Nucleic acid aptamer for specifically recognizing lung adenocarcinoma cells and application of nucleic acid aptamer

Abstract

The invention discloses a nucleic acid aptamer for specifically recognizing lung adenocarcinoma cells and application of the nucleic acid aptamer. The gene sequence of the nucleic acid aptamer is as shown in SEQ ID NO. 1. The nucleic acid aptamer has high specificity and high affinity to lung adenocarcinoma cells, is easy to synthesize and low in cost, can be used for lung adenocarcinoma detection, and provides a powerful molecular tool for early diagnosis and targeted therapy of lung adenocarcinoma.

Description

Technical Field

[0001] The invention belongs to the technical field of tumor molecular biology, and in particular relates to a nucleic acid aptamer for specifically recognizing lung adenocarcinoma cells and an application thereof. Background Art

[0002] Lung cancer is a malignant tumor that originates from the bronchial mucosa or lung glands. According to the 2023 cancer statistics report released by the American Cancer Society, lung cancer has become the malignant tumor with the highest mortality rate in the world. Based on histopathology, lung cancer can be divided into small cell lung cancer and non-small cell lung cancer, of which the latter accounts for about 85% of lung cancer. Non-small cell lung cancer can be further divided into squamous cell lung carcinoma, adenocarcinoma, and large cell carcinoma. According to statistics, patients with adenocarcinoma of the lung account for 50% of all lung cancer patients.

[0003] above.

[0004] For early stage lung cancer, the 5-year survival rate of patients is greater than 70%. However, due to the insidious onset of lung cancer and the lack of obvious symptoms in the early stage of lung cancer, it is difficult for patients to detect it. More than 50% of patients have already had obvious metastasis of the tumor when they are diagnosed. Studies have shown that the development of lung adenocarcinoma can be divided into four stages: carcinoma in situ, microinvasive adenocarcinoma, invasive adenocarcinoma, and distant metastasis of lung adenocarcinoma. The survival rate of advanced lung cancer does not exceed 5%, so early diagnosis and treatment are the key to reducing the mortality rate of lung cancer.

[0005] At present, there are two types of diagnosis methods for lung cancer: imaging and pathology. The former includes chest X-rays, CT, magnetic resonance imaging, etc. These methods can get results quickly, but there are cases of misdiagnosis and high false positive rates, such as judging lung nodules as lung cancer. Pathological examinations such as needle biopsy and bronchoscopy are more accurate, but sampling will have an impact on the patient's body and mind. Therefore, it is necessary to propose a method that can quickly and accurately detect lung cancer and is non-invasive. The development of molecular probes that can specifically identify lung cancer cells and distinguish them from normal lung cells has broad application prospects in the field of early diagnosis of lung cancer.

[0006] Aptamers are DNA / RNA molecules that can specifically bind to targets by forming specific secondary or tertiary structures. The sequence length of this type of single-stranded oligonucleotides is mostly between 20-90nt, and its targets are very broad, including small molecules, proteins, cells, bacteria, viruses, tissues, etc. Compared with antibodies, aptamers have smaller molecular weights, lower immunogenicity, and are easy to synthesize and modify. Thanks to the above advantages, aptamers have a wide range of applications in analytical detection, biological imaging, targeted therapy, etc.

[0007] Nucleic acid aptamers are obtained through the systematic evolution of ligands by exponential enrichment (SELEX). In 1990, scientists Ellington and Szostak screened RNA sequences that can specifically bind to a variety of organic dyes from a library containing 1015 oligonucleotide molecules, and named these RNA sequences "aptamers". In the same year, scientists Tuerk and Gold screened an RNA sequence that can specifically bind to T4 DNA polymerase and has only 8 bases. After more than 30 years of development, SELEX technology has been greatly improved, and many different forms of screening methods have emerged, such as cell SELEX technology (Cell-SELEX), capillary electrophoresis SELEX technology (Ce-SELEX), graphene oxide SELEX technology (multiple Go-SELEX), microfluidic chip SELEX technology (M-SELEX), etc. Among them, the cell-SELEX technology uses intact living cells as targets for screening. This technology can retain the natural conformation of receptors on cells. It is not necessary to clarify the type and number of target molecules on the target cell membrane, and it is possible to screen for nucleic acid aptamers that can specifically bind to target cells.

[0008] Although some lung cancer cell-specific aptamers have been screened through cell-selex technology, such as A549 and H-1975, there are many types of lung cancer cells, and many cells still lack aptamers with targeting functions as recognition tools. At present, there are no aptamers that recognize PC-9 cells. Summary of the invention

[0009] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art and provide a nucleic acid aptamer and its application for specifically identifying lung adenocarcinoma cells. We selected lung adenocarcinoma cell PC-9 carrying epidermal growth factor receptor exon 19 mutation as a target to carry out experiments to find nucleic acid aptamers that can distinguish the cell from normal cells. The present invention is based on cell-selex technology, with human lung adenocarcinoma cells as targets and human lung bronchial epithelial cells as controls. A total of 15 rounds of screening were performed to obtain an ssDNA library with obvious recognition of the target. Through high-throughput sequencing and result analysis, a nucleic acid aptamer with high specificity and high affinity for lung adenocarcinoma cells was obtained. The aptamer is easy to synthesize, low in cost, has high specificity and high affinity for lung adenocarcinoma cells, can be used for lung adenocarcinoma detection, and provides a powerful molecular tool for early diagnosis and targeted treatment of lung adenocarcinoma.

[0010] In order to solve the above technical problems, the present invention provides a nucleic acid aptamer that specifically recognizes lung adenocarcinoma cells, and the gene sequence of the nucleic acid aptamer is shown in SEQ ID NO.1.

[0011] The above-mentioned nucleic acid aptamer is further labeled with a radioactive label, a fluorescent label or a biotin label at one end or both ends of the nucleic acid aptamer.

[0012] The above-mentioned nucleic acid aptamer is further connected to a therapeutic drug at one end or both ends of the nucleic acid aptamer.

[0013] Based on a general technical concept, the present invention also provides an application of the nucleic acid aptamer in specifically identifying lung adenocarcinoma cells.

[0014] In the above application, further, the primers used in the application include a forward primer and a backward primer, the gene sequence of the forward primer is shown as SEQ ID NO.2; the gene sequence of the backward primer is shown as SEQ ID NO.3.

[0015] In the above application, further, the forward primer is labeled with FAM, and the backward primer is labeled with biotin.

[0016] Compared with the prior art, the advantages of the present invention are:

[0017] (1) The present invention provides a nucleic acid aptamer that specifically recognizes lung adenocarcinoma cells and can bind to lung adenocarcinoma cells with high specificity and high affinity, and has broad application prospects in the detection of lung adenocarcinoma and the preparation of targeted probes.

[0018] (2) The present invention provides a nucleic acid aptamer that specifically recognizes lung adenocarcinoma cells. The aptamer is obtained by cell-selex technology screening and can recognize the target protein in its natural conformation on the cell membrane surface. Compared with antibodies, the nucleic acid aptamer provided by the present invention has the advantages of lower molecular weight, easy synthesis and transportation, easy modification, low cost, etc., and has potential application value in biomedical detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to make the purpose, technical solution and advantages of the embodiments of the present invention more clear, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0020] Figure 1 The secondary structure diagram of the nucleic acid aptamer simulated by the nupack software in Example 1 of the present invention.

[0021] Figure 2 This is a result diagram of using flow cytometry to detect the enrichment of the library in each round of the screening process in Example 1 of the present invention.

[0022] Figure 3 This is a diagram showing the recognition effect of nucleic acid aptamers on lung adenocarcinoma cells PC-9 and normal lung epithelial cells BEAS-2B detected by flow cytometry in Experiment 1 of the present invention.

[0023] Figure 4 Schematic diagram of the dissociation constant of nucleic acid aptamer Y9 measured in Experiment 2 of the present invention. DETAILED DESCRIPTION

[0024] The present invention is further described below in conjunction with specific preferred embodiments, but the protection scope of the present invention is not limited thereby.

[0025] The materials, reagents and instruments used in the following examples can all be purchased from commercial channels. The experimental methods in the following examples are all conventional methods in the art unless otherwise specified.

[0026] Cell sources: The cells used in this experiment include two lung adenocarcinoma cell lines PC-9 and HCC827, and lung bronchial epithelial cells BEAS-2B, all purchased from Changsha Visher Biotechnology Co., Ltd.

[0027] Source of DNA sequences: The DNA sequences used in this experiment were commissioned to Shanghai Sangon Biotechnology Co., Ltd. for synthesis and HPLC purification, as shown in Table 1 below.

[0028] Table 1: Sequence list.

[0029]

[0030] Example 1

[0031] A nucleic acid aptamer that specifically recognizes lung adenocarcinoma cells, the nucleic acid sequence length is 80 nt, the nucleotide sequence is shown in SEQ ID NO.1, specifically (5'-3'):

[0032] AGAAGGAAGGAGAGCGACACTCGAGTAACTGCTGCGCCGCCGGGAAATGGTTTGTACGGTTATCAGTGGTCGGTCGTCAT.

[0033] Figure 1 This is the secondary structure diagram of the nucleic acid aptamer simulated by the nupack software.

[0034] The two or one ends of the sequence can be modified or altered by radioactive labeling, therapeutic drug linkage, fluorescent labeling or biotin labeling.

[0035] The nucleic acid aptamer can also be: while keeping the overall structure of the nucleic acid aptamer Y9 unchanged, a certain position on the nucleotide sequence of the nucleic acid aptamer Y9 is phosphorylated, methylated, aminated, thiolated or isotopized.

[0036] The above modifications and transformations do not affect the ability of the nucleic acid aptamer to bind to lung adenocarcinoma cells, and have the same or similar technical effects as SEQ ID NO.1.

[0037] At the same time, without affecting the function of SEQ ID NO.1 lung adenocarcinoma cells, sequences with a homology of more than 60% with SEQ ID NO.1 and hybridizing with SEQ ID NO.1, and RNA sequences transcribed from SEQ ID NO.1, can also achieve the same or similar technical effects.

[0038] The nucleic acid aptamers of Example 1 were screened by the following method:

[0039] (1) Library preparation: First, a random sequence ssDNA library and two primers were synthesized in vitro.

[0040] The gene sequence of the ssDNA library is:

[0041] 5'-AGAAGGAAGGAGAGCGACAC-(N40)-TATCAGTGGTCGGTCGTCAT-3',

[0042] The two ends are primer binding regions, and the middle contains a random region consisting of 40 arbitrary bases.

[0043] The gene sequence of the forward primer is: 5'-FAM-AGAAGGAAGGAGAGCGACAC-3' (SEQ ID NO. 2), and the FAM label is convenient for monitoring the screening process by flow cytometry.

[0044] The gene sequence of the backward primer is: 5'-Biotin-ATGACGACCGACCACTGATA-3' (SEQ ID NO. 3), and the biotin-labeled primer can fix the amplified double strand.

[0045] (2) Counter-screening: The synthesized library is put into the cell-selex process. First, it is incubated with control cells in a binding buffer system (containing PBS, 5 g / L glucose, 5 mM MgCl2·6H2O, 0.1 g / L tRNA, and 1 g / L BSA). The supernatant containing the non-binding sequences is collected and put into the next step.

[0046] (3) Positive screening: The supernatant collected in the previous step was incubated with lung adenocarcinoma cells. After the reaction was completed, the supernatant was discarded. The cells in the culture flask were washed multiple times with a washing buffer (the washing buffer contained PBS, 5 g / L glucose, and 5 mM MgCl2·6H2O) to remove weakly bound sequences. The cells were then scraped off with a scraper and sterile water was added three times for collection. The collected solution was denatured at 95°C for 10 min and quickly cooled on ice for 10 min. The supernatant was collected after centrifugation at 10,000 rpm for 5 min and marked as the library for this round of screening.

[0047] (4) PCR amplification: The supernatant obtained in the previous step was used as a template, and the primers were 5'-FAM-AGAAGGAAGGAGAGCGACAC-3' and 5'-Biotin-ATGACGACCGACCACTGATA-3'. Amplification was performed under appropriate cycle numbers. The amplification conditions were as follows: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing for 30 s, extension at 72°C for 30 s, and extension at 72°C for 3 min.

[0048] (5) Preparation and purification of single-chain: Take 150 μL of streptavidin-labeled agarose beads in an EP tube, centrifuge at 5000 rpm for 30 seconds, remove the upper protective solution, add 500 μL of PBS to wash, centrifuge to remove the supernatant, and repeat washing 3 times. Add the PCR amplification product to the beads, incubate in the dark for 40 minutes, and shake every 5 minutes to allow sufficient reaction. After completion, centrifuge to remove the supernatant, and use 500 μL of PBS to wash the beads 3 times. Add 300 μL of 200 mM NaOH solution to the beads, alkaline hydrolyze at room temperature for 15 minutes, centrifuge at 5000 rpm for 30 seconds to collect the supernatant, then add 100 μL of 200 mM NaOH solution to wash the residual library twice, collect the supernatant, minimize the loss of DNA, and finally collect about 500 μL of single-chain DNA. Use at least 15 mL of sterile water to wash the desalting column, add the collected ssDNA product, wait for the solution to drip naturally, do not collect the solution, add 1 mL of sterile water, collect the dripping solution, that is, the library solution obtained by screening. Place the library solution in a vacuum dryer for drying at 70°C for 2 hours. The obtained powder is used for subsequent screening or testing.

[0049] (6) Changing some screening conditions, gradually reducing the amount of library input, the number of target cells, and the positive screening time in each round of screening, extending the reverse screening time and the number of control cells, repeating the reverse screening, positive screening, amplification, separation and purification steps, and using flow cytometry to monitor the binding of each round of library to target cells. When the binding capacity of the library no longer increases, high-throughput sequencing is performed on the final round of library, and candidate aptamers that can bind to target cells are selected by analyzing the sequencing results.

[0050] Figure 2 This is a result diagram of the enrichment of each round of library during the screening process using flow cytometry. As can be seen from the figure: the binding of the 9th to 15th rounds of screening libraries to target cells and control cells was detected by flow cytometry to judge the progress of the screening. The different colors in the figure correspond to the blank cell group, the initial library group, and the 6 rounds of library experimental groups after screening. As can be seen from the figure, compared with the initial library, the fluorescence of the ninth round of library after reacting with lung cancer cells obviously shifted to the right, indicating that this round of library can bind to the target cells. And after the tenth round of screening, the fluorescence intensity increased further, and began to shift back in the subsequent four rounds of screening, indicating that the screening library reached saturation in the tenth round. Considering that the tenth round of screening library also has a certain recognition of normal cells, the 11th-15th rounds of libraries were selected for sequencing, and the results were analyzed to select candidate aptamer sequences.

[0051] Experiment 1: The binding of the nucleic acid aptamer that specifically recognizes lung adenocarcinoma cells in Example 1 to lung adenocarcinoma cells PC-9 and normal lung epithelial cells BEAS-2B was investigated.

[0052] The target cells PC-9 or epithelial cells BEAS-2B were inoculated into a culture flask and cultured at 37°C and 5% CO2. When the growth density reached 90%, the cells were washed three times with D-PBS, digested for 10 min with 1 mL of 0.2% EDTA solution, washed twice with D-PBS buffer solution, collected into a centrifuge tube, centrifuged at 2000 rpm for 4 min, the supernatant was discarded, and the cells were resuspended in binding buffer (binding buffer contained PBS, 5 g / L glucose, 5 mM MgCl2·6H2O, 0.1 g / L tRNA, 1 g / L BSA), and the candidate aptamer chain and random sequence with a final concentration of 250 nm were added. The cells were placed in a shaker and incubated at 4°C and 80 rpm for 30 min. After the reaction was completed, the washing buffer (containing PBS, 5 g / L glucose, 5 mM MgCl2·6H2O) was added and washed twice repeatedly. Finally, the cells were resuspended in 400 μL of binding buffer, and the fluorescence intensity of each group of samples was detected by flow cytometry.

[0053] Figure 3 The binding of nucleic acid aptamer Y9 to target cells and control cells was detected by flow cytometry to detect the binding of nucleic acid aptamer labeled with fluorescent dye FAM to lung adenocarcinoma cell PC-9 and normal lung epithelial cell BEAS-2B. In order to clarify the non-specific adsorption of sequence binding to cells, an experiment of random sequence binding to two types of cells was set up. As can be seen from the figure, compared with the random sequence, the fluorescence intensity of nucleic acid aptamer after reaction with lung cancer cell PC-9 increased significantly, but the fluorescence intensity did not change significantly after incubation with normal cells, indicating that the sequence can well identify lung cancer cells, but not normal lung epithelial cells.

[0054] Experiment 2: Determination of the dissociation constant of nucleic acid aptamers.

[0055] Lung adenocarcinoma cells PC-9 were inoculated in a culture flask and cultured at 37°C and 5% CO2. When the growth density reached 90%, the cells were washed 3 times with D-PBS, digested for 10 min with 0.2% EDTA solution, washed 2 times with DPBS, and the cells were collected in a centrifuge tube, centrifuged at 2000rpm for 5 min, the supernatant was discarded, and the cells were resuspended in binding buffer (binding buffer contained PBS, 5g / L glucose, 5mMMgCl2·6H2O, 0.1g / L tRNA, 1g / L BSA). Eight experimental groups were set up with final concentrations of 25nM, 50nM, 75nM, 100nM, 150nM, 250nM, 400nM, and 500nM, respectively. Each group contained three parallel samples and a random sequence of the same concentration as a control sample. Add them to the tubes respectively, place them in a shaker at 4℃80rpm and incubate for 30min. After the reaction is completed, add washing buffer (washing buffer contains PBS, 5g / L glucose, 5mM MgCl2·6H2O) and repeat washing twice. Finally, resuspend the cells in 400 microliters of binding buffer. Use flow cytometry to detect the fluorescence intensity of each group of samples. Subtract the fluorescence intensity value of the corresponding concentration random chain from the fluorescence intensity value of the three groups of parallel samples to deduct the influence of non-specific adsorption. With concentration as the horizontal axis and fluorescence intensity difference as the vertical axis, according to the formula Y=BmaxX / (K d +X) to fit the experimental data and obtain the dissociation constant value.

[0056] Figure 4 Figure 1 is a schematic diagram of the dissociation constant of nucleic acid aptamers. The figure measures the binding of nucleic acid aptamers (labeled with fluorescent dye FAM) at different concentrations to lung cancer cells PC-9. After fitting the curve, it can be seen that the dissociation constant of the aptamer is 6.04nM, indicating that it can reach saturation binding with lung cancer cells at low concentrations and has good affinity.

[0057] The above is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as above in the preferred embodiment, it is not used to limit the present invention. Any technician familiar with the art can make many possible changes and modifications to the technical solution of the present invention by using the methods and technical contents disclosed above without departing from the spirit and technical solution of the present invention, or modify it into an equivalent embodiment of equivalent changes. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention, still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A nucleic acid aptamer that specifically recognizes lung adenocarcinoma cells, characterized in that: The gene sequence of the nucleic acid aptamer is shown in SEQ ID NO.

1.

2. The nucleic acid aptamer according to claim 1, characterized in that One or both ends of the nucleic acid aptamer are labeled with a radioactive label, a fluorescent label or a biotin label.

3. The nucleic acid aptamer according to claim 1 or 2, characterized in that A therapeutic drug is connected to one or both ends of the nucleic acid aptamer.

4. Use of the nucleic acid aptamer according to claim 1 or 3 in specifically identifying lung adenocarcinoma cells.

5. The use according to claim 4, characterized in that: The primers used in the application include a forward primer and a backward primer, and the gene sequence of the forward primer is shown in SEQ ID NO.2; The gene sequence of the backward primer is shown in EQ ID NO.

3.

6. The use according to claim 5, characterized in that: The forward primer is labeled with FAM, and the backward primer is labeled with biotin.

Images