticides.

[0003] Entomogenous fungi are an important part of biological control, such as Beauveria bassiana, Metarhizium anisopliae, Paecilomyces oxysporum, and Verticillium truncatum. They not only promote the sustainable development of agriculture, but also play an important role in controlling agricultural pests. Laboratory experiments have shown that Metarhizium anisopliae has a killing effect on whiteflies, especially against whiteflies carrying cucurbit yellow chlorosis virus (CCYV), with a higher mortality rate, and Metarhizium anisopliae can affect the composition of the symbiotic bacterial community in whiteflies. However, due to the complexity and diversity of the natural environment and the special innate immune structure of the waxy powder layer on the surface of whiteflies, Metarhizium anisopliae has a poor control effect on whiteflies under natural conditions. Therefore, improving the control ability of Metarhizium anisopliae is the key to using Metarhizium anisopliae for biological control of whiteflies under natural conditions.

[0004] miRNAs are a class of small RNA molecules (sRNAs) approximately 19-25 nucleotides long that regulate gene expression at the post-transcriptional level. They are widely involved in biological processes such as development, immunity, and host-pathogen interactions. After forming a RISC complex with their target genes, miRNAs bind to them through complementary base pairing. After cleavage by Dicer 1 and Dicer 2, miRNAs degrade the target genes or inhibit translation, regulating their expression. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of miR-31-5p mimics in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, so as to solve the problem that Metarhizium anisopliae has poor control effect on Bemisia tabaci under natural conditions.

[0006] To achieve the above objectives, the present invention provides the use of a miR-31-5p mimic in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci. The RNA sequence of the miR-31-5p mimic is shown in SEQ ID NO.6.

[0007] Preferably, the working concentration of the miR-31-5p mimic is 0.2 μg / μL, and the working concentration of Metarhizium anisopliae is 10 7 -10 8 Spores / mL.

[0008] Preferably, the preparation method of the miR-31-5p mimetic is:

[0009] S1. Design four single-stranded DNA strands based on the DNA sequence of miRNA-31-5 from Bemisia tabaci and name them sense strand 1, sense strand 2, antisense strand 1, and antisense strand 2.

[0010] S2, PCR amplification is performed using a mixture of sense strand 1 and antisense strand 1 to obtain template 1; PCR amplification is performed using a mixture of sense strand 2 and antisense strand 2 to obtain template 2;

[0011] S3, performing PCR amplification with the mixture of template 1 and template 2, and performing in vitro transcription on the amplified product;

[0012] S4. Add enzyme-free water, 3M sodium acetate solution, water-saturated phenol solution and chloroform solution to the in vitro transcription product in sequence, mix well and centrifuge to obtain the supernatant, add anhydrous ethanol at -20°C overnight, then centrifuge to obtain the supernatant, wash the precipitate with 75% alcohol, and dry aseptically to obtain the miR-31-5p mimic.

[0013] Preferably, the DNA sequence of Bemisia tabaci miRNA-31-5 is shown as SEQ ID NO.1, the sequence of sense strand 1 is shown as SEQ ID NO.2, the sequence of sense strand 2 is shown as SEQ ID NO.3, the sequence of antisense strand 1 is shown as SEQ ID NO.4, and the sequence of antisense strand 2 is shown as SEQ ID NO.5.

[0014] Preferably, the PCR amplification program for amplification template 1 in S2 is denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; annealing at 10°C for 10 min; and annealing at 10°C for 10 min. The PCR amplification program for amplification template 2 is denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; and annealing at 10°C for 10 min.

[0015] Preferably, the PCR amplification program in S3 is denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; and annealing at 10°C for 10 min.

[0016] Preferably, the volume ratio of the in vitro transcription product: enzyme-free water: sodium acetate solution: water-saturated phenol solution: chloroform solution in S4 is 1:10:1:5:5.

[0017] A use of the above-mentioned Bemisia tabaci miRNA-31-5 in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci.

[0018] A whitefly control agent comprising the miR-31-5p mimic and Metarhizium anisopliae.

[0019] A method for controlling whitefly, comprising feeding whitefly with the miR-31-5p mimic, and then feeding or spraying whitefly with a concentration of 10 7 -10 8 spores / mL of Metarhizium anisopliae.

[0020] Therefore, the specific technical effects of the application of the miR-31-5p mimic provided by the present invention in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci are as follows:

[0021] (1) The present invention reversely regulates the expression of genes related to the immune, metabolic, and redox pathways of Bemisia tabaci by feeding them a miR-31-5p mimic synthesized by Bemisia tabaci. By weakening the immune system and metabolic capacity of Bemisia tabaci, the killing effect of Metarhizium anisopliae on Bemisia tabaci is enhanced, providing a new and effective strategy for the biological control of Bemisia tabaci under natural conditions.

[0022] (2) Feeding the miR-31-5p mimic provided by the present invention can significantly reduce the survival rate of whiteflies infected with Metarhizium, while the survival rate of whiteflies infected with the miR-31-5p antagonist is significantly increased, indicating that the miR-31-5p mimic provided by the present invention can significantly enhance the killing effect of Metarhizium on whiteflies. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0024] Figure 1The statistical results of miR-31-5p expression in the treatment group and the control group on days 1-5 after infection with the fungus in Example 2 of the present invention (A), the gel image of miR-31-5p mimics and siGFP (B), the statistical results of miR-31-5p expression in the whiteflies after feeding the mimics (C), and the statistical results of the survival rate of whiteflies infected with the fungus on days 1-7 after upregulation of miR-31-5p (D);

[0025] Figure 2 The statistical results of miR-31-5p expression in the treatment group and the control group of Bemisia tabaci in Example 3 of the present invention (A) and the statistical results of the survival rate of the treatment group and the control group 1-7 days after infection (B);

[0026] Figure 3 This is the statistical result of the mRNA changes in Bemisia tabaci after feeding the miR-31-5p mimic in Example 4 of the present invention;

[0027] Figure 4 These are the statistical results of changes in the expression levels of drug metabolism-related genes after feeding the miR-31-5p mimic in Example 4 of the present invention (A); the statistical results of changes in the expression levels of starch and sucrose genes (B); the statistical results of changes in the expression levels of antigen presentation and processing-related genes (C); and the statistical results of changes in the expression levels of NOD receptor genes (D). DETAILED DESCRIPTION

[0028] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0029] In order to make the purpose, technical solutions and advantages of the present application clearer, more thorough and more complete, the technical solutions of the present invention are clearly and completely described below through the accompanying drawings and Examples. The following detailed description is an explanation of the embodiments and is intended to provide further details of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the application belongs.

[0030] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels. The preparation method and components of the artificial liquid feed used in the examples, and the collection and culture method of Metarhizium anisopliae were all referenced to the 2023 master's thesis of Wang Donghuai and Zhu Chaoqiang at Henan Agricultural University; the microinsecta cages used in the examples were all modified plastic boxes with a top diameter of 5 cm, a bottom diameter of 3 cm, and a height of 3 cm; the operating methods not described in detail in the examples are conventional technical means in the art.

[0031] Example 1

[0032] Preparation of miR-31-5p mimics:

[0033] S11. Based on the DNA sequence of miRNA-31-5 from Bemisia tabaci (SEQ ID NO. 1), design four single-stranded DNA strands, respectively designated as sense strand 1 (sequence shown in SEQ ID NO. 2), sense strand 2 (sequence shown in SEQ ID NO. 3), antisense strand 1 (sequence shown in SEQ ID NO. 4), and antisense strand 2 (sequence shown in SEQ ID NO. 5). Send the sequence information to a company for sequence synthesis.

[0034] SEQ ID NO.1:AGGCAAGATGTCGGCATAGCTGA

[0035] SEQ ID NO.2:

[0036] GATCACTAATACGACTCACTATAGGGAGGCAAGATGTCGGCATAGCTGATT

[0037] SEQ ID NO.3:

[0038] GATCACTAATACGACTCACTATAGGGTCAGCTATGCCGACATCTTGCCTTT

[0039] SEQ ID NO.4:

[0040] AATCAGCTATGCCGACATCTTGCCTCCCTATAGTGAGTCGTATTAGTGATC

[0041] SEQ ID NO.5:

[0042] AAAGGCAAGATGTCGGCATAGCTGACCCTATAGTGAGTCGTATTAGTGATC

[0043] S12. Add the received sequences to the corresponding volume of sterile ddH2O according to the attached instructions to prepare solutions with a concentration of 100 μM.

[0044] 2 μL of the mixed sense chain 1 and 2 μL of the antisense chain 1 were used as template 1. After mixing evenly, PCR was performed. The PCR conditions were as follows: denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; and annealing at 10°C for 10 min. The PCR product was miR-31-5p template 1.

[0045] Using 2 μL of the evenly mixed sense chain 2 and 2 μL of the antisense chain 2 as templates, PCR was performed after mixing evenly. The PCR conditions were as follows: denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; and annealing at 10°C for 10 min. The PCR product was miR-31-5p template 2.

[0046] S13. A mixture of 2.5 μL of miR-31-5p template 1 prepared in step S12 and 2.5 μL of template 2 was prepared according to the instructions of the T7 High Yield RNA Synthesis Kit to prepare a reaction system for PCR. The PCR amplification program was 37° C. for 4 h.

[0047] To the in vitro transcription product, 300 μL of enzyme-free water, 30 μL of 3M sodium acetate solution, 150 μL of water-saturated phenol solution, and 150 μL of chloroform solution were added sequentially. The mixture was centrifuged at 13,200 rpm for 15 minutes, and the supernatant was collected. 600 μL of anhydrous ethanol was added to the supernatant, and the mixture was refrigerated at -20°C overnight. The supernatant was then centrifuged again at 13,200 rpm for 15 minutes, and the supernatant was discarded. The precipitate was washed with 75% ethanol and dried on a sterile bench. This yielded the miRNA-31-5p mimic. The RNA sequence of the miRNA-31-5p mimic is shown in SEQ ID NO. 6.

[0048] SEQ ID NO.6:AGGCAAGAUGUCGGCAUAGCUGA

[0049] Example 2

[0050] The effect of feeding the miR-31-5p mimic prepared in Example 1 on the survival rate of Bemisia tabaci was investigated. The specific steps were as follows:

[0051] S21. Dissolve 30 μg of the miR-31-5p mimic prepared in Example 1 in 300 μL of artificial liquid feed and feed the mixture to 100 3-day-old adult whiteflies using a membrane. After 2 days of feeding, the whiteflies were randomly placed into 5 micro-insect cages (20 whiteflies per micro-insect cage) as the treatment group. Feed the same concentration of GFP protein (19 bp, similar in size to the miR-31-5p mimic) with a fragment size similar to that of the miR-31-5p mimic. The electrophoresis diagram of the miR-31-5p mimic and GFP protein is shown in Figure 2. Figure 1 A control group of 100 whiteflies fed the same artificial liquid diet for 3 days served as the control group. These whiteflies were randomly placed in 5 micro-insect cages (20 whiteflies per cage). A blank control group of 100 whiteflies fed only artificial liquid diet for 2 days served as the control group. These whiteflies were randomly placed in 5 micro-insect cages (20 whiteflies per cage).

[0052] Select cucumber seedlings with about 3-5 true leaves and spray 10 7 After there was no obvious water stain on the leaf surface, the micro-insect cages of the treatment group, control group and blank control group were fixed on the back of the cucumber leaves sprayed with Metarhizium anisopliae. One micro-insect cage of the control group and one micro-insect cage of the treatment group were fixed at the same distance from the edge of each leaf.

[0053] Three replicates were randomly selected from the micro-insect cages of the treatment group and the control group on the 1st, 2nd, 3rd, 4th, and 5th day after fixation, with 30 whiteflies in each replicate. RNA was extracted using an RNA extraction kit and reverse transcribed using the stem-loop method with the primers shown in SEQ ID NO.7. The RT-PCR reaction procedure was 25℃ for 5min; 50℃ for 15min; and 85℃ for 5min. qPCR was performed using the primers shown in SEQ ID NO.8. The qPCR procedure was 95℃ pre-denaturation for 5min; 95℃ for 10s, 60℃ for 30s, and 40 cycles; the melting curve was 95℃ for 15s, 60℃ for 60s, and 95℃ for 15s. The results are shown in Figure 2. Figure 1 As shown in Figure A, compared with the control group and the blank control group, the expression of miR-31-5p in the infected whitefly was significantly downregulated during the observation period, indicating that the fungus can cause the whitefly to downregulate its own miR-31-5p, reduce the degradation of immune target genes, and enhance the ability to resist fungal infection.

[0054] SEQ ID NO.7:

[0055] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGGAG

[0056] SEQ ID NO.8:TGGGAGTTGTGGCGCG

[0057] S22. Membrane feeding was used, and the control group was fed with Bemisia tabaci miR-31-5p mimics. After 2 days, RNA was extracted using an RNA extraction kit and reverse transcribed using the stem-loop method. The sequence shown in SEQ ID NO.7 was used as a primer for reverse transcription. The RT-PCR reaction procedure was 25℃ for 5min; 50℃ for 15min; and 85℃ for 5min. The sequence shown in SEQ ID NO.8 was used as a primer for qPCR. The qPCR procedure was 95℃ pre-denaturation for 5min; 95℃ for 10s, 60℃ for 30s, and 40 cycles; the melting curve was 95℃ for 15s, 60℃ for 60s, and 95℃ for 15s. The results are shown in Figure 2. Figure 1As shown in C, compared with the control group, the mimic successfully upregulated the expression level of miR-31-5p in Bemisia tabaci.

[0058] S23, using the same treatment method as step S21, the obtained micro-insect cages of the treatment group, control group and blank control group were randomly fixed on the 8 Spores / mL on the underside of cucumber leaves grown in the greenhouse with Metarhizium anisopliae.

[0059] On the 1st, 2nd, 3rd, 4th, 5th, 6th, and 7th day after fixation, a micro-insect cage was randomly selected and the survival rate was calculated using the following formula: Survival rate (%) = number of living whiteflies / 20 × 100%. Figure 1 As shown in D, the survival rate of whiteflies infected with the fungus was significantly reduced after feeding with miR-31-5p mimics.

[0060] Example 3

[0061] To investigate the effect of feeding a miR-31-5p antagonist on the mortality of whiteflies, the specific steps are as follows:

[0062] S31. The sequence information of miR-31-5p was sent to the company to synthesize the miR-31-5p antagonist. 23 μg of miR-31-5p (Antagomir) antagonist was dissolved in 230 μL of artificial liquid feed and fed to 100 3-day-old adult whiteflies using a membrane. After feeding for 2 days, the whiteflies were randomly placed in 5 micro-insect cages (20 whiteflies in each micro-insect cage) as the treatment group.

[0063] After RNA was extracted using an RNA extraction kit, reverse transcription was performed using the sequence shown in SEQ ID NO.7 as a primer. The RT-PCR reaction program was 25°C for 5 minutes, 50°C for 15 minutes, and 85°C for 5 minutes. qPCR was performed using the sequence shown in SEQ ID NO.8 as a primer. The qPCR program was 95°C pre-denaturation for 5 minutes, 95°C for 10 seconds, 60°C for 30 seconds, and 40 cycles. The melting curve was 95°C for 15 seconds, 60°C for 60 seconds, and 95°C for 15 seconds. The results are shown in Figure 2. Figure 2 As shown in A, the expression level of miR-31-5p was significantly decreased after feeding the miR-31-5p antagonist (Antagomir), and the expression level of miR-31-5p was significantly increased after feeding the miR-31-5p mimic.

[0064] S32. 23 μg of miR-31-5p (Antagomir) antagonist was dissolved in 230 μL of artificial liquid diet and fed to 100 3-day-old whiteflies using a membrane. After 2 days of feeding, the whiteflies were randomly placed into 5 microcages (20 whiteflies per cage) to serve as the treatment group. Similarly, a negative control (NC-Inhibitor) was fed to 100 3-day-old whiteflies using a membrane. After 2 days of feeding, the whiteflies were randomly placed into 5 microcages (20 whiteflies per cage) to serve as the control group.

[0065] The obtained micro-insect cages of the treatment group and the control group were randomly fixed on the 8 Spores / mL on the back of cucumber leaves with Metarhizium anisopliae. A micro-insect cage was randomly selected on the 1st, 2nd, 3rd, 4th, 5th, 6th, and 7th day after fixation, and the survival rate was calculated using the following formula: Survival rate (%) = number of living whiteflies / 20×100%. The results are shown in the figure below. Figure 2 As shown in Figure B, after inhibiting the expression of miR-31-5p, the survival rate of whiteflies infected with Metarhizium anisopliae showed an upward trend compared with the control group, and there was a significant difference.

[0066] Example 4

[0067] To investigate the changes in immune-related mRNAs after feeding miR-31-5p mimics, the specific steps are as follows:

[0068] The same treatment method as in Example 2 was used to feed miR-31-5p mimics to whiteflies on the third day of adulthood. The whiteflies on the second day after feeding were sent to the company for transcriptome sequencing. The transcriptome of whiteflies published at https: / / doi.org / 10.5524 / 100286 was used as a control for analysis. The statistical results are as follows: Figure 3 As shown in the figure, a total of 1460 mRNAs showed significant changes. After target site prediction, 721 target site-matched mRNAs were found among the 1460 differentially expressed genes. Among them, the main functions of differentially expressed genes were enriched in immune pathways. Figure 4 The genes in the four pathways shown were significantly downregulated. Feeding miR-31-5p mimics overexpressed the expression of miR-31-5p. miR-31-5p bound to related target genes and silenced the target genes, weakening the immune system of whiteflies and leading to a decrease in survival rate. This indicates that miR-31-5p mimics can participate in regulating the expression of target genes in the whitefly immune system and enhance the killing ability of Metarhizium anisopliae on whiteflies.

[0069] Therefore, the present invention reversely regulates the expression of genes related to the immunity, metabolism, and redox pathways of Bemisia whiteflies by feeding them miR-31-5p mimics synthesized by Bemisia tabaci, and enhances the killing effect of Metarhizium anisopliae on Bemisia whiteflies by weakening the immune system and metabolic capacity of Bemisia whiteflies, thereby providing a new and effective strategy for biological control of Bemisia whiteflies under natural conditions; feeding the miR-31-5p mimics provided by the present invention can significantly reduce the survival rate of Bemisia whiteflies infected with Metarhizium anisopliae, while the survival rate of infected Bemisia whiteflies fed with miR-31-5p antagonists is significantly increased, indicating that the miR-31-5p mimics provided by the present invention can significantly enhance the killing effect of Metarhizium anisopliae on Bemisia whiteflies.

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. The use of miR-31-5p mimics in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The RNA sequence of the miR-31-5p mimic is shown in SEQ ID NO.

6.

2. The use of the miR-31-5p mimic according to claim 1 in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The working concentration of the miR-31-5p mimic was 0.2 μg / μL, and the working concentration of Metarhizium anisopliae was 10 7 -10 8 Spores / mL.

3. The use of the miR-31-5p mimic according to claim 1 in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The preparation method of the miR-31-5p mimetic is as follows: S1. Design four single-stranded DNA strands based on the DNA sequence of miRNA-31-5 from Bemisia tabaci and name them sense strand 1, sense strand 2, antisense strand 1, and antisense strand 2. S2, using the mixture of sense strand 1 and antisense strand 1 as a template for PCR amplification to obtain template 1; using the mixture of sense strand 2 and antisense strand 2 as a template for PCR amplification to obtain template 2; S3, performing PCR amplification with the mixture of template 1 and template 2, and performing in vitro transcription on the amplified product; S4. Add enzyme-free water, 3M sodium acetate solution, water-saturated phenol solution, and chloroform solution to the in vitro transcription product in sequence, mix well, centrifuge, and take the supernatant. Add anhydrous ethanol and incubate at -20°C overnight. Centrifuge, take the supernatant, wash the precipitate with 75% alcohol, and dry aseptically to obtain the miR-31-5p mimic. The DNA sequence of Bemisia tabaci miRNA-31-5 is shown in SEQ ID NO.1, the sequence of sense strand 1 is shown in SEQ ID NO.2, the sequence of sense strand 2 is shown in SEQ ID NO.3, the sequence of antisense strand 1 is shown in SEQ ID NO.4, and the sequence of antisense strand 2 is shown in SEQ ID NO.

5.

4. The use of the miR-31-5p mimic according to claim 3 in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The PCR amplification program for amplification template 1 in S2 is denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; annealing at 10°C for 10 min; and annealing at 10°C for 10 min. The PCR amplification program for amplification template 2 is denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; and annealing at 10°C for 10 min.

5. The use of the miR-31-5p mimic according to claim 3 in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The PCR amplification program in the S3 is denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; and annealing at 10°C for 10 min.

6. The use of the miR-31-5p mimic according to claim 3 in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The volume ratio of the in vitro transcription product in S4: enzyme-free water: sodium acetate solution: water-saturated phenol solution: chloroform solution is 1:10:1:5:

5.

7. A whitefly control agent, characterized by: The agent includes the miR-31-5p mimic described in any one of claims 1-6 and Metarhizium anisopliae.

8. A method for controlling Bemisia tabaci, characterized by: First feed the whitefly with the miR-31-5p mimics according to any one of claims 1 to 6, and then feed or spray the whitefly with a concentration of 10 7 -10 8 spores / mL of Metarhizium anisopliae.

Images