Delivery system of targeted B cells as well as construction method and application of delivery system

Abstract

The invention discloses a targeted B cell delivery system as well as a construction method and application thereof, and relates to the technical field of biology. The invention provides a delivery system of targeted B cells, the delivery system comprises a specifically targeted capsid plasmid, and the plasmid comprises a VSV-G signal peptide-transmembrane region-intracellular region and an scFv antibody; the sequence of the VSV-G signal peptide-transmembrane region-intracellular region is as shown in SEQ ID NO: 3; the scFv antibody is scFv-CD19, and the sequence of the scFv antibody is as shown in SEQ ID NO: 4. According to the delivery system of the targeted B cell, provided by the invention, the pseudovirus of which the capsid is a modular component of the specific targeted B cell is constructed based on the MSCV system, and the delivery efficiency in the B cell can reach up to 90%.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a B cell-targeted delivery system and a construction method and application thereof. Background Art

[0002] Drug delivery systems are mainly divided into organic carrier delivery systems, inorganic carrier delivery systems and bio-based carrier delivery systems. Organic carrier delivery systems and inorganic carrier delivery systems have strong drug loading capacity, and their properties can be adjusted by chemical modification and other means to achieve therapeutic effects on different pathological processes. Organic carrier delivery systems also have some disadvantages, including poor stability and biocompatibility, complex preparation, and exogenous products that easily cause immune responses. The bio-based delivery system itself has good biocompatibility and stability, and has higher safety and biological activity in treatment. The bio-based delivery system can achieve targeted delivery of drugs through the biological characteristics of the cells themselves, thereby improving the therapeutic effect. During the evolution process, viruses have developed various mechanisms to enter cells, which can preserve their own genetic material in cells for a long time, as well as inhibit or modify the host's own protective matrix. For most viruses, recombinant variants can be produced. They are considered to be good carriers in gene therapy, which can overcome multiple obstacles and effectively deliver the genome into cells. The viral vectors currently used include adenovirus, retrovirus, lentivirus and adeno-associated virus.

[0003] Chinese patent CN116769826A discloses a B-cell expression delivery system and its construction method and application. The construction method is to construct a pseudovirus-like particle (L-AVLP) system for B-cell delivery expression of a new parainfluenza virus strain PIV5-L derived from human B cells by reverse genetics, which successfully and continuously expresses exogenous genes, including: optimizing the PIV5-L pseudovirus-like particle packaging system, and upgrading it from a two-step method of establishing a cell line-packaging pseudovirus-like particles to a one-step method. Compared with the traditional lentiviral expression system, this method has the advantages of safety, high efficiency and broad spectrum, and is suitable for most different types of primary tumor cell lines with high expression of sialic acid SA. The invention also includes the use of the above system to construct pseudovirus-like particles to deliver exogenous genes to any susceptible cells.

[0004] Currently, gene therapy has made progress in the treatment of tumors, infectious diseases and various genetic diseases, and it has broad application prospects. There are few studies in the prior art on providing a delivery system that can efficiently deliver genetic material. Therefore, it is very important to provide a delivery system that can specifically target B cells and improve delivery efficiency. Summary of the invention

[0005] The purpose of the present invention is to provide a B cell-targeted delivery system and a construction method and application thereof.

[0006] To achieve the above-mentioned object of the invention, the technical solution of the present invention is as follows:

[0007] In one aspect, the present invention provides a B cell-targeted delivery system, the delivery system comprising a specifically targeted capsid plasmid, the plasmid comprising a VSV-G signal peptide-transmembrane region-intracellular region and a scFv antibody;

[0008] The sequence of the VSV-G signal peptide-transmembrane region-intracellular region is shown in SEQ ID NO:3.

[0009] Specifically, the scFv antibody sequence in the specifically targeted capsid plasmid also includes one or more of scFv-CD19, scFv-CD3, scFv-CD56, scFv-CD28, scFv-CD45, scFv-CD4, scFv-CD5, scFv-CD8, scFv-CD9, scFv-CD16, scFv-CD22, scFv-CD33, scFv-CD37, scFv-CD134, scFv-CD137, and scFv-CD154.

[0010] Furthermore, the scFv antibody is scFv-CD19, and the sequence of the scFv-CD19 is shown in SEQ ID NO:4.

[0011] Specifically, the construction method of the plasmid comprises the following steps:

[0012] (1) The vector is digested with a restriction endonuclease to obtain a linearized vector, and the linearized vector is connected to the sequence shown in SEQ ID NO: 3 by homologous recombination to obtain plasmid 1.

[0013] (2) Plasmid 1 was digested with a restriction endonuclease to obtain a linearized vector, and the linearized vector was connected to the sequence shown in SEQ ID NO: 4 by homologous recombination to obtain a plasmid.

[0014] Furthermore, the vector is pcDNA3.1+.

[0015] Furthermore, the restriction endonuclease described in step (1) and step (2) is selected from one or more of BamHI restriction endonuclease, EcoRI restriction endonuclease, PacI restriction endonuclease and ClaI restriction endonuclease.

[0016] According to some embodiments of the present invention, the restriction endonuclease described in step (1) includes BamHI restriction endonuclease and EcoRI restriction endonuclease.

[0017] According to some embodiments of the present invention, the restriction endonuclease described in step (2) includes PacI restriction endonuclease and ClaI restriction endonuclease.

[0018] According to some embodiments of the present invention, step (1) is: using BamHI enzyme and EcoRI enzyme to digest pcDNA3.1+ to obtain a linearized vector, and connecting the linearized pcDNA3.1+ vector with the sequence shown in SEQ ID NO:3 through homologous recombination to obtain pcDNA3.1-MCS-VSV-G-TM plasmid.

[0019] According to some embodiments of the present invention, step (2) is: using PacI enzyme and ClaI enzyme to digest the pcDNA3.1-MCS-VSV-G-TM plasmid to obtain a linearized vector, and connecting the linearized vector with the sequence shown in SEQ ID NO:4 by homologous recombination to obtain the pcDNA3.1-scFv-CD19-VSV-G-TM plasmid.

[0020] In another aspect, the present invention provides a method for constructing the above-mentioned delivery system, comprising the following steps:

[0021] (1) Construction of stable strains;

[0022] (2) The plasmid constructed as described above is added to the stable strain for transfection, the cell culture supernatant is collected, and the supernatant is purified to obtain the pseudovirus.

[0023] Specifically, the stable strain is the 293T-MSCV-gag-pol stable strain.

[0024] Furthermore, the transfection system in step (2) includes MSCV-EGFP plasmid and pcDNA3.1-scFv-CD19-VSV-G-TM plasmid.

[0025] Furthermore, in step (2), after the MSCV-EGFP plasmid and the pcDNA3.1-scFv-CD19-VSV-G-TM plasmid are mixed, PEI is added to obtain a transfection mixture.

[0026] Furthermore, the construction of the 293T-MSCV-gag-pol stable strain comprises the following steps:

[0027] S1. Mix the Super PiggyBac Transposase plasmid and the PB-MSCV-gag-pol plasmid, add PEI and mix well to obtain a transfection mixture, and drop the transfection complex into 293T cells;

[0028] S2. Perform puro drug screening 24-48 hours after transfection to obtain the 293T-MSCV-gag-pol stable strain.

[0029] Furthermore, in step S1, the addition amount of Super PiggyBac Transposase plasmid and PB-MSCV-gag-pol plasmid was 4 μg / dish.

[0030] Furthermore, in step S1, 48 hours after transfection, the cells were passaged at a cell density of 40%.

[0031] Furthermore, the preparation method of the PB-MSCV-gag-pol plasmid in step S1 is as follows: the PB-MCS-Puro plasmid is double-digested with XbaI and BamHI to obtain a linearized vector, and the linearized PB-MCS-Puro is connected with the synthesized SEQID NO.2 by homologous recombination to obtain the PB-MSCV-gag-pol plasmid.

[0032] Furthermore, in step S2, puro drug screening is performed 48 hours after cell transfection.

[0033] Further, puro drug screening was performed in three rounds.

[0034] Furthermore, the amount of puro added in step S2 is 3.5 μg / mL.

[0035] Furthermore, in step S2, a round of drug killing was performed every two days, and three rounds of drug killing were performed to obtain a 293T-MSCV-gag-pol stable strain.

[0036] In yet another aspect, the present invention provides use of the above delivery system in improving delivery efficiency.

[0037] The beneficial effects of the present invention are:

[0038] The B cell-targeted delivery system provided by the present invention is based on the MSCV system to construct a pseudovirus whose capsid is a modular component (including VSV-G signal peptide, transmembrane region, intracellular region and scFv-CD19) that specifically targets B cells, and can achieve a delivery efficiency of up to 90% in B cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is the plasmid map of PB-MCS-puro.

[0040] Figure 2 This is the PB-MSCV-gag-pol plasmid map.

[0041] Figure 3 This is the plasmid map of pcDNA3.1-MCS-VSV-G-TM.

[0042] Figure 4 This is the plasmid map of pcDNA3.1-scFv-CD19-VSV-G-TM.

[0043] Figure 5 This is the map of pcDNA3.1-VSV-G mut-TM plasmid.

[0044] Figure 6 This is the structural diagram of Target-CD19 virus.

[0045] Figure 7 The physical copy number bar graph of the pseudovirus specifically targeting B cells.

[0046] Figure 8 Flow cytometric analysis data of Raji and Jurkat cells infected with B cell-specific pseudovirus for 72 hours. DETAILED DESCRIPTION

[0047] In order to make the technical means, creative features, purpose and efficacy of the present invention easy to understand, the present invention is further explained in conjunction with specific embodiments below, but the following embodiments are only preferred embodiments of the present invention, not all. Based on the embodiments in the implementation mode, other embodiments obtained by those skilled in the art without creative work all belong to the protection scope of the present invention. In the following embodiments, unless otherwise specified, the operating methods used are conventional operating methods, the equipment used are conventional equipment, and the equipment materials used in each embodiment are the same.

[0048] Example 1 Construction of plasmids related to pseudovirus specifically targeting B cells

[0049] (1) The whole genome synthesis method obtained the following sequence, as shown in Table 1.

[0050] Table 1 Synthetic sequences

[0051]

[0052]

[0053] (2) The piggyBac target gene plasmid was used as a vector (purchased from Miaoling, catalog number P44092). The linearized vector was obtained by PCR and the Neo gene was removed. The linearized piggyBac target gene vector plasmid was connected with the synthesized SEQ ID NO.1 by homologous recombination to obtain the PB-MCS-puro plasmid. The map is shown in Figure 1 shown.

[0054] (3) The PB-MCS-Puro plasmid was double-digested with XbaI and BamHI to obtain a linearized vector. The linearized PB-MCS-Puro was connected with the synthesized SEQ ID NO.2 by homologous recombination to obtain the PB-MSCV-gag-pol plasmid. The map is shown in Figure 2 shown.

[0055] (4) Plasmid pcDNA3.1+ was used as a vector, and the linearized vector was obtained by restriction endonuclease BamHI and EcoRI. The linearized pcDNA3.1+ vector was connected with the synthesized SEQ ID NO.3 by homologous recombination to obtain pcDNA3.1-MCS-VSV-G-TM plasmid. The map is shown in Figure 3 shown.

[0056] (5) Plasmid pcDNA3.1-MCS-VSV-G-TM was used as a vector, and the linearized vector was obtained by restriction endonuclease PacI and ClaI. The linearized pcDNA3.1+ vector was connected with the synthesized SEQ ID NO.4 by homologous recombination to obtain pcDNA3.1-scFv-CD19-VSV-G-TM plasmid. The map is shown in Figure 4 shown.

[0057] (6) Plasmid pCMV-VSV-G (purchased from Addgene, catalog number 8454) was used as a vector, and the amino acids K47 and R354 of VSV-G were mutated into glutamine Q (K47Q and R354Q) to obtain the pcDNA3.1-VSV-Gmut-TM plasmid with VSV-G protein mutation inactivation, as shown in the map. Figure 5 shown.

[0058] 1ug of the constructed plasmid was run on 1% agarose gel electrophoresis at 120V for 30min; the plasmid with the correct electrophoresis band was sent for first-generation genome sequencing identification, and the sequencing was completed by Tianlin Company.

[0059] SEQ ID NO: 1:

[0060] ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCCGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGACCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTAG。

[0061] SEQ ID NO:2:

[0062]

[0063] SEQ ID NO:3:

[0064] atgaagtgccttttgtacttagcctttttattcattggggtgaattgcttaattaaatcgatGGAGGAGGAGGAAGCGGAGGAGGCGGAAGCGGAGGCGGAGGAAGCaatccaatcgagcttgtagaaggttggttcagtagttggaaaagctctattgcctcttttttctttatcatagggttaatcattggactattcttggttctccgagttggtatccatctttgcattaaattaaagcacaccaagaaaagacagatttatacagacatagagatgaaccgacttggaaag。

[0065] SEQ ID NO:4:

[0066] .

[0067] Example 2 Construction of 293T-MSCV-gag-pol stable strain

[0068] (1) Observe the status of 293T cells under a microscope before transfection. Cell transfection can be performed if the density is around 80%, there is no mycoplasma, and the growth status is good;

[0069] (2) Before transfection, replace the medium of each 100 cm cell culture dish with 10 mL of DMEM medium containing 2% FBS serum to reduce the effect of serum on plasmid transfection;

[0070] (3) Experimental groups and plasmid dosages are shown in the following table (the Super PiggyBac Transposase plasmid in Table 2 was purchased from Miaoling Biotechnology Co., Ltd., with a catalog number of P0179).

[0071] Table 2 Transfection system

[0072]

[0073] (4) Add the required amount of plasmid and 1xPEI in Table 2 into the corresponding 1.5 mL EP tube containing 1 mL 1xPBS / dish, add the plasmid first and mix well, then add 1xPEI (purchased from HARVEYBIO, catalog number 49553-93-7) and mix well, let stand for 15 min to obtain the transfection mixture;

[0074] (5) The transfection mixture was added dropwise to a 100 cm cell culture dish and replaced with 10 mL of DMEM medium containing 2% serum 8 h after transfection;

[0075] (6) 48 hours after transfection, the cells were passaged at a cell density of 40%. When the cell density reached 60%, puro drug screening was performed. Puro was added at a ratio of 3.5 ug / mL and a round of drug killing was performed every two days. After three rounds of drug killing, a stable 293T-MSCV-gag-pol strain was obtained.

[0076] Example 3 Specific targeting of B cells to pseudovirus packaging

[0077] (1) Before transfection, the 293T-MSCV-gag-pol cells constructed in Example 2 were observed under a microscope. The density was about 90%, there was no mycoplasma, and the growth state was good, so the cells could be transfected;

[0078] (2) Before transfection, replace the medium of each 100 cm cell culture dish with 10 mL of DMEM medium containing 2% FBS serum to reduce the effect of serum on plasmid transfection;

[0079] (3) Experimental groups and plasmid dosages are shown in the following table (MSCV-EGFP in Table 3 was purchased from Addgene, catalog number 24828).

[0080] Table 3 Specific B cell targeting pseudovirus packaging system

[0081]

[0082] (4) Add the required amount of plasmid and 1xPEI in Table 3 into the corresponding 1.5 mL EP tube containing 1 mL 1xPBS / dish, add the plasmid first and mix well, then add 1xPEI (purchased from HARVEYBIO, catalog number 49553-93-7) and mix well, let stand for 15 min to obtain the transfection mixture;

[0083] (5) The transfection mixture was added dropwise to a 100 cm cell culture dish and replaced with 10 mL of DMEM medium containing 2% serum 8 h after transfection;

[0084] (6) Virus supernatants were collected 24 h, 48 h, and 72 h after transfection, and the medium was replaced with 10 mL of DMEM medium containing 2% serum twice. The cells were centrifuged at 50,000 x g for 2 h and then resuspended with 100 ul of 1xPBS (purchased from Gibco, catalog number 70011044). Then, 25 ul of universal nuclease (purchased from zrbiorise, catalog number ZRXX12688) was added to each 100 cm cell culture dish and treated at 37°C for 1 h to eliminate free DNA and RNA. The cells were then centrifuged at 12,000 rpm for 3 min, the supernatant was aspirated with a syringe, and filtered with a 0.22 um filter to obtain purified pseudoviruses specifically targeting B cells, which were named Target-CD19 virus (the structure of Target-CD19 virus is shown in the figure). Figure 6 as shown) and Target-control virus.

[0085] Example 4 Detection of physical copy number of pseudovirus specifically targeting B cells

[0086] (1) Viral nucleic acid extraction kit (purchased from Beaverbio, Cat. NO. 70406) was used to extract RNA carried by the respiratory syncytial virus pseudovirus Target-CD19 virus and Target-control virus, respectively. The RNA carried by the two viruses was the same (including EGFP mRNA), and the specific extraction method was carried out according to the instructions.

[0087] (2) RNA was subjected to RT-qPCR using a one-step RT-qPCR kit (purchased from Novozymes, HiScript II One Step qRT-PCR SYBR Green Kit, catalog number: Q221-01), which can simultaneously perform RNA reverse transcription and qPCR.

[0088] (3) The qPCR primer sequences for detecting EGFP mRNA are as follows:

[0089] Table 4 Primer sequences

[0090] Sequence number synthetic sequence SEQ ID NO:5(CTACCCCGACCACATGAAGC) Forward Primer SEQ ID NO:6(TGAAGTCGATGCCCTTCAGC) Reverse primer

[0091] (4) The 20ul reaction system of RT-qPCR is as follows:

[0092] Table 5 Reaction system

[0093] name Dosage 2x One Step SYBR Green Mix 10ul One Step SYBR Green Enzyme Mix 1ul Forward primer (10uM) 0.4ul Reverse primer (10uM) 0.4ul Template RNA 2ul Double distilled water 6.2ul

[0094] Prepare the reaction system according to Table 5 on ice and mix well.

[0095] The RT-qPCR reaction procedure is as follows:

[0096] Table 6 Reaction procedure

[0097]

[0098]

[0099] Set up the RT-qPCR reaction program according to the program in Table 6 to perform RT-qPCR reaction and export the data for analysis.

[0100] (5) qPCR reaction of DNA standard curve (1E+4 copies / ul, 1E+5 copies / ul, 1E+6 copies / ul, 1E+7 copies / ul and 1E+8 copies / ul) of EGFP protein was performed simultaneously with RT-qPCR. The reaction system (20 ul) was as shown in Table 7 (reagents were purchased from Novozymes, catalog number Q511-01).

[0101] Table 7 DNA-qPCR reaction system

[0102] name Dosage 2x AceQ Universal SYBR gPCR Master Mix 10ul Forward primer (10uM) 0.4ul Reverse primer (10uM) 0.4ul Template RNA 2ul Double distilled water 7.2ul

[0103] The primers used for qPCR were the same as those in Table 4, and the reaction system was prepared on ice and mixed according to Table 7.

[0104] The qPCR reaction procedure is as follows:

[0105] Table 8 Reaction procedure

[0106]

[0107] Perform qPCR according to the reaction procedure in Table 8, export data for analysis, draw a standard curve, and calculate the physical copy number of the virus in combination with the RT-qPCR data. The physical copy number is as follows: Figure 7 As shown, the physical copy number of Target-CD19 virus is 5.56E+9vg / mL, and the physical copy number of Target-control virus is 1.77E+9vg / mL.

[0108] Example 5 Test of the efficiency of pseudovirus infection specifically targeting B cells

[0109] (1) Pre-infection incubation:

[0110] B cell Raji cells containing CD19 targets and T cell Jurkat cells without CD19 targets in the logarithmic growth phase were centrifuged and resuspended in a small volume of complete medium. The number of cells added to the 24-well plate was 1.0x10^6 cells. The volume of virus added was calculated according to the MOI value = 1000 and the virus infection titer (virus addition amount (ul) = MOI value X number of cells / virus titer (TU / mL) X1000); the virus dosage was calculated according to the formula and various viruses were added to 1.0x10^6 Raji or Jurkat cells in a 1.5mL EP tube, mixed, and placed in a centrifuge at 800rpm for 1h.

[0111] (2) Change medium after culture: Add the centrifuged mixture to a 24-well plate and add complete medium to 200ul. Shake the cells using the “cross method” and place at 37°C in a CO 2 Culture in a cell culture incubator; after infection overnight, centrifuge at 800 rpm for 3 min, discard the waste liquid, transfer the cells to a 24-well plate, and add new 1 mL of complete culture medium for culture.

[0112] (3) Flow cytometry analysis: After the virus infected cells for 72 hours, centrifuge at 800 rpm for 3 minutes and discard the waste liquid, wash once with 1xPBS, centrifuge and discard the PBS; resuspend in 500ul 1xPBS, select the GFP channel for flow cytometry analysis, and the specific data are as follows: Figure 8 As shown, in Raji cells containing CD19 targets, the infection efficiency of Target-CD19 virus was 96.71%, the infection efficiency of Target-control virus was 14.19%, and the infection efficiency of Target-CD19 virus in Jurkat cells without CD19 targets was less than 0.2%. These data indicate that pseudoviruses specifically targeting B cells have better delivery effects and specificity in B cells.

[0113] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A B cell-targeted delivery system, comprising a specifically targeted capsid plasmid, characterized in that: The plasmid includes VSV-G signal peptide-transmembrane region-intracellular region and scFv antibody; The sequence of the VSV-G signal peptide-transmembrane region-intracellular region is shown in SEQ ID NO:

3.

2. The delivery system according to claim 1, characterized in that The scFv antibody sequence in the specifically targeted capsid plasmid also includes one or more of scFv-CD19, scFv-CD3, scFv-CD56, scFv-CD28, scFv-CD45, scFv-CD4, scFv-CD5, scFv-CD8, scFv-CD9, scFv-CD16, scFv-CD22, scFv-CD33, scFv-CD37, scFv-CD134, scFv-CD137, and scFv-CD154.

3. The delivery system according to claim 2, characterized in that The scFv antibody is scFv-CD19, and the sequence of the scFv-CD19 is shown in SEQ ID NO:

4.

4. The delivery system according to claim 1, characterized in that The construction method of the plasmid comprises the following steps: (1) digesting the vector with a restriction endonuclease to obtain a linearized vector, and connecting the linearized vector with the sequence shown in SEQ ID NO: 3 by homologous recombination to obtain plasmid 1; (2) Plasmid 1 was digested with a restriction endonuclease to obtain a linearized vector, and the linearized vector was connected to the sequence shown in SEQ ID NO: 4 by homologous recombination to obtain a plasmid.

5. The delivery system according to claim 4, characterized in that Step (1) is: using BamHI enzyme and EcoRI enzyme to digest pcDNA3.1+ to obtain a linearized vector, and connecting the linearized pcDNA3.1+ vector with the sequence shown in SEQ ID NO: 3 by homologous recombination to obtain pcDNA3.1-MCS-VSV-G-TM plasmid.

6. The delivery system according to claim 4, characterized in that Step (2) is: using PacI enzyme and ClaI enzyme to digest the pcDNA3.1-MCS-VSV-G-TM plasmid to obtain a linearized vector, and connecting the linearized vector with the sequence shown in SEQ ID NO:4 by homologous recombination to obtain the pcDNA3.1-scFv-CD19-VSV-G-TM plasmid.

7. The method for constructing a delivery system according to any one of claims 1 to 6, characterized in that: The following steps are involved: (1) Construction of stable strains; (2) Adding the plasmid constructed according to any one of claims 1 to 6 to a stable strain for transfection, collecting the cell culture medium supernatant, and purifying the supernatant to obtain a pseudovirus.

8. The construction method according to claim 7, characterized in that: The stable strain described in step (1) is the 293T-MSCV-gag-pol stable strain.

9. The construction method according to claim 8, characterized in that: The construction of the 293T-MSCV-gag-pol stable strain comprises the following steps: S1. Mix the Super PiggyBac Transposase plasmid and the PB-MSCV-gag-pol plasmid, add PEI and mix well to obtain a transfection mixture, and drop the transfection complex into 293T cells; S2. Perform puro drug screening 24-48 hours after transfection to obtain the 293T-MSCV-gag-pol stable strain.

10. The construction method according to claim 9, characterized in that: The preparation method of the PB-MSCV-gag-pol plasmid in step S1 is as follows: the PB-MCS-Puro plasmid is double-digested with XbaI and BamHI to obtain a linearized vector, and the linearized PB-MCS-Puro is connected with the synthesized SEQ ID NO.2 by homologous recombination to obtain the PB-MSCV-gag-pol plasmid.

11. Use of the delivery system according to any one of claims 1 to 6 in improving delivery efficiency.

Images