Product for KRAS gene detection based on combination of dumbbell-type probe and RCA and application of product

Abstract

The invention relates to a product for KRAS gene detection based on combination of a dumbbell-shaped probe and RCA, the product comprises the dumbbell-shaped probe, DNA ligase and an RCA amplification reagent, the dumbbell-shaped probe comprises a stem part and a two-ring part, the ends of the two-ring part are connected through the stem part, one ring of the dumbbell-shaped probe contains a G-quadruplex aptamer PW17 complementary sequence, and the other ring of the dumbbell-shaped probe contains a G-quadruplex aptamer PW17 complementary sequence. One ring contains a complementary sequence of a G-quadruplex aptamer T30695, the other ring contains a complementary sequence of a G-quadruplex aptamer T30695, the RCA amplification reagent comprises Phi29DNA polymerase, dNTPs and a Phi29DNA polymerase reaction buffer solution, the stem part of the dumbbell-shaped probe is opened under the mediation of DNA ligase and a detection gene, and the cut is connected to form a closed ring structure which is used as a template of the RCA. By adopting the technical scheme, the invention provides a product for detecting the KRAS gene based on the combination of the dumbbell probe and the RCA, and compared with the traditional method, the product is more convenient and more efficient when the mononucleotide mutation of the gene is tested.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a product for KRAS gene detection based on the combination of a dumbbell-shaped probe and RCA and a use thereof. Background Art

[0002] KRAS is a gene that plays a key role in cell signaling, primarily regulating cell growth, division, and survival. Mutations in the KRAS gene are frequently encountered in various human cancers. In particular, the incidence of KRAS mutations in non-small cell lung cancer (NSCLC) is approximately 30%, in colorectal cancer (CRC) 30-50%, and in pancreatic ductal adenocarcinoma 80%. Mutations usually occur at a single nucleotide substitution at codon 12, with G12D being the most common. G12D mutations account for 20-50% of KRAS-mutated cancers, depending on the cancer type. These mutations lead to persistent activation of the KRAS protein, which can stimulate cell proliferation and inhibit apoptosis, promoting tumor initiation and progression. KRAS G12D mutations pose challenges to traditional treatments, and for colorectal cancer, G12D often leads to poor response to chemotherapy and a higher risk of recurrence. G12D patients are also unable to benefit from anti-EGFR therapy, which has been shown to benefit CRC patients resistant to other therapies.

[0003] Given that KRAS G12D single nucleotide mutations play a key role in prognostic assessment and treatment decision-making, polymerase chain reaction (PCR) and next-generation sequencing (NGS) are the most commonly used methods for detecting gene mutations, which are characterized by high specificity and sensitivity. However, these methods rely on special cost-intensive equipment and professional operators. Summary of the invention

[0004] Purpose of the invention: In order to overcome the defects of the prior art, the present invention provides a product for KRAS gene detection based on a combination of a dumbbell-shaped probe and RCA, the results of which can be judged by the naked eye without the need for precision instruments. Compared with traditional methods, it is more convenient and more efficient when testing single nucleotide mutations of genes.

[0005] The technical solution of the present invention is a product for KRAS gene detection based on the combination of a dumbbell-shaped probe and RCA. The product comprises a dumbbell-shaped probe, a DNA ligase and an RCA amplification reagent. The dumbbell-shaped probe comprises a stem and two loops, the ends of the two loops are connected via the stem, one of the loops of the dumbbell-shaped probe contains a complementary sequence of a G-quadruplex aptamer PW17, and the other loop contains a complementary sequence of a G-quadruplex aptamer T30695. A cut is provided on the stem for identifying and combining with a mutation site of a detection gene. The RCA amplification reagent comprises a Phi29 DNA polymerase, dNTPs and a Phi29 DNA polymerase reaction buffer. Under the mediation of the DNA ligase and the detection gene, the stem of the dumbbell-shaped probe is opened, the cut is connected to form a closed ring structure, and serves as a template for RCA to generate a G-quadruplex sequence. The G-quadruplex sequence combines with heme to imitate horseradish peroxidase.

[0006] It is further arranged that the sequence of the dumbbell-shaped probe is CAGCTCCAACTACCCCAACCCGCCCTACCCAAAGTTGGAGCTGTATGGCGTAGGCTTAACCCACCCACCCACCCTTGCCTACGCCAT.

[0007] It is further arranged that the stem is a complementary chain composed of reverse complementary paired base pairs, namely an upper chain and a lower chain, and the upper chain contains the nick.

[0008] It is further configured that the last base at the 3' end of the dumbbell-shaped probe is a thymine nucleotide, which can identify the mutation site adenine of the detection gene; when the detection gene is present, the base T of the dumbbell-shaped probe is perfectly paired with the A of the mutation site; the upper chain part and the lower chain part of the dumbbell-shaped probe are separated, and under the action of DNA ligase, the separated ends are connected and cyclized to form a closed ring structure; when the dumbbell-shaped probe encounters the wild-type KRAS gene, there is a base mismatch, which prevents the complete hybridization of the dumbbell-shaped probe stem and the target, resulting in the inability to effectively separate the upper chain and the lower chain of the stem.

[0009] It is further configured that the RCA reaction process will produce a long tandem repeat sequence composed of an alternating G-quadruplex sequence; the long tandem repeat sequence is GGGTGGGTGGGTGGGTTAAGCCTACGCCATACAGCTCCAACTTTGGGTAGGGCGGGTTGGGGTAGTTGGAGCTGATGGCGTAGGCAAGGGTGGGTGGGTGGGTTAAGCCTACGCCATACAGCTCCAACTTTGGGTAGGGCGGGTTGGGGTAGTTGGAGCTGATGGCGTAGGCAA.

[0010] It is further configured that the PW17 complementary sequence is CCCAACCCGCCCTACCC; the T30695 complementary sequence is ACCCACCCACCCACCC.

[0011] It is further provided that the length of the stem is 7 to 13 nt.

[0012] It is further configured that the concentration of the dumbbell-shaped probe is 5-15 μM, and the concentration of dNTPs is 5-15 mM.

[0013] Another object of the present invention is the use of the above detection product in the preparation of a detection product for detecting KRAS gene.

[0014] The beneficial effects of the present invention are that the dumbbell-shaped probe is combined with rolling circle amplification (RCA) for visual detection of KRASG12D. The test results can be directly interpreted by the naked eye without relying on precision instruments, which lowers the detection threshold and is suitable for instant detection or detection scenarios with limited resources. It can greatly assist pathologists in making quick and accurate judgments, and the product has high specificity and high sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 A schematic diagram of a dumbbell-shaped probe and a detection method according to a specific embodiment of the present invention; Figure 2 The results of agarose gel electrophoresis, absorbance and absorption spectrum of the specific embodiment of the present invention are as follows; Figure 3 Schematic diagram of RCA reaction products of different dumbbell-shaped probes according to specific embodiments of the present invention and the detection results of kinetics, absorbance and absorption spectrum; Figure 4 The product color development results of the RCA reaction of four dumbbell-shaped probes at different KRAS G12D concentrations in a specific embodiment of the present invention; Figure 5 Schematic diagram of a linear probe and dumbbell-shaped probes with different stem lengths according to a specific embodiment of the present invention, and absorbance detection results of dumbbell-shaped probe stem length optimization and RCA reaction time optimization; Figure 6 This is the color development result after optimizing the stem length of the dumbbell-shaped probe and the RCA reaction time in a specific embodiment of the present invention; Figure 7 It is an analysis diagram of the sensitivity of colorimetric determination in a specific embodiment of the present invention; Figure 8 It is a specific analysis diagram of the detection method of a specific embodiment of the present invention; Fig. 9 The absorbance detection and color development results of the specific embodiment of the present invention at different concentrations with or without 200 nM KRAS G12D gene; Fig.10 The following are the test flow chart and real sample test results of the specific embodiment of the present invention; Fig.11 This is a summary diagram of the results of blind testing of specific embodiments of the present invention. DETAILED DESCRIPTION

[0016] The technical scheme in this embodiment will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0017] In addition, the technical solutions between the various embodiments of the present invention may be combined with each other, but this must be based on the fact that they can be implemented by those skilled in the art. When the combination of technical solutions is mutually contradictory or cannot be implemented, it should be deemed that such combination of technical solutions does not exist and is not within the scope of protection required by the present invention. Example

[0018] A product for KRAS gene detection based on a combination of a dumbbell-shaped probe and RCA, the product comprising a dumbbell-shaped probe, a DNA ligase and an RCA amplification reagent, the dumbbell-shaped probe comprising a stem and two loops, the ends of the two loops being connected via the stem, one of the loops of the dumbbell-shaped probe containing a complementary sequence of a G-quadruplex aptamer PW17, the other loop containing a complementary sequence of a G-quadruplex aptamer T30695, the stem being provided with a cutout for identifying and binding to a mutation site of a detected gene, the RCA amplification reagent The reagents include Phi29 DNA polymerase, dNTPs and Phi29 DNA polymerase reaction buffer. Under the mediation of DNA ligase and the detection gene, the stem of the dumbbell-shaped probe is opened, and the incision is connected to form a closed circular structure, which serves as a template for RCA to generate a G-quadruplex sequence. The G-quadruplex sequence combines with heme to mimic horseradish peroxidase to form a reaction with horseradish peroxidase (HRP) and catalyze the reaction of 2,2'-azo-bis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS) with hydrogen peroxide (H 2 O 2 ) to produce a visible green color. The test results can be directly interpreted by the naked eye without relying on precision instruments, which lowers the detection threshold. It is suitable for instant detection or detection scenarios with limited resources. It can greatly assist pathologists in making quick and accurate judgments, and the product has high specificity and high sensitivity.

[0019] Materials and reagents The oligonucleotides were synthesized and purified by Sangon Biotechnology (Shanghai) Co., Ltd. by HAP. The sequences of the oligonucleotides are shown in Table S1 Table S1 The underlined parts in Table S1 are the recognition regions of the targets, and the italic letters indicate the mutation sites compared with the wild-type KRAS gene.

[0020] All lyophilized oligonucleotides were dissolved in 1× TE buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH = 8.0) and stored at 4 °C until use.

[0021] Phi29 DNA polymerase was purchased from Nanjing Novozyme Biotechnology Co., Ltd., and 9°N DNA ligase was purchased from NewEngland Biolabs Ltd.

[0022] Deoxyribonucleotide mixed solution (dNTPs, 10 mM) was purchased from Sangon Biotechnology (Shanghai) Co., Ltd.

[0023] Heme and ABTS were purchased from Sigma-Aldrich Co. LLC.

[0024] The water used in the experiment was ultrapure water from the Avidity Science water purification system (resistivity ≥ 18.2 MΩ cm).

[0025] Example 2 Preparation method of product S1. Connection of dumbbell-shaped probe: dissolve the dumbbell-shaped probe in TE buffer and denature it at 95°C for 5 min, then gradually cool it to room temperature; S2. Add 1 μL of the prepared dumbbell probe (10 μM) and 1 μL of the target KRAS gene to 1.5 μL of 10×9°N DNA ligase reaction buffer (100 mM Tris-HCl, 6000 μM ATP, 25 mM DTT, 25 mM MgCl2, 1% Triton X-100, pH 7.5), 0.5 μL of 9°N DNA ligase and 11 μL of ddHO. 2 O in a 1.5 mL centrifuge tube, the target concentration was 200 nM, the resulting solution was kept at 45 ° C, the reaction time was 15 min, and then the mixture was incubated at 85 ° C for 10 min to terminate the reaction; S3, RCA reaction, i.e. rolling circle amplification technique; add 0.5 μL of Phi29 DNA polymerase, 2.5 μL of dNTPs (10 μM), 2.5 μL of 10× Phi29 DNA polymerase reaction buffer and 4.5 μL of ddH 2O, the resulting mixture was incubated at 30°C for 60 min, and then incubated at 65°C for 10 min to terminate the reaction; the final volume of the RCA reaction was 25 μl; S4, add 0.5 μL of heme and 80 μL of 2× HEPES buffer (50 mM HEPES, 20 mM KCl, 0.4 M NaCl, 2% DMSO, 0.1% Triton X-100, pH 5.2) to the solution in S3 and mix, and incubate the mixture at 37°C for 30 min to form DNase; S5. Add 9 μL 40 mM ABTS and 5 μL 4 mM H 2 O 2 The resulting solution was reacted for 30 min.

[0026] like Figure 1 A shows the design of a dumbbell-shaped probe, wherein the stem of the dumbbell-shaped probe is a complementary chain composed of reverse complementary paired base pairs, namely an upper chain and a lower chain, and the upper chain contains a nick that can recognize and bind to the mutation site of the KRAS G12D gene.

[0027] The sequence of the dumbbell probe is CAGCTCCAACTACCCCAACCCGCCCTACCCAAAGTTGGAGCTGTATGGCGTAGGCTTAACCCACCCACCCACCCTTGCCTACGCCAT. One loop of the dumbbell probe contains the complementary sequence of the G-quadruplex aptamer PW17, and the other loop contains the complementary sequence of the G-quadruplex aptamer T30695, the complementary sequence of PW17 is CCCAACCCGCCCTACCC; the complementary sequence of T30695 is ACCCACCCACCCACCC.

[0028] like Figure 1 As shown in B, it is a schematic diagram of the dumbbell-shaped probe combined with RCA reaction for visual detection of KRAS G12D; the last base at the 3' end of the dumbbell-shaped probe is designed as a thymine nucleotide, which can specifically recognize and bind to the mutation site of the KRASG12D gene, where adenine (A) exists; when the KRAS G12D target is present, the T at the 3' end of the probe perfectly matches the A at the mutation site; this specific binding allows the two ends of the dumbbell-shaped probe to be separated through intramolecular hybridization to form the stem structure; with the help of DNA ligase, these separated ends can be connected and circularized in the presence of the mutant target to form a closed ring structure; once circularized, the probe serves as a template and the KRAS G12D chain as a primer for RCA amplification under the action of phi29 DNA polymerase with strong chain displacement activity.

[0029] The RCA reaction process produces a long tandem repeat sequence composed of an alternating G-quadruplex sequence: GGGTGGGTGGGTGGGTTAAGCCTACGCCATACAGCTCCAACTTTGGGTAGGGCGGGTTGGGGTAGTTGGAGCTGATGGCGTAGGCAAGGGTGGGTGGGTGGGTTAAGCCTACGCCATACAGCTCCAACTTTGGGTAGGGCGGGTTGGGGTAGTTGGAGCTGATGGCGTAGGCAAGGGTGGGTGGGTGGGTTAAGCCTACGCCATACAGCTCCAACTTTGGGTAGGGCGGGTTGGGGTAGTTGGAGCTGATGGCGTAGGCAA; this sequence can bind to heme to form a DNA enzyme with horseradish peroxidase (HRP) activity; this DNA enzyme can be oxidized in HRP. 2 O 2 The substrate ABTS is oxidized in the presence of Figure 1 As shown in C.

[0030] In contrast, when the probe encounters the wild-type KRAS gene, there is a base mismatch that prevents complete hybridization of the probe stem and the target, and the upper and lower strands of the stem cannot be effectively separated; therefore, the ligation step cannot occur effectively and the subsequent amplification process cannot be initiated; since no G-quadruplex structure is formed, no DNA enzyme with HRP activity is produced, and therefore there is no catalytic conversion of ABTS and no color change in the detection solution, which is different from the output of the detection system containing KRAS G12D; this method uses this property to distinguish mutant and wild-type KRAS genes with high accuracy and obvious visual distinction.

[0031] Example 3: Feasibility Assessment by Agarose Gel Electrophoresis and Colorimetric Absorbance of Various Reaction Mixtures like Figure 2 Figure A shows agarose gel electrophoresis analysis of various reaction mixtures. Tracks b to e represent reaction mixtures lacking one of the essential components for RCA: DNA ligase (track b), phi29 DNA polymerase (track c), dumbbell-shaped probe (track d), and target DNA (KRAS G12D) (track e). In these tracks, no high molecular weight amplification products were observed. Track f, which contains all the essential components, shows a clear band at the top, indicating the production of large molecular weight products, indicating that these components are essential for the RCA process to occur. We also performed a colorimetric assay for the final RCA product in each reaction mixture.

[0032] like Figure 2 As shown in C, the Figure 2The absorbance of each reaction mixture in A at 420 nm, the error bars represent the mean ± standard deviation (n = 3), ***, P < 0.001, one-way ANOVA; only sample f was observed to have a significant color change, which is consistent with the positive RCA reaction detected by gel electrophoresis in f; Figure 2 Figure B in the figure is Figure 2 UV-vis spectra of each reaction mixture in A; the product of the RCA reaction was further confirmed because it showed a characteristic absorption peak in sample f; the absorbance value of the product at 420nm was further measured, and the absorbance value of sample f was significantly higher than that of other negative controls. The absorbance measurement was performed using a Thermo Scientific Varioskan LUX multi-function microplate reader at 400~440nm, and UV-vis spectroscopy was performed in the wavelength range of 400~500nm. Kinetic detection was completed in the kinetic mode of the Molecular Devices SpectraMax 190 microplate reader.

[0033] Example 4: To improve the colorimetric performance, the dumbbell-shaped probes of the experimental group and the dumbbell-shaped probes of the three control groups were compared. The dumbbell-shaped probes of the experimental group contained double G-quadruplex complementary sequences in both loops; e.g. Figure 3 As shown in A, it is a schematic diagram of four dumbbell probes and their products produced by RCA reaction. Dumbbell probe 11 contains G-quadruplex complementary sequences in both rings, and the product after RCA reaction is P; dumbbell probe 11-A and dumbbell probe 11-B contain G-quadruplex complementary sequences in only one ring, and produce products PA and PB, respectively; probe 11-C lacks G-quadruplex complementary sequences in both rings, and the product is PC.

[0034] Then, the kinetics of the four RCA products were measured at a wavelength of 420 nm; Figure 3 As shown in Figure B, the kinetics of the four RCA products were measured at a wavelength of 420 nm, and the dumbbell probe 11 had the highest reaction rate among the four dumbbell probes; this is because the dumbbell probe 11 can produce more G-quadruplex sequences within the same RCA reaction time; the dumbbell probe 11-C cannot produce any G-quadruplex sequence, so there is no obvious absorbance increase even in the presence of a specific target.

[0035] UV-vis spectra of four RCA products at 200 nM, 100 nM and 0 nM KRAS G12D were detected ( Figure 3 C) and absorbance at 420 nm ( Figure 3Dumbbell probe 11 showed the highest absorbance value at both 200 nM and 100 nM KRAS G12D concentrations; Figure 4 As shown in Figure 2, dumbbell-shaped probe 11 showed the best color development effect. In addition, the signal-to-noise ratio (S / N) analysis further confirmed the advantages of this probe, where dumbbell-shaped probe 11 produced the largest S / N value among the probes tested ( Figure 3 E).

[0036] In summary, the strategy of placing two G-quadruplex complementary sequences in the dumbbell-shaped probe significantly improved the colorimetric performance of KRAS G12D detection, and by generating more G-quadruplexes, the color development effect was enhanced, making it easier for the tester to observe.

[0037] Example 5: Effect of dumbbell-shaped probe stem length on test results The design of the dumbbell probe, especially the stem length, plays a key role in the specificity and sensitivity of the detection method to distinguish between KRAS G12D mutant sequences and wild-type sequences. A shorter stem is conducive to the hybridization of the probe to the target, but may lead to an increase in the background noise of nonspecific interactions; on the contrary, a longer stem requires more energy to open the stem of the probe to bind to the target, which reduces the nonspecific signal but may affect the output of the specific signal.

[0038] like Figure 5 As shown in A, a linear probe and four dumbbell-shaped probes with different stem lengths were designed; a series of probes with different stem lengths were designed while keeping the total length and recognition region of the probe consistent; the colorimetric performance of each probe was evaluated using the absorbance ratio of G12D to WT; The linear probe without stem showed the lowest AG12D / AWT ratio. As the length of the probe stem increased, the AG12D / AWT ratio increased accordingly, with Stem-11 reaching the highest ratio. Figure 5 As shown in Figure B, when the stem length was extended to Stem-13, the AG12D / AWT ratio decreased. Therefore, Stem-11 performed best in distinguishing KRAS G12D from KRASWT and was used throughout the subsequent experiments, as shown in Figure 2 Figure 6 The figure in the upper middle shows the optimization of the stem length of the dumbbell-shaped probe. The color development results of probes with different stem lengths after RCA reaction in the presence of KRAS G12D or KRAS wild type. When the stem length is 11 bases, the color contrast between G12D and WT is most obvious.

[0039] Optimizing the duration of the RCA reaction during the assay like Figure 5As shown in C, the time of RCA reaction is optimized; the value of AG12D / AWT increases with the increase of incubation time and reaches a plateau after 60 minutes, which indicates that this time can optimally allow the target to bind to the probe and achieve sufficient amplification without over-amplifying potential non-specific products; Figure 6 The figure in the lower middle shows the optimization of the RCA reaction time. The color development results of different RCA reaction times in the presence of KRAS G12D or KRAS wild type are shown. The color development contrast between G12D and WT is most obvious after the reaction for 60 minutes.

[0040] Example 6, Colorimetric Determination Sensitivity The sensitivity of the assay was further evaluated under the above optimized conditions. Figure 7 The UV-vis spectra in B show the increase in absorbance intensity after adding different concentrations of KRAS G12D gene. Figure 7 The A shows that at 420 nm, as the concentration of KRASG12D gene changes from 10 nM to 100 nM, the absorbance intensity increases linearly. The linear regression equation is A=0.24586+0.00925C (R 2 =0.9884), indicating a positive correlation between absorbance (A) and KRAS G12D DNA concentration (C). Compared with the blank control, the assay was sensitive enough to detect KRAS G12D gene signals as low as 10 nM. Figure 7 As can be seen from the photo of C, the lowest concentration that can be visually distinguished by color is also 10 nM. Therefore, 10 nM is defined as the limit of detection (LOD).

[0041] Example 7, Colorimetric Assay Specificity Seven common single nucleotide mutations at codons 12 and 13 of the human KRAS gene were used together with KRAS wild type to validate system specificity.

[0042] like Figure 8 As shown in A, the underlined bases indicate mutation points; only the specific target KRAS G12D can effectively trigger the opening of the dumbbell-shaped probe, thereby achieving RCA reaction and generating significant colorimetric signals. Figure 8 As shown in B and C, in the presence of KRAS wild-type or other single nucleotide mutation analytes at 200 nM concentration, the signal generated by non-target is very weak and almost indistinguishable from the blank signal. This selective response is critical for accurate mutation detection, and the assay shows excellent discrimination and visualization properties in detecting KRAS G12D from other single nucleotide mutations.

[0043] Example 8, real sample detection and blind test In order to evaluate the potential of the detection method in practical applications, the target detection was first carried out in different concentrations of fetal bovine serum, e.g. Fig. 9 As shown; when the system contains 10% FBS, the detection method still has the ability to detect KRAS G12D.

[0044] Next, the assay was performed in real human serum samples, e.g. Fig.10 The procedure flow chart shown in A is to collect peripheral blood samples from healthy donors and G12D patients for testing. After centrifuging the blood samples, serum is added to the test system.

[0045] like Fig.10 As shown in Figure B, stronger absorbance signals were detected in G12D patient samples (numbers 5 to 8) compared with samples from healthy donors (numbers 1 to 4). The corresponding scatter plots and significance analysis are shown in Figure 2. Fig.10 C, indicating that our detection method can clearly distinguish G12D patients from healthy individuals.

[0046] To further evaluate the reliability and accuracy of the test, a blind evaluation was performed by separating the sample coding from the sample testing process. In addition, the personnel performing the test remained blinded to the coding information. Fig.11 As shown in AC, the results of the blind test are consistent with expectations. Fig.11 A in the figure is a representative color image. Fig.11 B in is the result of a single blind test. Fig.11 C in the figure is the blind test result of KRAS G12D and other single nucleotide mutations repeated three times.

[0047] In summary, the dumbbell probe is combined with rolling circle amplification (RCA) for visual detection of KRAS G12D. The specificity of the dumbbell probe, the amplification ability of the RCA reaction, and the visual detection based on G-quadruplex / heme DNA enzyme are used to detect specific targets. The main highlight is its excellent target recognition and visualization capabilities. Through experimental optimization, we significantly reduced non-target signals and maximized the specificity of target detection. This detection system has high specificity for KRAS G12D. The presence of KRAS G12D can be determined by observing the color change with the naked eye. No precision instruments are required. It is suitable for instant detection or detection scenarios with limited resources.

Claims

1. A product for KRAS gene detection based on a combination of dumbbell-shaped probe and RCA, characterized in that: The product comprises a dumbbell-shaped probe, a DNA ligase and an RCA amplification reagent. The dumbbell-shaped probe comprises a stem and two loops, the ends of the two loops are connected via the stem, one of the loops of the dumbbell-shaped probe contains a complementary sequence of a G-quadruplex aptamer PW17, and the other loop contains a complementary sequence of a G-quadruplex aptamer T30695. A cut is arranged on the stem for identifying and combining with a mutation site of a detection gene. The RCA amplification reagent comprises a Phi29 DNA polymerase, dNTPs and a Phi29 DNA polymerase reaction buffer. Under the mediation of the DNA ligase and the detection gene, the stem of the dumbbell-shaped probe is opened, the cut is connected to form a closed ring structure, and serves as a template for RCA to generate a G-quadruplex sequence. The G-quadruplex sequence combines with heme to imitate horseradish peroxidase.

2. The product for KRAS gene detection based on a dumbbell-shaped probe combined with RCA according to claim 1, characterized in that: The sequence of the dumbbell-shaped probe is CAGCTCCAACTACCCCAACCCGCCCTACCCAAAGTTGGAGCTGTATGGCGTAGGCTTAACCCACCCACCCACCCTTGCCTACGCCAT.

3. The product for KRAS gene detection based on a dumbbell-shaped probe combined with RCA according to claim 1 or 2, characterized in that: The stem is a complementary chain composed of reverse complementary paired base pairs, which are an upper chain and a lower chain respectively, and the upper chain contains the nick.

4. The product for KRAS gene detection based on a dumbbell-shaped probe combined with RCA according to claim 3, characterized in that: The last base at the 3' end of the dumbbell-shaped probe is a thymine nucleotide, which can identify the mutation site adenine of the detection gene; when the detection gene is present, the base T of the dumbbell-shaped probe is perfectly paired with the A of the mutation site; the upper chain and the lower chain of the dumbbell-shaped probe are separated, and under the action of DNA ligase, the separated ends are connected and cyclized to form a closed ring structure; when the dumbbell-shaped probe encounters the wild-type KRAS gene, there is a base mismatch, which prevents the dumbbell-shaped probe stem and the target from completely hybridizing, resulting in the inability to effectively separate the upper chain and the lower chain of the stem.

5. The product for KRAS gene detection based on a dumbbell-shaped probe combined with RCA according to claim 1 or 2, characterized in that: The RCA reaction process will produce a long tandem repeat sequence composed of an alternating G-quadruplex sequence; the long tandem repeat sequence is GGGTGGGTGGGTGGGTTAAGCCTACGCCATACAGCTCCAACTTTGGGTAGGGCGGGTTGGGGTAGTTGGAGCTGATGGCGTAGGCAAGGGTGGGTGGGTGGGTTAAGCCTACGCCATACAGCTCCAACTTTGGGTAGGGCGGGTTGGGGTAGTTGGAGCTGATGGCGTAGGCAA.

6. The product for KRAS gene detection based on a dumbbell-shaped probe combined with RCA according to claim 1 or 2, characterized in that: The PW17 complementary sequence is CCCAACCCGCCCTACCC; the T30695 complementary sequence is ACCCACCCACCCACCC.

7. The product for KRAS gene detection based on a dumbbell-shaped probe combined with RCA according to claim 1 or 2, characterized in that: The length of the stem is 7 to 13 nt.

8. The product for KRAS gene detection based on a dumbbell-shaped probe combined with RCA according to claim 1 or 2, characterized in that: The concentration of the dumbbell-shaped probe is 5-15 μM, and the concentration of dNTPs is 5-15 mM.

9. Use of the product according to any one of claims 1 to 8 in the preparation of a product for detecting KRAS gene.

Images