Method for detecting miR-21 based on pincerlike DNA scaffold and space local synergistic catalysis hairpin self-assembly strategy

Abstract

The invention develops a method for detecting microRNA-21 (miR-21) on the basis of a pincerlike DNA (Deoxyribose Nucleic Acid) bracket and spatial local synergistic catalysis hairpin self-assembly. If the sample to be detected contains the miR-21, the miR-21 can induce the primary catalytic hairpin self-assembly reaction to generate the three-legged Y-type DNA. And the three tail ends of the three-legged Y-type DNA can catalyze the pincer-like DNA scaffold on the gold nanoparticles to generate a catalytic hairpin self-assembly reaction. Meanwhile, the three tail ends are close in space, so that the local concentration of the secondary catalytic hairpin self-assembly catalyst is greatly increased. In addition, the pincerlike DNA scaffold on the gold nanoparticles has two pairs of molecular hairpins which are close to each other tightly, so that the concentration of a secondary catalytic hairpin self-assembly reactant is increased. Through the spatial constraint design, the effective concentration of reactants is greatly improved. The reaction time of two levels of catalytic hairpin self-assembly is shortened to 40 min, and the detection limit is as low as 0.1 pM. In addition, the space and local collaborative catalytic hairpin self-assembly strategy has good practical application capability and wide application prospect in the aspects of disease diagnosis and monitoring.

Description

Technical Field

[0001] The present invention relates to a method for detecting miR-21 based on a clamp-shaped DNA scaffold and a spatially localized coordinated catalytic hairpin self-assembly strategy. Background Art

[0002] MicroRNA (miRNA) is a widely distributed endogenous non-coding RNA that is widely present in animals, plants and viruses. MiRNA is related to the occurrence, development and prognosis of tumors, and plays an important role in tumor proliferation, differentiation and apoptosis. A large number of research results have shown that many miRNAs can act as proto-oncogenes or tumor suppressor genes and play an important role in the occurrence and development of tumors, among which miR-21 is the most valued. As one of the earlier discovered human miRNAs, miR-21 has become an important tool in the study of human miRNA functions due to its relatively clear existence background. Studies have found that miR-21 is abnormally expressed in human ovarian cancer tissues, and miR-21 may play its oncogene role by inhibiting the expression of PTEN protein. The expression level of miR-21 in serum has important reference value for the diagnosis of gynecological tumors such as ovarian tumors and uterine tumors. At present, common miRNA detection methods RT-qPCR, Northern Blot and microarray are widely used to detect miRNA. The improvement of sensitivity is conducive to the detection of miRNA signals. However, some obvious disadvantages hinder their use, such as long processing time, cumbersome operation process and high false positive results. Therefore, new strategies to simplify the miRNA detection process and shorten the detection time are worth exploring.

[0003] Aptamer-based DNA nanotechnology has attracted extensive attention due to its unique advantages, including strong binding affinity, ease of use, easy chemical synthesis, good biocompatibility, and low cost. An aptamer is a small oligonucleotide sequence that is selected through a systematic evolution by exponential enrichment (SELEX) process. It has a strong affinity for its target through hydrogen bonding and hydrophobic interactions. Therefore, it is widely used in the detection of substances such as metal ions, small molecules, and proteins. Although these methods have their advantages, their low sensitivity greatly limits their practical applications. To improve the sensitivity, some studies have combined several enzyme-free isothermal amplification techniques, such as catalytic hairpin assembly (CHA), hybridization chain reaction (HCR), and entropy-driven catalysis (EDC). Different signal transduction biosensors have been developed, including colorimetry, fluorescence, electrochemistry, surface-enhanced Raman scattering (SERS), and electrochemiluminescence (ECL).

[0004] Traditional DNA-based amplification strategies have a single catalytic site, which leads to low collision reaction probability and low interaction efficiency, limiting reaction kinetics and sensitivity. To overcome this shortcoming, spatial localization strategy has become an attractive approach, which can assemble multiple catalytic sites on DNA nanostructures to increase catalyst concentration and accelerate the reaction. Therefore, designing a dual spatial localization strategy with spatial localization to increase catalyst concentration and reactant concentration is of great significance to improve amplification capacity and shorten reaction time.

[0005] In order to solve the problems in the prior art, the present invention proposes a method for detecting miR-21 based on a clamp-shaped DNA scaffold and a spatially localized cooperative catalytic hairpin self-assembly strategy. Summary of the invention

[0006] To solve the problems in the prior art, the present invention proposes a spatially localized synergistic catalytic hairpin self-assembly strategy for miR-21 detection. miR-21 can induce the primary catalytic hairpin self-assembly reaction to produce a tripodal Y-shaped DNA. The three ends of the tripodal Y-shaped DNA can catalyze the catalytic hairpin self-assembly reaction of the clamp-shaped DNA scaffold on the gold nanoparticle. At the same time, because the three tail ends are close in space, this greatly increases the local concentration of the secondary catalytic hairpin self-assembly catalyst. In addition, the clamp-shaped DNA scaffold on the gold nanoparticle has two pairs of molecular hairpins in close proximity to increase the concentration of the secondary catalytic hairpin self-assembly reactants. Through this spatially constrained design, the effective concentration is greatly improved. The reaction time of the two-level catalytic hairpin self-assembly is shortened to 40 minutes, and the detection limit is as low as 0.1 pM. In addition, the spatially localized synergistic catalytic hairpin self-assembly strategy has good practical application capabilities and broad application prospects in disease diagnosis and monitoring.

[0007] Specifically, the present invention provides a method for detecting miR-21 based on a clamp-shaped DNA scaffold and a spatially localized synergistic catalytic hairpin self-assembly strategy. The method comprises the following steps:

[0008] 1. A method for detecting miR-21 based on a clamp-shaped DNA scaffold and a spatially localized synergistic catalytic hairpin self-assembly strategy. The method comprises the following steps:

[0009] 1) Sequences S1, S2, S3, S4, H4 and H5 were dissolved in PBS buffer at the same molar ratio to form a clamp-shaped DNA scaffold. The resulting clamp-shaped DNA scaffold was then reacted with gold nanoparticles for 12 hours and fixed to the gold nanoparticles. The S1 sequence is 5'-GAATGCTGCGTGTAATCCGTCTGTCCACTGGCTACTGTC-3', the S2 sequence is 5'-GAGTACTAGAGGAACACGCAGCATTCACCTGTCTGTCGT-3', the S3 sequence is 5'-GGAC AGACGGATTTCCTCTAGTACTCCTGTGTGACTCCA-3', the S4 sequence is 5'-HS-TTTTTTTTTTT TTTTTTTTTTGGAGTCACACA-3', the H4 sequence is 5'-CGATCCAATCTACAGCAGATGTGTACC GCTGTAGATTGGATCGGTCCTTGATTTTTTTTGACAGTAGCCAGT-3', and the H5 sequence is 5'-FAM (fluorescein)-AGATGTGTACCCGATCCAATCTACAGCGGTACACATCT (BHQ1 / quencher) GCTGT AGATTTTTTTTTTACGACAGACAGGT-3'.

[0010] 2) The miR-21 sample to be tested is mixed with the sequences H1, H2 and H3 at the same molar ratio, and added to the solution obtained in step 1. The miR-21 sequence is 5'-UAGCUUAUCAGACUGAUGUUGA-3', the H1 sequence is 5'-TCAA GGACCGATATTGTCAACATCAGTCTGATAAGCTACAATCAACTAGCTTATCAGACTGAC CAATCTACAGC-3', the H2 sequence is 5'-TCAAGGACCGATTCAGTCTGATAAGCTAGTTGATTG GACTGATGTTGACAATCAACTAGCTCCAATCTACAGC-3', and the H3 sequence is 5'-TCAAGGACCG ATAGCTAGTTGATTGTCAACATCAGTCTAGCTTATCAGACTGATGTTGACAATCCAATCT ACAGC.

[0011] 3) Detect the fluorescence spectrum of the solution obtained in step 2, and use the standard curve method to obtain the concentration of miR-21 in the sample to be tested.

[0012] Preferably, step 1) is specifically as follows: H4 and H5 are heated to 90°C in advance and then slowly cooled to room temperature to form a nucleic acid molecular hairpin structure. Then, equimolar amounts of sequences S1, S2, S3, S4, H4 and H5 are dissolved in 10mM PBS buffer solution (100mM NaCl, pH 7.4), and then incubated at 37°C for 60 minutes to form a clamp-shaped DNA scaffold, and then 10nM gold nanoparticles are added to react for 12 hours to fix the clamp-shaped DNA scaffold to the surface of the gold nanoparticles.

[0013] Preferably, step 2) is specifically as follows: adding the sample miR-21 and H1, H2 and H3 in a molar ratio of 1:1:1 to the solution obtained in step 1, and incubating the mixture at 37°C for 40 minutes to form a tripodal Y-shaped DNA structure and to catalyze a hairpin self-assembly reaction with the clamp-shaped DNA scaffold on the gold nanoparticles in the solution.

[0014] Preferably, step 3) is specifically as follows: the fluorescence spectrum is excited at 486 nm, and the emission spectrum is scanned at 505-600 nm. The concentration of miR-21 in the sample to be tested is obtained using the standard curve method. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 (A) The formation process of the clamp-shaped DNA scaffold and its modification onto gold nanoparticles. (B) Schematic diagram of the detection process of the present invention.

[0016] Figure 2 (A) Fluorescence stability of the clamp-shaped DNA scaffold. (B) Fluorescence intensity of different combination samples: (1) H1+H2+H3+S1+S2+S3+S4+H4+H5+Au nanoparticles (lacking miR-21); (2) miR-21+H2+H3+S1+S2+S3+S4+H4+H5+Au nanoparticles (lacking H1); (3) miR-21+H1*+H2*+H3*+S1+S2+S3+S4+H4+H5+Au nanoparticles (H1*, H2* and H3* do not have the catalytic chains at the tail ends of H1, H2 and H3); (4) miR-21+H2+H3+S1+S2+S3+S4+H5+Au nanoparticles (lacking H4); (5) miR-21+H1+H2+H3+S1+S2+S3+S4+H4+H5+Au nanoparticles.

[0017] Figure 3 Comparison of the results of the selectivity study of the method of the present invention on miR-21 and other similar sequences. The six samples consisted of the following: blank sample, miR-16, miR-92a, miR-146a, miR-21 and mixed sample (the mixed sample contained miR-21 and other miRNA sequences). Specific embodiments

[0018] The present invention will be further described in detail below in conjunction with the embodiments.

[0019] The detection method and steps of the present invention are as follows:

[0020] 1) Heat H4 and H5 to 90°C in advance and then slowly cool to room temperature to form a nucleic acid molecular hairpin structure. Then dissolve equimolar amounts of sequences S1, S2, S3, S4, H4 and H5 in 10mM PBS buffer solution (100mM NaCl, pH7.4), and then incubate at 37°C for 60 minutes to form a clamp-shaped DNA scaffold, and then add 10nM gold nanoparticles to react for 12 hours to fix the clamp-shaped DNA scaffold to the surface of the gold nanoparticles. The S1 sequence is 5'-GAATGCT GCGTGTAATCCGTCTGTCCACTGGCTACTGTC-3', the S2 sequence is 5'-GAGTACTAGAGGAAC ACGCAGCATTCACCTGTCTGTCGT-3', the S3 sequence is 5'-GGACAGACGGATTTCCTCTAGTAC TCCTGTGTGACTCCA-3', the S4 sequence is 5'-HS-TTTTTTTTTTTTTTTTTTTTTGGAGTCACAC A-3', the H4 sequence is 5'-CGATCCAATCTACAGCAGATGTGTACCGCTGTAGATTGGATCGGTC CTTGATTTTTTTTGACAGTAGCCAGT-3', and the H5 sequence is 5'-FAM (fluorescein)-AGATGTGTACC CGATCCAATCTACAGCGGTACACATCT (BHQ1 / quencher) GCTGTAGATTTTTTTTTTACGACAGACAGGT-3'.

[0021] 2) The sample miR-21 was mixed with H1, H2 and H3 at a molar ratio of 1:1:1 in a 10mM PBS buffer solution (100mM NaCl, pH 7.4) containing gold nanoparticles modified with a clamp-shaped DNA scaffold and incubated at 37°C for 40min. The formed tripodal Y-shaped DNA structure and the clamp-shaped DNA scaffold fixed to the gold nanoparticles in the solution underwent a catalytic hairpin self-assembly reaction. The miR-21 sequence was 5′-UAGCUUAUCAGACUGAUGUUGA-3′, the H1 sequence was 5′-TCAAGGACCGATATTGTCAACATCAGTCTGATAAGCTACAATCAACTAGCTTAT CAGACTGACCAATCTACAGC-3′, the H2 sequence was 5′-TCAAGGACCGATTCAGTCTGATAAGCT AGTTGATTGGACTGATGTTGACAATCAACTAGCTCCAATCTACAGC-3′, and the H3 sequence was 5′-T CAAGGACCGATAGCTAGTTGATTGTCAACATCAGTCTAGCTTATCAGACTGATGTTGACAATCCAATCTACAGC.

[0022] 3) The fluorescence spectrum was excited at 486 nm, and the emission spectrum was scanned at 505-600 nm. The concentration of miR-21 in the sample to be tested was obtained using the standard curve method.

[0023] The above method is the best embodiment of the present invention.

[0024] The miR-21 detection principle of the present invention is as follows Figure 1 As shown. miR-21 catalyzes the primary catalytic hairpin self-assembly reaction between H1, H2, and H3 through toe-mediated strand displacement to form a tripod Y-shaped DNA with three catalytic tails. The catalytic tail of the tripod Y-shaped DNA can trigger the secondary catalytic hairpin self-assembly reaction on the clamp-shaped DNA scaffold on the gold nanoparticles, generating fluorescence intensity. Importantly, because the three tails of the tripod Y-shaped DNA are close in space, the local concentration of the catalyst for the secondary catalytic hairpin self-assembly is greatly increased. At the same time, the clamp-shaped DNA scaffold on the gold nanoparticles has two pairs of molecular hairpins in close proximity to increase the concentration of the secondary catalytic hairpin self-assembly reactants. Through this spatially constrained design, the effective concentration is greatly increased, which improves the reaction efficiency.

[0025] Feasibility characterization of the method

[0026] The stability of the clamp DNA scaffold affects the background fluorescence intensity, thus affecting the performance of the strategy. Therefore, the stability of the clamp DNA scaffold was evaluated by tracking the fluorescence signal of the clamp DNA scaffold within 4 hours. During this process, the fluorescence signal of the clamp DNA scaffold remained weak and stable, indicating that the hairpin on the clamp DNA scaffold was in a closed state, resulting in a weak fluorescence signal intensity during the experiment ( Figure 2 A).

[0027] A specially designed sample was used to study the feasibility of this strategy. Figure 2 As shown in B. The control sample lacking miR-21 showed a low fluorescence signal intensity in sample 1, indicating that the primary catalytic hairpin self-assembly cannot be triggered without miR-21. In sample 2, the H1 required for the primary catalytic hairpin self-assembly is missing, resulting in a relatively low signal intensity. This is because the reaction of the primary catalytic hairpin self-assembly is restricted. The tail end of the tripod Y-shaped DNA was deleted in sample 3, and the sample only showed a background signal. This can be explained by the inhibition of the secondary catalytic hairpin self-assembly reaction in the absence of the catalytic tail end of the secondary catalytic hairpin self-assembly. In sample 4, H4 is missing, and there is only fluorescence with background signal intensity, which is because the absence of H4 inhibits the secondary catalytic hairpin self-assembly reaction. When the method of the present invention is used to detect a solution containing miR-21 (sample 5), the fluorescence intensity is the highest, indicating that the catalytic hairpin self-assembly strategy of spatially localized synergistic catalytic effect significantly improves the effective reaction concentration of the catalyst and reactants.

[0028] The selectivity of the present invention for miR-21

[0029] The anti-interference and specificity of the method of the present invention for detecting miR-21 were evaluated by using some heterologous miRNAs: miR-16, miR-92a, and miR-146a. Figure 3 As shown, the method of the present invention exhibits strong fluorescence signals for miR-21 samples and mixed samples, indicating that only miR-21 can trigger the two-stage catalytic hairpin self-assembly reaction and obtain strong fluorescence signals ( Figure 3 ). These results show that the present invention has good anti-interference and specificity.

[0030] Practicality of miR-21 detection

[0031] In order to evaluate the practical application performance of the strategy, the actual analytical ability of the proposed strategy was evaluated by detecting miR-21 in real samples. Different concentrations of miR-21 were added to 10-fold diluted healthy human serum for recovery test. As shown in Table 1, the recovery rate varied from 92.2% to 104.9%, and the RSD varied from 4.4% to 8.1%. The data clearly show that the present invention has been successful in detecting miR-21 in actual human serum. It meets the requirements of practical application.

[0032] Table 1. Practical applications of miR-21 detection in human blood samples

[0033]

[0034] In summary, the present invention has developed a catalytic hairpin self-assembly strategy with spatial localized synergistic catalytic effect to detect miR-21. Through this spatial localized design, the effective concentration of reactants and catalysts is greatly improved. The reaction rate of miR-21 is accelerated. The detection limit is increased to 0.1pM, and the incubation time of miR-21 is shortened to 40min. In addition, the present invention provides reference value for miRNA detection and disease diagnosis.

Claims

1. A method for detecting miR-21 based on a clamp-shaped DNA scaffold and a spatially localized synergistic catalytic hairpin self-assembly strategy. The method comprises the following steps: 1) Sequences S1, S2, S3, S4, H4 and H5 were dissolved in PBS buffer at the same molar ratio to form a clamp-shaped DNA scaffold. The resulting clamp-shaped DNA scaffold was then reacted with gold nanoparticles for 12 hours and fixed to the gold nanoparticles. The S1 sequence is 5'-GAATGCTGCGTGTAATCCGTCTGTCCACTGGCTACTGTC-3', the S2 sequence is 5'-GAGTACTAGAGGAACACGCAGCATTCACCTGTCTGTCGT-3', the S3 sequence is 5'-GGACAGACGGATTTCCTCTAGTACTCCTGTGTGACTCCA-3', the S4 sequence is 5'-HS-TTTTTTTTTTTTTTTTTTTTTGGAGTCACACA-3', the H4 sequence is 5'-CGATCCAATCTACAGCAGATGTGTACCGCTGTAGATTGGATCGGTCCTTGATTTTTTTTGACAGTAGCCAGT-3', and the H5 sequence is 5'-FAM-AGATGTGTACCCGATCCAATCTACAGCGGTACACATCT(BHQ1)GCTGTAGATTTTTTTTTTACGACAGACAGGT-3'. 2) The miR-21 sample to be tested is mixed with the sequences H1, H2 and H3 at the same molar ratio, and added to the solution obtained in step 1. The miR-21 sequence is 5'-UAGCUUAUCAGACUGAUGUUGA-3', the H1 sequence is 5'-TCAAGGACCGATATTGTCAACATCAGTCTGATAAGCTACAATCAACTAGCTTATCAGACTGACCAATCTACAGC-3', the H2 sequence is 5'-TCAAGGACCGATTCAGTCTGATAAGCTAGTTGATTGGACTGATGTTGACAATCAACTAGCTCCAATCTACAGC-3', and the H3 sequence is 5'-TCAAGGACCGATAGCTAGTTGATTGTCAACATCAGTCTAGCTTATCAGACTGATGTTGACAATCCAATCTACAGC. 3) Detect the fluorescence spectrum of the solution obtained in step 2, and use the standard curve method to obtain the concentration of miR-21 in the sample to be tested.

2. The method according to claim 1, characterized in that Step 1) is specifically as follows: H4 and H5 are preheated to 90°C and then slowly cooled to room temperature to form a nucleic acid molecular hairpin structure. Then, equimolar amounts of sequences S1, S2, S3, S4, H4 and H5 are dissolved in 10mM PBS buffer solution (100mM NaCl, pH 7.4), and then incubated at 37°C for 60 minutes to form a clamp-shaped DNA scaffold, and then 10nM gold nanoparticles are added to react for 12 hours to fix the clamp-shaped DNA scaffold to the surface of the gold nanoparticles.

3. The method according to claim 1, characterized in that Step 2) is specifically as follows: the sample miR-21 is mixed with H1, H2 and H3 in a molar ratio of 1:1:1 and added to the solution obtained in step 1, and mixed and incubated at 37°C for 40 minutes to form a tripodal Y-shaped DNA structure and to undergo a catalytic hairpin self-assembly reaction with the clamp-shaped DNA scaffold fixed to the gold nanoparticles in the solution.

4. The method according to claim 1, characterized in that Step 3) is specifically as follows: the fluorescence spectrum is excited at 486 nm, and the emission spectrum is scanned at 505-600 nm. The concentration of miR-21 in the sample to be tested is obtained using the standard curve method.

Images