Primer pair and probe of haemophilus paragallinarum and kit of haemophilus paragallinarum

Abstract

The invention provides a primer pair, a probe and a kit of haemophilus paragallinarum, and belongs to the technical field of biological detection. The sequences of the primer pair are as follows: Apg-F: TATCGGTGCGGAAATGCAGAACACG, and Apg-R: GCTTGATTTACCTGTTGTGTTATTC, and the sequences of the primer pair are as follows: TATCGGTGCGGAAATGCAGAACACG, GCTTGTGTTATTC, and the sequence of the probe is Apg-P: FAM-TAACTAAATCGGGCATA-MGB, and the sequence of the probe is as follows. The primer pair and the probe can specifically amplify a haemophilus paragallinarum gene segment, as shown in SEQ ID NO. 4. The fluorescent quantitative PCR method using the primer pair and the probe has high specificity, high sensitivity and good repeatability, and can quickly and accurately identify clinical suspected haemophilus paragallinarum infection symptoms, early monitor pathogens, timely take prevention and control measures, avoid disease spread and reduce economic loss.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and in particular relates to a primer pair and a probe of Haemophilus paragallinarum and a kit thereof. Background Art

[0002] Infectious coryza is an acute upper respiratory tract infection caused by Haemophilus paragallinarum. Chickens infected with the disease will have symptoms such as swelling of the face and eyelids, runny nose and sneezing, resulting in a decrease in feed intake. When laying hens are infected with the disease, the egg production rate will drop significantly, with a drop of more than 10%. At present, this disease has become one of the major problems endangering the health and productivity of chickens.

[0003] In the detection of Haemophilus paragallinarum, the commonly used methods currently include bacterial isolation and culture and conventional PCR testing. Bacterial isolation and culture requires at least 18-24 hours, and PCR amplification is also required for confirmation. However, this method has the problem of difficulty in isolating bacteria and high separation conditions. Although conventional PCR testing can be used for the detection of this bacterium, its sensitivity is relatively low, especially when the bacterial content is low or there is a mixed infection of Escherichia coli, it is easy to miss the detection. This is because in these cases, the amount of target DNA may be lower than the detection threshold, or nonspecific amplification may interfere with the test results.

[0004] In order to solve these problems, it is necessary to establish a highly sensitive and specific fluorescent quantitative detection method based on TaqMan probe, so as to detect Haemophilus paragallinarum more accurately, reduce missed detection, and improve detection efficiency and accuracy. This will help to detect and control infectious coryza in chickens earlier and reduce its harm to the poultry industry. Summary of the invention

[0005] The purpose of the present invention is to provide a primer pair and a probe for Haemophilus paragallinarum and a kit thereof, so as to achieve efficient and accurate detection of Haemophilus paragallinarum.

[0006] First, the present invention provides a primer pair and a probe for detecting Haemophilus paragallinarum, wherein the sequence of the primer pair is:

[0007] Apg-F:TATCGGTGCGGAAAATGCAGAACACG and

[0008] Apg-R:GCTTGATTTAACCTGTTGTGTTATTC;

[0009] The probe is:

[0010] Apg-P:FAM-TAACTAAATCGGGCATA-MGB.

[0011] Preferably, the gene fragment amplified by the primer pair is as shown in SEQ ID NO.4, and the Haemophilus paragallinarum is Haemophilus paragallinarum A, B or C type.

[0012] Secondly, the present invention provides a TaqMan fluorescent quantitative PCR kit for detecting Haemophilus paragallinarum, wherein the TaqMan fluorescent quantitative PCR kit comprises the primer pair and probe according to claim 1, and the Haemophilus paragallinarum is Haemophilus paragallinarum A, B or C type.

[0013] Preferably, the TaqMan fluorescent quantitative PCR kit further comprises: 2×T5 Fast qPCR Mix (probe) and ddH 2 O.

[0014] Preferably, the reaction system per 20 μL of the TaqMan fluorescent quantitative PCR kit is:

[0015] 2×T5 Fast qPCR Mix (probe) 10 μL, Apg-F (10 μM) 0.7 μL, Apg-R (10 μM) 0.7 μL, Apg-P (10 μM) 0.6 μL, DNA template 5 μL, ddH 2 Add 0.1% HO to make up to 20 μL.

[0016] Preferably, the reaction conditions of the TaqMan fluorescent quantitative PCR kit when used are: 50°C for 5 min; 95°C for 3 min; 95°C for 15 s, 60°C for 30 s, and 40 cycles.

[0017] In addition, the present invention provides a TaqMan fluorescent quantitative PCR method for detecting the infection of Haemophilus paragallinarum in a sample to be tested, wherein the TaqMan fluorescent quantitative PCR method is used for non-disease detection purposes;

[0018] The Haemophilus paragallinarum is Haemophilus paragallinarum type A, B or C;

[0019] The TaqMan fluorescent quantitative PCR method comprises the following steps:

[0020] (1) preparing a DNA template of a sample to be tested;

[0021] (2) using the primer pair and probe described in claim 1 to perform TaqMan fluorescent quantitative PCR detection;

[0022] (3) Determine the infection status of the sample to be tested based on the test results.

[0023] Preferably, the reaction system of the TaqMan fluorescent quantitative PCR detection is: 2×T5 Fast qPCR Mix (probe) 10 μL, Apg-F (10 μM) 0.7 μL, Apg-R (10 μM) 0.7 μL, Apg-P (10 μM) 0.6 μL, DNA template 5 μL, ddH 2 Add 0.1% HO to make up to 20 μL.

[0024] Preferably, the reaction conditions of the TaqMan fluorescent quantitative PCR detection are: 50°C for 5 min; 95°C for 3 min; 95°C for 15 s, 60°C for 30 s, and 40 cycles.

[0025] The beneficial effects of the present invention are:

[0026] The fluorescent quantitative PCR reaction provided by the present invention has the characteristics of strong specificity, high sensitivity and good repeatability. Compared with the common PCR detection method, the PCR detection method provided by the present invention has a sensitivity increased by 10,000 times. Therefore, this method can make a rapid and accurate identification of clinical suspected symptoms of Haemophilus paragallinarum infection, can monitor the pathogen in the early stage of the disease and prevent missed detection, so as to take prevention and control measures in time to avoid the spread and spread of the disease and reduce economic losses.

[0027] In addition, this detection method is extremely efficient and fast. The entire process from receiving the diseased material to issuing the test results can be completed within 3 hours, which is a speed and efficiency that ordinary PCR testing cannot achieve. This fluorescent quantitative PCR reaction not only greatly shortens the diagnosis time, but also improves the reliability of the test, providing an effective tool for the aquaculture industry to help quickly respond to outbreaks of infectious rhinitis. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is the specific detection result of TaqMan fluorescent quantitative PCR;

[0029] Figure 2 The standard curve of TaqMan fluorescence quantitative PCR;

[0030] Figure 3 This is the sensitivity test result of TaqMan fluorescent quantitative PCR;

[0031] exist Figure 3 From left to right, it is 1.0×10 7 to 1.0×10 -2 copies / μL;

[0032] Figure 4 It is the sensitivity test result of common PCR;

[0033] exist Figure 4From left to right, it is 1.0×10 7 to 1.0×10 -2 copies / μL;

[0034] Figure 5 This is the test result of clinical samples by common PCR;

[0035] exist Figure 5 In the figure, from left to right are samples 1-20. DETAILED DESCRIPTION

[0036] Now, various exemplary embodiments of the present invention are described in detail, and this detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present invention. It should be understood that the terms described in the present invention are only for describing specific embodiments and are not used to limit the present invention.

[0037] Example 1

[0038] Design and synthesis of primers and probes for Haemophilus paragallinarum

[0039] According to the accession numbers KU143734.1, KU143736.1, KU143739.1, KU143741.1 and KU143744.1 of the reference sequences of Haemophilus paragallinarum, the hmtp210 gene sequences of three serotypes A, B and C of Haemophilus paragallinarum were downloaded from NCBI / GenBank and homology analysis was performed. The highly conserved gene regions were selected to design primers and probes. The specific designed primer and probe sequences are as follows:

[0040] Primer and probe sequences (5'-3'):

[0041] Apg-F:TATCGGTGCGGAAAATGCAGAACACG, SEQ ID NO.1;

[0042] Apg-R: GCTTGATTTACCTGTTGTGTTATTC, SEQ ID NO.2;

[0043] Apg-P: FAM-TAACTAAATCGGGCATA-MGB, SEQ ID NO.3;

[0044] The fragment amplified by the primers is:

[0045] TATCGGTGCGGAAAATGCAGAACACGTTGAAGTAACTAAATCGGGC ATAGCCTTAAAAGCGAATAACACAACAGGTAAATCAAGC, SEQ ID NO. 4.

[0046] Example 2

[0047] Optimization of fluorescence quantitative reaction conditions

[0048] The primer and probe concentrations were diluted to 10 μM, and the matrix method was used to determine the optimal primer dosage (0.3, 0.5, 0.7, 0.9 μL), probe dosage (0.2, 0.4, 0.6, 0.8 μL), annealing temperature (52, 54, 56, 58, 60°C), two-step method and three-step method, and reaction time (30 s, 45 s).

[0049] Finally, the reaction system determined by the present invention is as follows:

[0050] 2×T5 Fast qPCR Mix (probe) 10 μL, Apg-F (10 μM) 0.7 μL, Apg-R (10 μM) 0.7 μL, Apg-P (10 μM) 0.6 μL, template 5 μL, ddH 2 O to make up to 20 μL;

[0051] The reaction procedure is as follows:

[0052] 50℃ for 5 min; 95℃ for 3 min; 95℃ for 15 s, 60℃ for 30 s, 40 cycles.

[0053] Example 3

[0054] Specificity test

[0055] The reaction system and reaction procedure determined in Example 2 were used to amplify Haemophilus paragallinarum A, B, C, infectious bronchitis virus, infectious laryngotracheitis virus, Escherichia coli, Staphylococcus, Streptococcus, avian endocarditis bacillus, and H9 avian influenza virus. The results are as follows: Figure 1 As shown;

[0056] The results showed that Apg-A, B, and C had S-shaped amplification curves, indicating positive amplification, while other pathogens and negative controls were negative amplifications, indicating that the method had good specificity.

[0057] Example 4

[0058] Establishing a standard curve for real-time fluorescence quantitative PCR

[0059] (1) Construction of recombinant plasmid of Haemophilus paragallinarum: Nucleic acid of Haemophilus paragallinarum was extracted according to the operating instructions of the extraction kit, and the extracted nucleic acid was used as a template and amplified using an amplification kit. After the amplification, it was observed under a gel imaging system. When the PCR product was positive, it was purified and recovered, and then connected to the pMD18-T vector and transformed into DH5α competent cells. After PCR identification of positive clones, the plasmid was extracted for sequencing identification, and the plasmid concentration was measured to calculate the copy number.

[0060] (2) The positive plasmid was diluted 10-fold and 1.0×10 6 to 1.0×10 1 Copies / μL were used for fluorescence quantitative PCR amplification and a standard curve was established. The results were as follows Figure 2 As shown. Wherein, the standard curve equation is: Y = -3.24x + 34.234 (Y is the Ct value, x is the logarithmic value of the template DNA copy number), R 2 =0.9986, E=104%, the detection efficiency is relatively high.

[0061] Example 5

[0062] The positive plasmid was diluted 10 times in series, and 1.0×10 7 to 1.0×10 -2 Copies / μL, according to the primers and probes provided in Example 1 and the reaction conditions and system determined in Example 2, fluorescence quantitative PCR amplification was performed, and the sensitivity analysis of the method was performed. The results obtained are as follows Figure 3 shown.

[0063] At the same time, the same primers were used and the conventional PCR reaction system was used: 2x Tap mix 12.5 μL, APG-F 1 μL, APG-R 1 μL, template 5 μL, ddH 2 O was added to 25 μL; reaction conditions: 95°C, 3 min; 95°C, 30 s, 60°C, 30 s, 72°C, 30 s, 35 cycles; 72°C, 10 min, stored at 4°C, and conventional PCR amplification was performed. The results were as follows. Figure 4 shown.

[0064] from Figure 3 It can be seen that the fluorescence quantitative PCR method provided by the present invention can detect a minimum of 0.2 copies / μL; Figure 4 It can be seen that the use of ordinary PCR method can only detect 10 3 It can be seen that the fluorescence quantitative PCR method provided by the present invention has a sensitivity 10,000 times higher than that of the common PCR method, and is 100 times higher than the conventional method in the art, and has an unexpected technical effect.

[0065] Example 6

[0066] Repeatability experiment

[0067] In the present invention, a standard plasmid of 10 6 -10 4 copies / μL was used as a template, and three replicates were made in the same batch to verify the within-group coefficient of variation, and three batches were made to verify the between-group coefficient of variation. The results are shown in Tables 1 and 2.

[0068] Table 1 Repeatability of within-group differences

[0069]

[0070] Table 2 Repeatability of between-group differences

[0071]

[0072] The results show that the within-group and between-group coefficients of variation are within 0.5%, indicating that the established fluorescence quantitative PCR detection method has good repeatability.

[0073] Example 7

[0074] Clinical sample detection

[0075] (1) Nucleic acids were extracted from 20 clinical samples as templates, and the established fluorescence quantitative PCR method of the present invention was used to detect the clinical samples. At the same time, the clinical samples were detected by the ordinary PCR method. The results are shown in Table 3 and Figure 5 as shown.

[0076] The judgment criteria for fluorescence quantitative PCR are as follows:

[0077] When the CT value < 33 and there is a typical amplification curve, it is positive; when 33 < CT value < 36 and there is a typical amplification curve, it is weakly positive; when CT > 36 and it is still greater than 36 after retesting, it is initially judged as negative; when there is no CT value, it is negative.

[0078] Table 3 Detection results of the fluorescence quantitative PCR method established by the present invention for clinical samples

[0079] Serial number CT value Serial number CT value Serial number CT value 1 / 9 / 17 15.33 2 / 10 33.15 18 / 3 29.75 11 26.62 19 / 4 23.21 12 34.6 20 / 5 / 13 / 6 19.41 14 / 7 / 15 / 8 34.12 16 15.31

[0080] From Table 3 and Figure 5 it can be seen that the positive rate of fluorescence quantitative detection is 9 / 20, and the positive rate of ordinary PCR detection is 6 / 20. Samples with fluorescence quantitative CT > 33 cannot be detected by conventional PCR.

Claims

1. A primer pair and a probe for detecting Haemophilus paragallinarum, characterized in that: The sequences of the primer pairs are: Apg-F:TATCGGTGCGGAAAATGCAGAACACG and Apg-R:GCTTGATTTAACCTGTTGTGTTATTC; The probe is: Apg-P:FAM-TAACTAAATCGGGCATA-MGB.

2. A primer pair and probe for detecting Haemophilus paragallinarum according to claim 1, characterized in that: The gene fragment amplified by the primer pair is shown in SEQ ID NO.4; the Haemophilus paragallinarum is Haemophilus paragallinarum A, B or C type.

3. A TaqMan fluorescent quantitative PCR kit for detecting Haemophilus paragallinarum, characterized in that: The TaqMan fluorescent quantitative PCR kit comprises the primer pair and probe according to claim 1, and the Haemophilus paragallinarum is Haemophilus paragallinarum type A, B or C.

4. The TaqMan fluorescent quantitative PCR kit for detecting Haemophilus paragallinarum according to claim 3, characterized in that: The TaqMan fluorescent quantitative PCR kit also includes: 2×T5 Fast qPCR Mix (probe) and ddH2O.

5. The TaqMan fluorescent quantitative PCR kit for detecting Haemophilus paragallinarum according to claim 4, characterized in that: The reaction system of each 20 μL of the TaqMan fluorescent quantitative PCR kit is: 2×T5 Fast qPCR Mix (probe) 10μL, Apg-F (10μM) 0.7μL, Apg-R (10μM) 0.7μL, Apg-P (10μM) 0.6μL, DNA template 5μL, ddH2O is added to 20μL.

6. The TaqMan fluorescent quantitative PCR kit for detecting Haemophilus paragallinarum according to claim 5, characterized in that: The reaction conditions of the TaqMan fluorescent quantitative PCR kit when used are: 50°C for 5 min; 95°C for 3 min; 95°C for 15 s, 60°C for 30 s, and 40 cycles.

7. A TaqMan fluorescent quantitative PCR method for detecting infection of Haemophilus paragallinarum in a sample to be tested, characterized in that: The TaqMan fluorescent quantitative PCR method is used for non-disease detection purposes; The Haemophilus paragallinarum is Haemophilus paragallinarum type A, B or C; The TaqMan fluorescent quantitative PCR method comprises the following steps: (1) preparing a DNA template of a sample to be tested; (2) using the primer pair and probe described in claim 1 to perform TaqMan fluorescent quantitative PCR detection; (3) Determine the infection status of the sample to be tested based on the test results.

8. The TaqMan fluorescent quantitative PCR method for detecting the infection of Haemophilus paragallinarum in a sample to be tested according to claim 7, characterized in that: The reaction system of the TaqMan fluorescent quantitative PCR detection is: 2×T5 FastqPCR Mix (probe) 10 μL, Apg-F (10 μM) 0.7 μL, Apg-R (10 μM) 0.7 μL, Apg-P (10 μM) 0.6 μL, DNA template 5 μL, ddH2O supplemented to 20 μL.

9. The TaqMan fluorescent quantitative PCR method for detecting infection of Haemophilus paragallinarum in a sample to be tested according to claim 8, characterized in that: The reaction conditions of the TaqMan fluorescent quantitative PCR detection are: 50°C for 5 min; 95°C for 3 min; 95°C for 15 s, 60°C for 30 s, and 40 cycles.

Images