Glucometer signal conversion method based on G4 DNAzyme

Abstract

The invention belongs to the technical field of molecular biology, and provides a glucometer signal conversion method based on G4DNAzyme and application of the glucometer signal conversion method in non-glucose target detection. According to the strategy, G4DNAzyme with peroxidase activity is utilized to oxidize a reduced substrate which can be directly detected by a glucometer, so that the content of the reduced substrate in a reaction system is reduced, the reading of the glucometer is reduced, and qualitative and quantitative detection can be carried out on the G4DNAzyme by utilizing the change of a detection signal value of the glucometer. Different to-be-detected non-glucose targets can be qualitatively and quantitatively detected through the glucometer by combining different target recognition strategies. According to the technical scheme, protein modification is not needed, cost is low, operation is easy, and a brand new direction is provided for POCT technology development based on a glucometer report.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology technology, and relates to converting the detection signal of a target to be detected into a portable blood glucose meter signal, so as to realize the use of the blood glucose meter for the detection of non-glucose targets. Specifically, it relates to a method of using G4 DNAzyme to oxidize a reduced substrate detectable by a blood glucose meter to generate an oxidized product that cannot be detected by the blood glucose meter, resulting in a change in the reading of the blood glucose meter, and realizing the conversion of the G4DNAzyme signal to the reading of the blood glucose meter. On this basis, combined with the signal sensing of non-glucose targets to G4 DNAzyme, a universal method of converting non-glucose targets to blood glucose meter signals is finally established, which is applied to the detection of non-glucose targets. Background Art

[0002] Although currently dominated by centralized laboratory testing, biosensor testing is moving towards the era of point-of-care testing (POCT). POCT can achieve rapid, reliable and cost-effective molecular testing in decentralized locations such as outpatient clinics and homes. Unlike the bulky and complex instruments used in centralized laboratories, POCT is highly advantageous in using miniaturized and portable devices that can be easily operated by untrained personnel. However, even after decades of development, only a few commercial portable devices have been achieved. The inevitable challenge when developing new POCT devices is the huge financial and time investment, which leads to a significant delay in the time to transform new devices into popular home commercial products. Therefore, looking for different strategies is a wise choice to solve the problem.

[0003] Repurposing existing off-the-shelf devices to detect different targets is one of the most innovative approaches in developing new point-of-care testing (POCT) technologies. This strategy significantly reduces costs and development time. In addition, the widespread use of these commercial devices has also made it easier for the public to accept and familiarize themselves with their new functions. To date, many approaches have emerged to redesign commercial handheld devices such as pregnancy test strips (PTS), personal glucose meters (PGMs), pH meters, barometers, and thermometers for the detection of various molecular targets, including proteins, nucleic acids, and small molecules. Among these advances, PGMs have a significant advantage in being redeveloped for the detection of non-sugar substances due to their low cost, user-friendly design, and wide user base. However, existing PGM repurposing strategies often rely on protease modification, limiting their scope of application. In recent years, although some strategies have achieved universal PGM-based detection without protein modification, they usually require the elaborate preparation of complex nanomaterials and the use of expensive, optimized cell-free expression systems. Therefore, finding a simple and cost-effective strategy to convert the detection of non-sugar targets into PGM signals is of great significance for the development of new PGM-based POCT technologies.

[0004] Commercial PGMs rely on proteases (glucose oxidase or glucose dehydrogenase) to catalyze glucose and initiate electrochemical reactions. Taking the most commonly used glucose dehydrogenase-based PGM as an example, glucose sensing involves three cascade reactions. First, glucose is oxidized by glucose dehydrogenase, thereby converting the coenzyme nicotinamide adenine dinucleotide (NAD + ) into its reduced form (NADH). Then, NADH converts the oxidized electron mediator [Fe(CN)6] 3- Reduction to [Fe(CH)6] 4- Finally, [Fe(CN)6] 4- It is reoxidized on the electrode and generates a current signal in the PGM. Based on this principle, a variety of reduced substrates such as the reduced form of nicotinamide adenine dinucleotide (NADH), ascorbic acid, uric acid, dopamine, mannitol, etc. (Diabetes technology & therapeutics, 12 (11), 847-857; Angewandte Chemie (International ed. in English), 55 (2), 732-736.) can directly generate corresponding signal readings on the blood glucose meter.

[0005] By using the in vitro systematic evolution of ligands by exponential enrichment (SELEX) technology, scientists have discovered a class of single-stranded DNA molecules with catalytic functions, namely DNAzymes. These molecules are widely favored by the scientific community because of their strong stability, easy storage, and low synthesis cost. In 1996, Dipankar Sen first discovered a guanine-rich single-stranded DNAzyme that can self-fold to form a G-quadruplex (G4) structure. When these DNAzymes are combined with porphyrin iron or its analogs, they exhibit catalytic activity similar to that of peroxidases, which can promote H2O2 to oxidize substrates (such as ABTS, TMB, NADH, o-phenylenediamine, sodium ascorbate, etc.) and produce signal changes (Chemical communications (Cambridge, England), 51(6), 979–995; Analytica chimica acta, 707(1-2), 7–17; Angewandte Chemie (Internationaled. in English), 50(49), 11710–11714.).

[0006] Therefore, in view of the fact that G4 DNAzyme is a single-stranded DNA with the characteristics of low cost, easy operation, and high programmable performance, the present invention develops a new PGM signal conversion method based on it, which is expected to break through the bottleneck of the current PGM reuse strategy and promote the long-term development of POCT technology. Summary of the invention

[0007] On the one hand, the present invention provides a blood glucose meter signal conversion method based on G4 DNAzyme, which utilizes the characteristic that G4 DNAzyme catalyzes the oxidation of reduced substrates to cause changes in blood glucose meter readings, thereby realizing the conversion of G4 DNAzyme signals to PGM signals; on the other hand, the blood glucose meter signal conversion method based on G4 DNAzyme is associated with a non-glucose target, and a method for converting a non-glucose target signal to a blood glucose meter signal via G4 DNAzyme is established, which is applied to the detection of non-glucose targets. The method is a conversion strategy that can easily and efficiently realize the conversion of non-sugar target detection signals into qualitative and quantitative PGM signals without the need for protein modification and expensive detection instruments.

[0008] The technical solutions to achieve the above objectives are as follows:

[0009] A blood glucose meter signal conversion method based on G4 DNAzyme, the specific technical scheme is: the blood glucose meter signal conversion system based on G4 DNAzyme includes a peroxidase system based on G4 DNAzyme and a reduced substrate. When a mixture of a peroxidase system and a reduced substrate without G4 DNAzyme is detected by a blood glucose meter, the reading of the blood glucose meter is high. After adding G4 DNAzyme, the peroxidase system based on G4 DNAzyme oxidizes the reduced substrate into an oxidized product, the content of the reduced substrate decreases, and the reading detected by the blood glucose meter decreases. Thus, the signal of DNAzyme is converted into the change of blood glucose meter reading, and the change of blood glucose meter reading can be used to qualitatively detect G4 DNAzyme. Different concentrations of G4 DNAzyme have different oxidation degrees on the reduced substrate, resulting in different reduction degrees of blood glucose meter reading. The higher the concentration of G4 DNAzyme, the less the remaining reduced substrate and the lower the blood glucose meter reading. The concentration of G4 DNAzyme is negatively correlated with the blood glucose meter reading, and positively correlated with the difference (Δreadout) of the blood glucose meter reading of the reaction system before and after the addition of G4 DNAzyme. A standard curve based on the concentration of G4 DNAzyme and Δreadout can be used to quantitatively analyze G4 DNAzyme.

[0010] The peroxidase system based on G4 DNAzyme includes G4 DNAzyme, hemin, H2O2, and reaction buffer. Among them, G4 DNAzyme is a guanine-rich nucleic acid sequence that can self-fold to form a G-quadruplex structure. When combined with porphyrin iron (hemin) or its analogs, it can exert peroxidase-like activity and catalyze the oxidation reaction of H2O2 on reduced substrates. The G4 DNAzyme sequence is preferably 5'-GGTGGTGGTGGTTGTGGTGGTGGTGG-3' (SEQ NO ID: 1) and its multimeric form sequence repeated multiple times. The buffer is the most suitable buffer for the G4 DNAzyme to exert oxidative enzyme activity. The preferred buffer adapted to the preferred G4 DNAzyme sequence 5'-GGTGGTGGTGGTTGTGGTGGTGGTGG-3' and its polymer form sequence is: 10mM Tris-HCl (pH=7.2), 100mM KCl, 20mM NaCl, 1% DMSO, 0.1% Triton X-100.

[0011] The reduced substrate can cause a response from the blood glucose meter, and the higher the concentration, the higher the reading of the blood glucose meter. At the same time, the reduced substrate can also be oxidized and converted into an oxidized product by the peroxidase system based on G4 DNAzyme, resulting in a decrease in the content of the reduced substrate in the reaction system, and the reading detected by the blood glucose meter is reduced accordingly. The reduced substrate includes but is not limited to ABTS, TMB, NADH, o-phenylenediamine, sodium ascorbate, etc., preferably NADH, o-phenylenediamine, sodium ascorbate.

[0012] The application of the blood glucose meter signal conversion method based on G4 DNAzyme in the detection of non-glucose targets. The specific technical solution is: G4 DNAzyme is a multifunctional signal sensing tool that can establish connections with a variety of targets such as nucleic acids, proteins, and small molecules through signal sensing strategies. A signal sensing method for conversion to G4 DNAzyme is established based on a specific non-glucose target, and the presence or absence of the non-glucose target is converted into the generation or consumption of G4 DNAzyme. Combined with a blood glucose meter signal conversion method based on G4 DNAzyme, it can be further converted into a decrease or increase in the blood glucose meter reading, thereby enabling qualitative detection of the non-glucose target; the concentration of the non-glucose target is converted into the amount of G4 DNAzyme generated or consumed, and combined with a blood glucose meter signal conversion method based on G4 DNAzyme, it can be further converted into the difference in blood glucose meter readings (Δreadout). The higher the concentration of the non-glucose target, the more G4 DNAzyme is generated or consumed, resulting in a larger Δreadout of the blood glucose meter. The concentration of the non-glucose target is positively correlated with the Δreadout of the blood glucose meter. A standard curve based on the concentration of the non-glucose target and Δreadout can be used to quantitatively analyze the non-glucose target.

[0013] In the present invention, G4 DNAzyme is used as an intermediary for blood glucose meter signal conversion, which has the advantages of low synthesis cost, simple operation, and easy storage. It does not require protein modification and can be connected to different biomarker detection methods through some commonly used nucleic acid signal conversion strategies, and has good programmability.

[0014] As used herein, the following words / terms have the following meanings, unless otherwise stated.

[0015] "DNA": Deoxyribonucleic acid, a biological macromolecule that carries the genetic information of an organism. This molecule is composed of four basic deoxynucleotides, which are connected by phosphodiester bonds at the 3' and 5' positions to form a long chain. The structure of DNA makes it a medium for storing and transmitting genetic information.

[0016] "PGM": Personal Glucose Meter. It is a commonly used POCT device, mainly used for blood glucose monitoring. Through a specific signal conversion strategy, the device can be used for the detection of non-sugar targets, with the characteristics of simple operation and low cost.

[0017] "DNAzyme": Deoxyribozyme, also known as catalytic DNA, is a single-stranded DNA molecule artificially synthesized through in vitro molecular evolution strategy. These molecules are carefully designed to show excellent catalytic efficiency and precise structural recognition properties. They can bind to compounds such as porphyrin iron, thereby giving them peroxidase activity.

[0018] "SELEX": systematic evolution of ligands by exponential enrichment, exponentially enriched ligand system evolution technology, is a strategy to screen out rare nucleic acid sequences with specific binding properties from a wide range of random oligonucleotide sequences. This technology was proposed by Tuerk and Ellington in 1990. It selects sequences that can interact with specific target molecules from a huge nucleotide library through a continuous in vitro screening and amplification process. In the SELEX operation process, a nucleic acid library containing random sequences is first prepared by combinatorial chemistry. Subsequently, these random sequence nucleic acid libraries are placed in a special buffer solution and incubated with the target molecule under suitable temperature conditions, so that the nucleic acid molecules that can specifically bind to the target molecule can be identified. Then, these specifically bound molecules are separated from the unbound molecules using physical separation technology. Finally, these screened molecules are amplified for further enrichment and optimization in subsequent cycles. By repeating this process, the specificity and affinity of the nucleic acid molecules can be gradually improved.

[0019] “Hemin”: heme, also known as porphyrin iron.

[0020] The key to the method disclosed in the present invention is to use G4 DNAzyme to control the oxidation reaction of the reduced substrate, thereby affecting the signal reading of PGM. By detecting the amount of DNAzyme, the target analyte can be directly or indirectly qualitatively or quantitatively determined. The method is simple, accurate and inexpensive, and can be applied to various biological target detection systems, especially for some home detection projects and detection needs in resource-poor areas. It has high practical value. The present invention has obvious advantages over the prior art, and its main advantages include:

[0021] 1. Novelty. The present invention successfully combines the reduced substrate oxidation reaction catalyzed by DNAzyme with the PGM signal report, providing a universal method of using DNA as an input signal to achieve the detection of non-glucose targets based on PGM, which is the first of its kind in China.

[0022] 2. Universality. The G4 DNAzyme-reduced substrate-PGM signal conversion method involved in the present invention has the characteristics of universality and can be connected with different target recognition methods. For different targets to be tested, it is only necessary to change the target detection strategy to trigger the generation or consumption of DNAzyme, and it can be used for reporting these targets.

[0023] 3. Practicality. Existing PGM recycling technologies usually rely on protease modification (such as sucrose invertase-modified oligonucleotide probes) or nanotechnology. When performing different target detections, magnetic bead centrifugation operations or complex nanomaterial synthesis are required, which places high demands on detection personnel and conditions, thus making the detection have certain limitations. The detection method of the present invention does not require centrifugal elution and nanomaterial synthesis, so the PGM signal reporting becomes more practical and convenient.

[0024] 4. Economical. The existing PGM recycling technology involves high costs for protein modification, magnetic bead modification, nanomaterial preparation and centrifugal separation equipment, while the DNAzyme involved in the present invention is composed of ordinary nucleotides, does not require special modification, is easy to synthesize, and reagents such as reduced substrates, hemin, and H2O2 are relatively cheap, thus greatly reducing the detection cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is a schematic diagram of the change of PGM signal in the presence or absence of G4 DNAzyme in specific example 1.

[0026] Figure 2 It is a schematic diagram of the signal reporting strategy of specific embodiment 2 based on the target recognition method of programmable nuclease combined with G4 DNAzyme-reduced substrate-PGM.

[0027] Figure 3 This is a schematic diagram of specific embodiment 3 using an aptamer switch and CRISPR / Cas12a system combined with a G4 DNAzyme-reduced substrate-PGM signal reporting strategy for small molecule target ATP detection.

[0028] Figure 4 This is a schematic diagram of specific embodiment 4, which is a signal reporting strategy based on the CRISPR / Cas12a system combined with G4 DNAzyme-reduced substrate-PGM for protein target PNK detection. DETAILED DESCRIPTION

[0029] The present invention is further described below by examples in conjunction with the accompanying drawings. It should be understood by those skilled in the art that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0030] Example 1: Since G4 DNAzyme can change the reading of PGM by oxidizing and reducing substrates, this method can first be used to quantitatively detect different concentrations of G4 DNAzyme.

[0031] The reaction steps for measuring G4 DNAzyme concentration can be found in Figure 1A. Both reaction tubes contain the same concentration of reduced substrate, hemin, and H2O2. A certain concentration of G4 DNAzyme sequence is added to one of the reaction tubes, and water is added to the other reaction tube as a control. After reacting at room temperature for 30 minutes, 1 μL of the reaction solution is drawn into the liquid sample addition area of ​​the test strip and the PGM reading is observed. Since G4 DNAzyme can oxidize the reduced substrate in the presence of hemin and H2O2 to produce reaction products that cannot be recognized by the blood glucose meter, the PGM signal presents a low value; when there is no G4 DNAzyme in the system, the reduced substrate is not oxidized, so a high signal value is presented on the PGM. In addition to the reduced substrate, other components in the system do not cause changes in the PGM signal.

[0032] (1) The G4 DNAzyme sequence oligonucleotide G4 used for reducing oxidation must have peroxidase or oxidase activity after binding to hemin.

[0033] In this embodiment, the sequence 5'-GGTGGTGGTGGTTGTGGTGGTGGTGG-3' is selected as the preferred oligonucleotide G4.

[0034] (2) Reaction system and conditions.

[0035]

[0036] Make up the volume of the system to 20 μL with ultrapure water.

[0037] The reaction conditions were: incubation at room temperature for 30 min.

[0038] 1 negative control: the above reaction system without adding oligonucleotide G4.

[0039] (3) Detection method

[0040] After the reaction is completed, take 1 μL of the reaction solution and test it directly with a blood glucose test strip inserted into the PGM, and record the PGM reading.

[0041] (4) Test results

[0042] As attached Figure 1 As shown in B, in the reaction system containing different reduced substrates (NADH, o-phenylenediamine, sodium ascorbate), when oligonucleotide G4 was added, the PGM reading was significantly reduced compared with the reaction without oligonucleotide G4, and a reading difference (Δreadout) appeared between the two, realizing the conversion from G4 DNAzyme to PGM signal. Figure 1As shown in Figure C, NADH was selected as the representative reducing substrate. As the concentration of oligonucleotide G4 increased, the PGM reading gradually decreased, and Δreadout changed linearly with the concentration of oligonucleotide G4. The standard curve can be used to achieve quantitative detection of oligonucleotide G4.

[0043] Example 2: Using the programmable nuclease CRISPR / Cas12a system as a target detection tool, combined with G4 DNAzyme-reduced substrate-PGM as a signal reporting tool, the signal of the non-glucose target is converted into a G4 DNAzyme concentration signal, and then converted into a PGM signal.

[0044] The CRISPR / Cas12a system has the ability to trans-cleave single-stranded DNA triggered by target DNA recognition, which can achieve specific activated signal amplification. It has been successfully used in the detection of a variety of molecules, including nucleic acid and non-nucleic acid targets. Combining the specific target recognition function of the CRISPR / Cas12a system with G4 DNAzyme-reduced substrate-PGM can construct a versatile biosensor platform.

[0045] like Figure 2 As shown in A, since the trans-cleavage activity of the CRISPR / Cas12a system cannot act on the guanine-rich G4 DNAzyme, in this strategy, we introduced the blocking sequence (blocker) of G4 DNAzyme as the trans-cleavage substrate of the CRISPR / Cas12a system. Figure 2 As shown in B, the addition of blocker can effectively block the peroxidase activity of G4 DNAzyme. Based on this strategy, when the target to be tested is present, the trans-cleavage activity of the CRISPR / Cas12a system is specifically activated, cutting off the blocker sequence, and the G4 DNAzyme added later will not be blocked by the blocker.

[0046] The sequence is closed, the peroxidase activity is normally exerted, and the reduced substrate added to the oxidation system eventually leads to a decrease in the PGM signal. On the contrary, when the target to be tested does not exist, the CRISPR / Cas12a system remains inactive, the blocker sequence remains intact, and the added G4 DNAzyme is then blocked, which eventually leads to a high value for the PGM reading. According to the concentration of the added target, the concentration of the chopped blocker sequence and the concentration of G4 DNAzyme can be affected, and finally the PGM reading has a certain linear relationship with the target concentration. Through this principle, the recognition signal of the non-glucose target can be converted into a concentration change of G4 DNAzyme via the CRISPR / Cas12a system, and then the PGM reading is affected, thereby realizing the detection of these targets.

[0047] (1) Sequences used for CRISPR / Cas12a target detection and G4 DNAzyme blocking.

[0048] blocker: 5'-CCACCACCACCACAACCACCACCACC-3'(SEQ NO ID:2)

[0049] Guide RNA: 5'-AAUUUCUACUAAGUGUAGAUUGCCUGUGUAGACAUUG-3' (SEQ NO ID: 4)

[0050] Target double-stranded DNA to be tested: 5'-CGTCAATGTCTACACAGGCA-3' (SEQ NO ID: 3)

[0051] (2) Reaction system and conditions

[0052]

[0053] Make up the volume of the system to 10 μL with ultrapure water.

[0054] The Cas12a cleavage reaction conditions were: incubation at 37°C for 30 min.

[0055] A negative control is a system in which the target double-stranded DNA to be tested is replaced by water.

[0056] (3) Detection method

[0057] Add 0.75 μM oligonucleotide G4 to the Cas12a cleavage reaction, heat at 94°C for 1 min, and quickly cool to room temperature. Then, add 2 μL of G4 reaction buffer, 625 μM hemin, 1 mM ATP, 10 mM NADH, and 10 mM H2O2, and make up the system to 20 μL with ultrapure water. React at room temperature for 30 min, then take 1 μL of the reaction product and use PGM for reading report.

[0058] (4) Test results

[0059] As attached Figure 2 As shown in C, adding different concentrations of the target double-stranded DNA to be detected can produce different signal changes on the PGM, and the value of Δreadout decreases as the concentration of the target double-stranded DNA to be detected decreases. This method can be directly used for the detection of nucleic acid targets.

[0060] Example 3: Use the aptamer switch and CRISPR / Cas12a system as target detection tools, combined with G4DNAzyme-reduced substrate-PGM as a signal reporting tool to detect small molecules.

[0061] Aptamers are a class of oligonucleotide single strands that can bind to specific target molecules with high affinity and specificity. They can be DNA, RNA sequences, or nucleic acid analogs (XNA). After binding to specific small molecules, aptamers undergo conformational changes. Many researchers have used this property to construct aptamer-based switch strategies to detect different small molecules. In this implementation case, we selected adenosine triphosphate (ATP) as a representative small molecule, used reported aptamers to construct aptamer switches, and combined CRISPR / Cas12a and G4 DNAzyme-reduced substrate-PGM system to achieve quantitative analysis of ATP.

[0062] like Figure 3 As shown in A, in this strategy, two aptamers that can specifically bind to ATP close the recognition sequence (activator) of crRNA, so that it is recognized by Cas12a / crRNA, so that the trans-cleavage activity of Cas12a cannot be activated. When ATP is added, the aptamer binds to ATP, so that a conformational change occurs, the aptamer switch is turned on, and the recognition sequence of crRNA is released, so as to activate the trans-cleavage activity of Cas12a, and the signal is converted into a G4 DNAzyme signal, and finally presented as a low reading of PGM. On the contrary, when there is no ATP, the aptamer switch cannot be turned on, Cas12a cannot be activated, and the PGM reading remains high.

[0063] (1) Sequence used for ATP detection.

[0064] Guide RNA: 5'-AAUUUCUACUAAGUGUAGAUAAGGUUUGUGUGUUUACCUG-3' (SEQ NO ID: 5)

[0065] Activator DNA: 5'-CCCAGGTAAACACACAAACCTT-3'(SEQ NO ID: 6)

[0066] ATP aptamer1: 5'-ACCTGGGGGAGTATTGCGGAGGAAGGTTTGTGT-3' (SEQ NO ID: 7)

[0067] ATP aptamer2: 5'-GTTTACCTGGGGGAGTATTGCGGAGGAAGGT-3' (SEQ NO ID: 8)

[0068] (2) Reaction system and conditions

[0069] The blocking probe was prepared by mixing ATP aptamer 1, ATP aptamer 2 and ssDNA activation sequence in a final ratio of 3:3:1 in 1× binding buffer, then heated to 95°C for 5 min and cooled at room temperature. The ATP aptamer switch detection system is as follows:

[0070] 10x ATP reaction buffer 1 μL

[0071] Blocking probe 20nM

[0072] ATP 1μL

[0073] Make up the volume of the system to 10 μL with ultrapure water.

[0074] A negative control is a system in which the ATP to be tested is replaced by water.

[0075] The reaction conditions were: incubation at 37°C for 30 min.

[0076] (3) Detection method

[0077] Take 2 μL of the above incubation product to the shearing reaction of Cas12a (see Example 2 for the system), incubate at 37 ° C for 45 min, add 0.75 μM oligonucleotide G4 to the shearing reaction, heat at 94 ° C for 1 min, and quickly cool to room temperature. After that, continue to add 2 μL G4 reaction buffer, 625 μM hemin, 1 mM ATP, 10 mM NADH and 10 mM H2O2, and ultrapure water to make up the system to 20 μL. React at room temperature for 30 min, then take 1 μL of the reaction product and report the reading with PGM.

[0078] (4) Test results

[0079] As attached Figure 3 As shown in Figure B, the addition of ATP can produce different signal changes on PGM. The Δreadout value decreases as the concentration of the ATP to be tested decreases, and has a good linear relationship in the ATP concentration range of 12.5μM to 800μM, with a detection limit of 10.9μM. The above data prove that this method can be used for the detection of small molecule ATP. Given that there are relevant aptamers reported for different small molecules or proteins, combined with different aptamer switching strategies, this method has the potential to detect different small molecules and proteins.

[0080] Example 4: Using the CRISPR / Cas12a system as a target detection tool, combined with G4 DNAzyme-reduced substrate-PGM as a signal reporting tool, functional proteins were detected.

[0081] In order to verify the feasibility of this method for protein detection, this example takes the protein biomarker polynucleotide kinase (PNK) as the target and develops a strategy for PNK detection. Figure 4 As shown in A, in this strategy, we designed a PNK probe with a stem-loop structure for the 3'phosphatase activity characteristics of PNK, and the 3' end of the probe was modified with a phosphate group. When PNK is present in the system, the phosphate group at the 3' end of the probe can be removed by PNK, leaving a 3' terminal hydroxyl group that can be extended by DNA polymerase. Afterwards, under the action of DNA polymerase, the stem-loop probe uses itself as a template to form a double-stranded DNA product with a crRNA recognition sequence. The double-stranded DNA can be specifically recognized by Cas12a / crRNA and activates the trans-cleavage activity of Cas12a, thereby opening the downstream signal transmission, ultimately leading to a low PGM value. On the contrary, when PNK is not present in the system, the phosphate group at the 3' end of the probe blocks the extension of the DNA polymerase, causing it to be unable to produce a double-stranded DNA product that can activate Cas12a, so it cannot trigger subsequent signal transmission, ultimately leading to a high PGM reading.

[0082] (1) Sequences used for PNK detection.

[0083] Guide RNA: 5'-AAUUUCUACUAAGUGUAGAUUGCCUGUGUAGACAUUGACG-3' (SEQ NO ID: 9)

[0084] PNK probe:

[0085] 5'-TCTCCTACATTTTATGCCTGTGTAGACATTGACGGTGGACAGTCTTTTGACTGTC CAC-phosphate group-3' (SEQ NO ID: 10)

[0086] (2) Reaction system and conditions

[0087] Before testing, the PNK probe was heated at 95°C for 2 min and cooled at room temperature. The PNK detection system is as follows:

[0088]

[0089] Make up the volume of the system to 10 μL with ultrapure water.

[0090] A negative control was performed by replacing the PNK to be tested with water.

[0091] The reaction conditions were: incubation at 37°C for 15 min.

[0092] (3) Detection method

[0093] Take 1 μL of the above incubation product to the shearing reaction of Cas12a (see Example 2 for the system), incubate at 37 ° C for 30 min, add 0.75 μM oligonucleotide G4 to the shearing reaction, heat at 94 ° C for 1 min, and quickly cool to room temperature. After that, continue to add 2 μL G4 reaction buffer, 625 μM hemin, 1 mM ATP, 10 mM NADH and 10 mM H2O2, and ultrapure water to make up the system to 20 μL. React at room temperature for 30 min, then take 1 μL of the reaction product and use PGM for reading report.

[0094] (4) Test results

[0095] As attached Figure 4 As shown in B, the addition of PNK can produce different signal changes on PGM. The Δreadout value decreases with the decrease of the concentration of PNK to be tested, and has a good linear relationship in the PNK concentration range of 0.1 to 0.0001 U / mL, with a detection limit of 6.5×10 -5 The above data prove that this method can be used for the detection of protein target PNK.

Claims

1. A blood glucose meter signal conversion method based on G4 DNAzyme, characterized by: The reaction system includes a G4 DNAzyme-based peroxidase system and a reduced substrate; the reduced substrate can both cause a response from the blood glucose meter and be oxidized by the G4 DNAzyme-based peroxidase system, resulting in a decrease in the content of the reduced substrate in the reaction system and a decrease in the reading detected by the blood glucose meter.

2. The method for converting blood glucose meter signals based on G4 DNAzyme according to claim 1, characterized in that: When a mixture of a peroxidase system without G4 DNAzyme and a reduced substrate is detected by a blood glucose meter, the reading of the blood glucose meter is high. After G4 DNAzyme is added thereto, the peroxidase system based on G4 DNAzyme oxidizes the reduced substrate into an oxidized product, the content of the reduced substrate decreases, and the reading detected by the blood glucose meter decreases. Therefore, the signal of DNAzyme is converted into a change in the reading of the blood glucose meter, and the G4 DNAzyme can be qualitatively detected by whether the reading of the blood glucose meter changes or not. Different concentrations of G4 DNAzyme have different degrees of oxidation of the reduced substrate, resulting in different degrees of reduction in the reading of the blood glucose meter. The higher the concentration of G4 DNAzyme, the less the remaining reduced substrate and the lower the reading of the blood glucose meter. The concentration of G4 DNAzyme is negatively correlated with the reading of the blood glucose meter, and is positively correlated with the difference (Δreadout) of the blood glucose meter reading of the reaction system before and after the addition of G4 DNAzyme. A standard curve based on the concentration of G4 DNAzyme and Δreadout can be used to quantitatively analyze G4 DNAzyme.

3. The method for converting blood glucose meter signals based on G4 DNAzyme according to claim 1, characterized in that: The G4 DNAzyme-based peroxidase system comprises G4 DNAzyme, hemin, H2O2 and a reaction buffer; wherein the G4 DNAzyme is a guanine-rich nucleic acid sequence that can self-fold to form a G-quadruplex structure, and can exert a peroxidase-like activity when combined with porphyrin iron or its analogs, catalyzing the oxidation reaction of H2O2 on a reduced substrate; and the buffer is the most suitable buffer for the G4 DNAzyme used to exert the oxidative reaction enzyme activity.

4. The method for converting blood glucose meter signals based on G4 DNAzyme according to claims 1, 2 and 3, characterized in that: The G4 DNAzyme sequence is preferably 5'-GGTGGTGGTGGTTGTGGTGGTGGTGG-3' and its multimeric sequence repeated multiple times; the preferred buffer for adaptation is: 10mM Tris-HCl (pH=7.2), 100mM KCl, 20mM NaCl, 1% DMSO, 0.1% Triton X-100.

5. The method for converting blood glucose meter signals based on G4 DNAzyme according to claims 1, 2 and 3, characterized in that: The reduced substrate includes all substances that can cause changes in blood glucose meter readings and can be oxidized by G4 DNAzyme, preferably NADH, o-phenylenediamine, and sodium ascorbate.

6. Application of the G4 DNAzyme-based blood glucose meter signal conversion method in non-glucose target detection, characterized by: A signal sensing method associated with G4 DNAzyme is established for different non-glucose targets to be detected, and the non-glucose target signal is converted into the generation or consumption of G4 DNAzyme. Combined with the blood glucose meter signal conversion method based on G4 DNAzyme according to claims 1 to 5, the oxidation of the reduced substrate by G4 DNAzyme is further converted into a change in the amount of the reduced substrate, and then converted into a change in the blood glucose meter reading, and different targets are qualitatively and quantitatively detected through the changes in the blood glucose meter readings.

7. The application of the G4 DNAzyme-based blood glucose meter signal conversion method in non-glucose target detection according to claim 6, characterized in that: The non-glucose targets include nucleic acids, proteins, and small molecules.

Images