Field detection kit for fusarium graminearum and application of field detection kit

Abstract

The invention relates to a field detection kit for fusarium graminearum and application, a crude extract of a sample obtained by physical crushing can be directly used for RAA isothermal amplification, amplification targets respectively correspond to specific sequences of fusarium verticillioides and fusarium graminearum, and an RAA amplification product is used as a DNA target for a CRISPR / Cas12a detection system. Aiming at a conserved region of a calmodulin gene of fusarium verticillioides, the length of an amplified target sequence is 120bp, and a specific RAA primer and a crRNA (Complementary Ribonucleic Acid) are respectively Fv-F / Fv-R and Fv-crRNA. The advantage of setting two different result reading strategies in the same onsite pathogen detection reaction is that reliability and flexibility are enhanced, so that more accurate and timely decisions can be made under different onsite conditions.

Description

Technical Field

[0001] The invention belongs to the technical field of agriculture, and in particular to a field detection kit for cereal Fusarium and application thereof. Background Art

[0002] A survey of rot and wilt diseases on wheat, corn and rice showed that Fusarium diseases accounted for 70%-95%, and most of them existed in the form of pathogenic complexes. Among them, the toxin-producing species Fusarium verticillioides and F. graminearum are the dominant pathogens. These fungi can cause rot and wilt of crops, resulting in economic losses and food shortages. The harmful mycotoxins they produce, fumonisins, deoxynivalenol (also known as vomitoxin), zearalenone and nivolumab toxin, pose a major threat to livestock and human health. Given their widespread presence and harmful effects, rapid field screening of these Fusarium is essential for effective management and mitigation of their hazards, ensuring food safety and agricultural productivity.

[0003] Since different species of Fusarium are morphologically similar and easily affected by the environment, traditional morphological identification methods are difficult to accurately identify. However, identification methods based on molecular biology techniques such as polymerase chain reaction (PCR) and real-time fluorescence quantitative PCR can accurately identify species because they can amplify specific sequences. Although PCR-based techniques have high sensitivity and specificity, they still face challenges in on-site detection because they require precise temperature control equipment and skilled operation. To address this limitation, isothermal amplification techniques such as loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) have been developed to simplify the detection process and shorten the time, gradually replacing PCR. Compared with LAMP, RPA has faster amplification speed, lower operating temperature and simpler operation settings, making it more suitable for on-site rapid nucleic acid identification. Recently, an improved version of RPA, recombinase-assisted amplification (RAA), has been developed. Similar to the RPA system, RAA relies on recombinase, single-stranded binding protein and DNA polymerase. RAA detection can exponentially amplify target DNA under incubation at 37℃-42℃ within 30 minutes, with an amplification efficiency 10-100 times higher than PCR, while retaining all the technical advantages of RPA and being more cost-effective. RAA's specific primers are simple in design and do not require complex sample preparation, making it suitable for on-site testing. However, due to the complexity of the crop sampling environment, samples often contain similar biological backgrounds and interfering substances, which may affect the accuracy of the test results.

[0004] Visual nucleic acid detection methods based on clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein (Cas) systems have attracted widespread attention due to their rapid, portable, low-cost and highly sensitive detection capabilities, especially in resource-limited environments. Among CRISPR effectors, Cas12a stands out for its ability to bind and cut target double-stranded DNA (dsDNA) under the guidance of single guide RNA (crRNA), and for its nonspecific single-stranded DNA (ssDNA) cutting activity after binding to the target. Taking advantage of this feature, ssDNA reporter probes labeled with fluorescent groups, black hole quenchers or biotin can be used to determine the presence of target DNA through fluorescent signals or colloidal gold test strips.

[0005] RAA amplification combined with CRISPR / Cas12a technology has the advantages of in situ, precision, rapidity, and visualization, and has been widely used in medical point-of-care testing, but there are few studies in agriculture, and there are few reports on the use of RAA combined with CRISPR / Cas12a to detect Fusarium. The construction and application of this technology can improve the accuracy and credibility of field detection results for Fusarium pseudoverticillium and Fusarium graminearum.

[0006] At present, the PCR-based molecular identification technology of Fusarium graminearum and Fusarium graminearum in the prior art uses DNA polymerase and specific PCR primer pairs to specifically amplify the strain genomic gDNA in a reaction buffer containing nucleotides. The amplification reaction includes denaturation (heating the reaction system to 94°C-98°C to unwind the DNA double strands and produce two single-stranded templates), annealing (lowering the temperature to 50°C-65°C so that the primers can complement the target DNA sequence to form a primer-template complex), and extension (increasing the temperature to the optimal working temperature of DNA polymerase at 92°C, and the DNA polymerase synthesizes a new DNA chain along the primer-template complex). Repeat the above three steps (denaturation, annealing, and extension) 20-40 times to exponentially amplify the target DNA sequence, and finally keep it at the extension temperature for a period of time to ensure that all unfinished DNA chains in the last round of PCR are fully extended. Through these steps, PCR can amplify a sufficient number of target DNA fragments from a very small genomic gDNA sample, providing sufficient nucleic acid materials for further detection or sequencing. However, it has the following defects: (1) It has high requirements for the sample size and purity of genomic gDNA; (2) It relies on expensive temperature control instruments and cannot be tested in the field, resulting in high testing costs; (3) The extraction and purification of genomic gDNA requires 0.5h-1.0h, the PCR reaction requires 1.5h-2.0h, and the gel electrophoresis imaging of the results requires 0.5h-1.0h, a total of 2.5h-4.0h. The experimental steps are cumbersome and the cycle is long.

[0007] Patent document CN202310860222 discloses RPA-CRISPR / Cas12a detection technology based on the fumonisin gene sequence of pseudo-verticillium fusarium, which utilizes the nucleic acid replication mechanism of T4 phage, and under the joint action of multiple enzymes and proteins, can complete the amplification of the target gene within 30 minutes with the assistance of a simple heat source (37°C-43°C). The DNA enzyme activity of CRISPRCas12a targeted recognition and cutting of the target gene (double-stranded DNA) completes the high-specific recognition of the target gene at the single base level. After targeted cutting of double-stranded DNA, Cas12a is stimulated to obtain the activity of cutting non-target single-stranded DNA. It has the following defects: (1) The detection of the fumonisin gene sequence of pseudo-verticillium fusarium cannot identify strains that do not produce fumonisin. In addition, pseudo-verticillium fusarium may also have the ability to secrete fungal toxins such as deoxynivalenol, zearalenone and fumonisin, which are potentially harmful to human and animal health. Therefore, the detection of fumonisin gene sequences alone still poses a food safety risk. (2) This technology is based on nucleic acid extraction from nucleic acid extracts, which increases costs; (3) The RPA isothermal amplification technology used in this technology was developed by the British company TwistDx. The use of imported reagents increases the cost of testing. The RAA isothermal amplification technology we used is an upgraded version of RPA developed by a Chinese team. It retains all the technical advantages of RPA and is more cost-effective; (4) This technology is limited to endpoint detection based on test strips, which lacks flexibility. That is, when encountering samples with a large amount of infection, it is still necessary to wait for the entire experiment to be completed, and when encountering samples with a small amount of infection, it is impossible to increase the sensitivity of the test by extending the reaction time.

[0008] In addition, CN202311209620, CN116926235B, and CN202311209639 disclose methods for detecting Fusarium pseudoverticulatum or Fusarium graminearum based on the RPA-CRISPR / Cas system; utilizing the nucleic acid replication mechanism of T4 phage, under the joint action of multiple enzymes and proteins, the amplification of the target gene can be completed within 10min-30min with the assistance of a simple heat source (37°C-42°C). The DNA enzyme activity of CRISPR Cas12a targeted recognition and cutting of the target gene (double-stranded DNA) completes the high specific recognition of the single base level of the target gene. After targeted cutting of double-stranded DNA, Cas12a is stimulated to obtain the activity of cutting non-target single-stranded DNA. It has the following defects: (1) This technology is based on the nucleic acid extraction technology of the centrifugal column method or nucleic acid extraction liquid, which increases the cost; (2) The RPA isothermal amplification technology selected by this technology is developed by the British TwistDx company. The use of imported reagents increases the detection cost, while the RAA isothermal amplification technology selected by the present invention is an upgraded version of RPA developed by China Qitian Gene, which retains all the technical advantages of RPA and is more cost-effective; (3) This technology requires the selection of specific reporter molecules to complete fluorescence detection or test strip detection. Specifically, the reporter molecules labeled with FAM and Biotin are used for test strip detection, and the reporter molecules labeled with FAM and quenching groups are used for fluorescence detection. The visualization means of the detection results are not flexible, while the technology developed by the present invention is to realize the visualization of dual results of the same reaction system through three labeled reporter groups, thereby increasing the flexibility of detection. Without increasing the number of reactions and costs, the results are presented by two technical means, which can achieve the effect of secondary verification of the detection results. Summary of the invention

[0009] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a field detection kit for Fusarium graminearum based on RAA-CRISPR / Cas12a and its application. The present invention combines RAA and CRISPR / Cas12a systems to detect quickly, efficiently, sensitively and accurately. Compared with conventional detection methods for Fusarium pseudoverticillium and Fusarium graminearum, the kit of the present invention has the technical advantages of short time, easy operation and can complete detection in the field.

[0010] The technical solution adopted by the present invention to solve its technical problem is:

[0011] A field detection kit for Fusarium spp. in cereals, comprising

[0012] Specific RAA primer pair 1:

[0013] Fg-F:GGCTTGCGTTGCTCATGGATGATCTGGATA

[0014] Fg-R: AAGATGGCTAAACAGCACGAATGCCCGACTTG

[0015] crRNA 1:

[0016] Fg-crRNA: GGGAAUUUCUACUGUUGUAGAUAAGGGCUGGCGCUUCUCG

[0017] Specific RAA primer pair 2:

[0018] Fv-F: CTTTCCTGGTTCGTAGTATCCCAAGACGATTATAG

[0019] Fv-R:GATCTCCTCCTCAGAGTCGGTATCCTTCAT

[0020] crRNA II:

[0021] Fv-crRNA: GGGAAUUUCUACUGUUGUAGAUCCUAAUGGUUAGUACUCG.

[0022] Furthermore, primers for constructing crRNA DNA are also included.

[0023] crRNA-F: TAATACGACTCACTATAGGGAATTTCTACTGTTGTAGAT

[0024] Fg-cr-R: CGAGAAGCGCCAGCCCTTATCTACAACAGTAGAAATTFv-cr-R: CGAGTACTAACCATTAGGATCTACAACAGTAGAAATT.

[0025] Furthermore, a ssDNA reporter molecule: 5'-FAM-TTATT-BHQ1-TTATT-Biotin-3' triple-labeled probe is also included.

[0026] Moreover, the reaction system includes the RAA reaction system and the CRISPR / Cas12a reaction system;

[0027] The RAA reaction system is: recombinase, 2× reaction buffer, RAA primer pair 1 or RAA primer pair 1, 280 mM magnesium acetate;

[0028] The CRISPR / Cas12a reaction system is: 1×NEBuffer 2.1 buffer, 50nM FnCas12a, 500nM crRNA 1 or crRNA 2, 200nM triple-labeled probe 5'-FAM-TTATT-BHQ1-TTATT-Biotin-3', 1U / μL RNase inhibitor.

[0029] A method for detecting Fusarium spp. in cereals in the field, comprising the following steps:

[0030] ⑴ Obtaining the template for RAA detection: Take the sample and place it in a centrifuge tube with zirconium oxide beads, add sterile water without nuclease to wet the sample and zirconium oxide beads, and use an oscillator to shake for 10 minutes or grind with a pestle to obtain a cell lysate as a template for RAA detection;

[0031] (2) RAA reaction

[0032] Dissolve the recombinase, then add 2× reaction buffer, 10μM upstream primer and 10μM downstream primer. Once the enzyme is completely dissolved, add the RAA detection template and 280mM magnesium acetate. After the reaction mixture is fully mixed, the amplification technology can complete the exponential amplification of the target gene within 10min-30min at 35℃-43℃ to obtain the RAA amplification product.

[0033] (3) CRISPR / Cas12a reaction

[0034] The Cas12a reaction solution contains 1×NEBuffer 2.1 buffer, 50nM FnCas12a, 500nM sequence 1 crRNA or 500nM sequence 2 crRNA, 200nM triple-labeled ssDNA reporter probe and 1U / μL RNase inhibitor.

[0035] (4) Real-time fluorescence naked eye observation: add 2 μL RAA amplification product, incubate at 39°C for 5-60 minutes, and observe the fluorescence results in real time with naked eyes under 470nm LED light;

[0036] ⑸Test strip detection: Add 2 μL RAA amplification product and incubate at 39°C for 30-60 min. After the reaction is completed, mix the two parallel reactions to obtain 60 μL CRISPR / Cas12a system detection solution in a centrifuge tube, insert the Cas12 / 13 special nucleic acid detection test strip and incubate at room temperature for 3 min.

[0037] Specific RAA primer pair

[0038] Fg-F:GGCTTGCGTTGCTCATGGATGATCTGGATA

[0039] Fg-R: AAGATGGCTAAACAGCACGAATGCCCGACTTG

[0040] crRNA sequence

[0041] Fg-crRNA: GGGAAUUUCUACUGUUGUAGAUAAGGGCUGGCGCUUCUCG

[0042] Specific RAA primer pair

[0043] Fv-F: CTTTCCTGGTTCGTAGTATCCCAAGACGATTATAG

[0044] Fv-R:GATCTCCTCCTCAGAGTCGGTATCCTTCAT

[0045] crRNA sequence II

[0046] Fv-crRNA: GGGAAUUUCUACUGUUGUAGAUCCUAAUGGUUAGUACUCG.

[0047] Primers for constructing crRNA DNA

[0048] The DNA template amplification primers of the crRNA sequence 2 and crRNA sequence 1 are:

[0049] crRNA-F: TAATACGACTCACTATAGGGAATTTCTACTGTTGTAGAT

[0050] Fg-cr-R: CGAGAAGCGCCAGCCCTTATCTACAACAGTAGAAATT

[0051] Fv-cr-R: CGAGTACTAACCATTAGGATCTACAACAGTAGAAATT.

[0052] The advantages and positive effects achieved by the present invention are:

[0053] 1. The method for crude nucleic acid extraction of the sample in the present invention is low-cost (no chemical reagents are required, Figure 1 ), reusable, easy to store and transport, can achieve cell lysis of field samples, and obtain crude nucleic acid extract suitable for RAA amplification within 10 minutes ( Figure 2 );

[0054] 2. The RAA isothermal amplification technology in the present invention is an upgraded version of RPA developed by a Chinese team. It retains all the technical advantages of RPA and is more cost-effective ( Figure 5 and Figure 7 ); Get rid of the dependence on imported test kits. Under the conditions optimized by this patent, the detection limit is as low as 10 -1 aM level.

[0055] 3. In the present invention, the RAA amplification product is used as a DNA template for the CRISPR / Cas12a detection system. The Cas12a-crRNA complex recognizes the protospacer adjacent motif (PAM) in the amplicon and specifically binds to the target strand of crRNA. RAA specific amplification and specific recognition of the CRISPR / Cas12a system provide double protection for the specificity of the system.

[0056] 4. The sensitivity of the kit of the present invention can reach aM level, which meets the requirements of on-site rapid detection. At the same time, the detection method is simple to operate, does not require precision instruments, has a short cycle, high efficiency, and has high specificity and accuracy.

[0057] 5. The kit of the present invention provides an efficient and accurate detection strategy for two common toxin-producing pathogens of cereal crops, Fusarium graminearum and Fusarium graminearum, which significantly improves the pertinence and effectiveness of prevention and control measures.

[0058] 6. The application scenario of the kit of the present invention is the field, and the target users are agricultural practitioners. In a non-experimental environment, the irregular operation of untrained professional testers may cause false positives or false negatives in field tests. The dual detection mechanism of fluorescence and test strips of the present invention improves the reliability of field test results. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 The following are photos of the consumables for bead milling lysis method using zirconium oxide beads and a grinding pestle; A is a picture of zirconium oxide beads with different diameters. B is a schematic diagram of the consumables for bead milling lysis method using zirconium oxide beads and a grinding pestle.

[0060] Figure 2 A is a feasibility analysis diagram of the bead mill lysis method. A is a comparison of different lysis methods: negative control, that is, the centrifugal column treatment results of wheat leaves not inoculated with Fusarium; alkaline lysis method, that is, using Kangwei Century The results of the commercial kit Cat.CW3011 on wheat leaves inoculated with Fusarium spores; the bead milling lysis method optimized by the present invention; the centrifugal column method, i.e., using Tiangen The results of the commercial kit Cat.DP350 on wheat leaves inoculated with Fusarium spores. B is a comparison between the optimized bead mill lysis method of the present invention and the centrifugal column method at different lysis time treatments.

[0061] Figure 3Gene targets for RAA-CRISPR / Cas12a detection of Fusarium graminearum. The green color shows its RAA-specific amplification primers, and the yellow color shows the targeting sequence of Cas12a.

[0062] Figure 4 The gene target of RAA-CRISPR / Cas12a detection of Fusarium spp. The green color shows its RAA-specific amplification primer, and the yellow color shows the targeting sequence of Cas12a.

[0063] Figure 5 Optimization of RAA reaction conditions. (A) Under 39°C incubation, the longer the reaction time, the darker the amplification band, which means more products and higher efficiency. (B) Under 35°C-43°C incubation, the higher the temperature, the darker the amplification band, which means more products and higher efficiency. At the same time, it is further confirmed that at the same temperature, the longer the reaction time, the darker the target band, which means an increase in the amount of product.

[0064] Figure 6 Specificity of RAA amplification. (A) Specificity of RAA primers Fv-F / Fv-R for F. pseudoverticillium; (B) Specificity of RAA primers Fg-F / Fg-R for F. graminearum. Lane 1: F. pseudoverticillium; Lane 2: F. graminearum; Lane 3: F. oxysporum; Lane 4: Rhizoctonia solani; Lane 5: Botrytis cinerea; Lane 6: Alternaria solani; Lane 7: negative control.

[0065] Figure 7 is the sensitivity of RAA amplification of the present invention.

[0066] Figure 8 Optimize the dosage of key components in the CRISPR / Cas12a system detection reaction.

[0067] Fig. 9 The sensitivity of CRISPR test strip detection technology.

[0068] Fig.10 Visualize the interference of chlorophyll on the discrimination of fluorescence signals in CRISPR fluorescence assays.

[0069] Fig.11 Real-time visual results of CRISPR fluorescence detection.

[0070] Fig.12 The sensitivity of CRISPR fluorescence detection.

[0071] Fig.13 The sensitivity of PCR method for detecting Fusarium.

[0072] Fig.14 This method was applied to the field experiments to detect Fusarium graminearum and Fusarium graminearum. DETAILED DESCRIPTION

[0073] The present invention is further described below in conjunction with the examples, which are descriptive and not restrictive, and the protection scope of the present invention cannot be limited by the following examples. The various experimental operations involved in the specific embodiments are all conventional techniques in the art. For the parts not specially annotated herein, ordinary technicians in the art can refer to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the application date of the present invention to implement them.

[0074] The kit of the present invention aims at the characteristics of Fusarium disease of field cereal crops, which has no obvious early symptoms and is usually characterized by complex infection of multiple pathogens. It proposes a rapid naked-eye visual qualitative detection kit and application in the field within 2 hours for two common toxigenic Fusarium pathogenic strains (Fusarium graminearum and Fusarium pseudo-verticillium) on cereal crops, providing a reliable method for early diagnosis and disease monitoring of common Fusarium pathogens Fusarium graminearum and Fusarium pseudo-verticillium of field cereal crops.

[0075] In order to achieve on-site detection, the ssDNA reporter gene in the Cas12a detection reaction is labeled with a fluorescent group FAM, a quenching group BHQ1 and biotin Biotin (5'-FAM-TTATT-BHQ1-TTATT-Biotin-3'). After Cas12a recognizes and cuts the target, the nonspecific cutting activity triggered by it causes the fluorescent group FAM to emit a fluorescent signal, which can be observed in real time by the naked eye under blue light irradiation, i.e., the RAA-Cas12a-Fluo detection method. In addition, the fluorescent group FAM and the biotin group Biotin released in the reaction can be detected by colloidal gold chromatography immunoassay strips (lateral flow strip, LFS), i.e., the RAA-Cas12a-LFS detection method. The advantage of setting two different result reading strategies in the same on-site pathogen detection reaction is that it enhances flexibility and reliability, allowing more accurate and timely decision-making under different field conditions.

[0076] The crude extract of the sample obtained by physical crushing of the present invention can be directly used for RAA isothermal amplification. The amplification targets correspond to the specific sequences of the calmodulin gene of F. verticillioides and the protein gene unique to F. graminearum. The RAA amplification product is used as a DNA template for the CRISPR / Cas12a detection system. The Cas12a-crRNA complex recognizes the PAM site in the amplicon and specifically binds to the target chain of crRNA, thereby enhancing the specificity of the detection and being able to identify single-base mismatches. In order to achieve on-site detection, the ssDNA reporter probe in the Cas12a detection reaction is labeled with a fluorescent group FAM, a quenching group BHQ1, and biotin Btiotin (5'-FAM-TTATT-BHQ1-TTATT-Biotin-3').

[0077] The kit and application of the RAA-CRISPR / Cas12a-based field detection of pathogenic Fusarium spp. in cereal crops provided by the present invention are described in the following basic parts, specifically as follows:

[0078] 1. Crude extraction of sample nucleic acid:

[0079] The bead beating method using zirconium oxide beads and pestles is a simple physical cell lysis method that does not require organic reagents. Both zirconium oxide beads and pestles are commercially available and can be reused by cleaning and moist heat sterilization.

[0080] Specific operation: Take an appropriate amount of plant or soil samples and add 500 μL of nuclease-free sterile water. For fungal culture fluid or liquid samples such as rainwater and irrigation water, directly take 500 μL; add 450 mg of wet heat sterilized zirconium oxide beads, oscillate with an oscillator for 10 minutes or grind with a pestle to obtain cell lysate, and then take 5 μL as a template for RAA detection.

[0081] Spray the wheat leaves with 10 4 conidia / mL (spores per milliliter) of fresh Fusarium spore solution, cut the inoculated leaves with sterile scissors, add 500 μL of nuclease-free sterile water and about 450 mg of zirconium oxide beads, and grind them thoroughly with the help of a pestle ( Figure 2 A) or use an oscillator to shake for 2min-10min ( Figure 2 In B), 5 μL of cell lysate was taken for RAA amplification of the target gene to achieve sufficient disruption. At the end of the reaction, 50 μL of a mixture of phenol: chloroform: isoamyl alcohol (25:24:1) was added, followed by centrifugation at 12,000 rpm for 5 min to remove the enzyme components in the reaction, and the purified supernatant was analyzed by electrophoresis on a 2% agarose gel.

[0082] The results are as follows Figure 2 The present invention provides a bead grinding lysis method suitable for crude extraction of plant samples including pathogen genomes. This method is inexpensive (no chemical reagents are required), reusable, easy to store and transport, and can achieve cell lysis of field samples to obtain a crude nucleic acid extract suitable for RAA amplification within 10 minutes.

[0083] Under a sterile environment, weigh 450±50 mg of heat-sterilized zirconium oxide beads (about 20 zirconium oxide beads with a diameter of 2 mm) and place them in a sterile, enzyme-free 2 mL centrifuge tube for later use. At the same time, heat-sterilize the grinding rod for later use.

[0084] Bead grinding lysis method to obtain the template for RAA detection: When sampling in the field, take an appropriate amount of plant or soil sample (about 100 mg) and put it into the above-mentioned centrifuge tube containing zirconium oxide beads, add 500 μL of nuclease-free sterile water to soak the sample and zirconium oxide beads, use an oscillator to oscillate for 10 minutes or use a pestle to grind thoroughly to obtain cell lysate, and then take 5 μL as the template for RAA detection.

[0085] For liquid samples, such as fungal culture fluid or rainwater, irrigation water, etc., use a pipette to directly aspirate 500 μL into the above-mentioned centrifuge tube containing zirconium oxide beads, oscillate on an oscillator for 10 minutes or grind with a pestle to obtain cell lysate, and then take 5 μL as a template for RAA detection. Unless otherwise specified, this method is used to obtain the template for RAA detection.

[0086] Comparison of methods for obtaining genomic DNA templates that meet the requirements of RAA amplification: Spraying 10 4 conidia / mL (spores per milliliter) of fresh Fusarium spore solution, cut the inoculated leaves with sterile scissors and put them into a centrifuge tube containing about 450 mg of zirconium oxide beads (20 zirconium oxide beads with a diameter of 2 mm), and then add 500 μL of nuclease-free sterile water. Grind and crush thoroughly with the help of a grinding pestle ( Figure 2 A) or use an oscillator to shake for 2min-10min ( Figure 2 In B), 5 μL of cell lysate was taken for RAA amplification to achieve sufficient disruption. At the end of the reaction, 50 μL of a mixture of phenol: chloroform: isoamyl alcohol (25:24:1, volume ratio) was added, followed by centrifugation at 12,000 rpm for 5 min to remove the enzyme components in the reaction, and the purified supernatant was analyzed by electrophoresis on 2% agarose gel.

[0087] pass Figure 2It can be concluded that the bead beating lysis method used in the present invention can achieve the same effect as the alkaline lysis kit and the centrifugal column kit with higher requirements for reagents and consumables, and successfully obtain genomic DNA that meets the requirements of RAA amplification.

[0088] 2. RAA amplification: Prepare the RAA reaction system and amplify the nucleic acid target exponentially through RAA technology.

[0089] RAA amplification utilizes crowd-testing The basic RAA kit, RAA primer design and reaction system follow the guidelines provided by its manufacturer, specifically: one tube of lyophilized recombinant enzyme was dissolved in 13.5 μL of distilled water, and then 25 μL of 2× reaction buffer, 2 μL of 10 μM upstream primer and 2 μL of 10 μM downstream primer were added. After the lyophilized recombinant enzyme was completely dissolved, 5 μL of sample lysate (obtained by the first step of bead beating lysis) and 2.5 μL of 280 mM magnesium acetate (this component is used to start the reaction) were added. After the reaction mixture was fully mixed, it was immediately incubated at 39°C for 30 min.

[0090] The RAA amplification product sequence contains a protospacer adjacent motif (PAM) 5'-TTTN-3' that can be recognized and bound by Cas12a. Cas12a recognizes the PAM region under the guidance of crRNA and complements its downstream bases to achieve the purpose of accurately identifying the target DNA and cutting its target.

[0091] 2.1 SEQ ID NO.1 for the conserved region in the cereal pathogen Fusarium graminearum.

[0092] According to the target sequence, a series of primer pairs that meet the RAA primer design principles were designed and synthesized by General Biotechnology (Anhui) Co., Ltd. After a series of preliminary tests and screening, the primer screening results are as follows:

[0093] Fg-F: 5'-GGCTTGCGTTGCTCATGGATGATCTGGATA-3';

[0094] Fg-R: 5'-AAGAATGGCTAAACAGCACGAATGCCCGACTTG-3';

[0095] The amplified fragment size is 186 bp, and the amplified sequence is SEQ ID NO.2:

[0096] The gene sequence used to identify Fusarium graminearum is a protein sequence unique to its strain (GenBank: HG970332). The amplified target sequence length is 186 bp. The specific RAA primers and crRNA used are Fg-F / Fg-R and Fg-crRNA, respectively. The sequences are as follows:

[0097]

[0098] 2.2 SEQ ID NO.3 for the conserved region in Fusarium spp. in cereals.

[0099] According to the target sequence, a series of primer pairs that meet the RAA primer design principles were designed and synthesized by General Biotechnology (Anhui) Co., Ltd. After a series of preliminary tests and screening, the primer screening results are as follows:

[0100] Fv-F: 5'-CTTTCCTGGTTCGTAGTATCCCAAGACGATTATAG-3';

[0101] Fv-R: 5'-GATCTCCTCCTCAGAGTCGGTATCCTTCAT-3';

[0102] The size of the amplified fragment is 120 bp, and the amplified sequence is SEQ ID NO.4.

[0103] The gene sequence used to identify Fusarium verticillioides is its calmodulin gene (GenBank: MT010888), and the amplified target sequence length is 120 bp. The specific RAA primers and crRNA used are Fv-F / Fv-R and Fv-crRNA, respectively, and the sequences are as follows:

[0104]

[0105] 2.3 Optimization of RAA reaction conditions

[0106] The purified Fusarium gDNA was quantified by spectrophotometer and then diluted with library dilution buffer (full gold Beijing, China) was diluted to 30 pg / μL (10 3 aM) and stored at -20°C until use. RAA kit was used to perform RAA amplification on 30 pg / μL Fusarium gDNA.

[0107] Specifically, a tube of lyophilized recombinant enzyme was dissolved in 17.5 μL of distilled water, and then 25 μL of 2× reaction buffer, 2 μL of 10 μM F primer, and 2 μL of 10 μM R primer were added. Once the enzyme was completely dissolved, 1 μL of 30 pg / μL Fusarium gDNA and 2.5 μL of 280 mM magnesium acetate were added. After the reaction mixture was fully mixed, it was immediately incubated at 39°C for 10 min-30 min. At the end of the reaction, 50 μL of phenol: chloroform: isoamyl alcohol (25:24:1) mixture was added, followed by centrifugation at 12000 rpm for 5 min to remove the enzyme components in the reaction, and the purified supernatant was analyzed by electrophoresis on a 2% agarose gel.

[0108] Figure 5 Conclusion: (A) Under incubation at 39°C, the longer the reaction time, the darker the amplification band, which means more products and higher efficiency. (B) Under incubation at 35°C-43°C, the higher the temperature, the darker the amplification band, which means more products and higher efficiency. At the same time, it was further confirmed that at the same temperature, the target band deepened with prolonged reaction time, indicating an increase in the amount of product. The RAA amplification technology used in the present invention can complete the exponential amplification of the target gene within 10min-30min at 35°C-43°C. Based on this feature, in the early stage of infection (when the amount of Fusarium is small), more amplification products can be obtained by increasing the RAA incubation temperature and reaction time.

[0109] 2.4 Specificity and sensitivity of RAA amplification for detection of Fusarium

[0110] Reaction conditions: Dissolve one tube of lyophilized recombinant enzyme in 13.5 μL of distilled water, then add 25 μL of 2× reaction buffer, 2 μL of 10 μM F primer, and 2 μL of 10 μM R primer. Once the enzyme is completely dissolved, add 5 μL of sample lysate (obtained from the first bead beating lysis method) and 2.5 μL of 280 mM magnesium acetate. After the reaction mixture is thoroughly mixed, incubate at 39°C for 30 minutes. The negative control is sterile ddH2O.

[0111] At the end of the reaction, 50 μL of a mixture of phenol: chloroform: isoamyl alcohol (25:24:1) was added, followed by centrifugation at 12,000 rpm for 5 min to remove the enzyme components in the reaction, and the purified supernatant was analyzed by electrophoresis on a 2% agarose gel.

[0112] Figure 6 Conclusion: The Fusarium-specific RAA primers Fv-F / Fv-R and the Fusarium-specific RAA primers Fg-F / Fg-R can exponentially amplify their corresponding Fusarium identification gene targets (target bands are visible at 120 bp and 186 bp, respectively), and the non-target strains tested have no bands of corresponding lengths.

[0113] The RAA primers designed and constructed in the present invention have high specificity for target amplification of Fusarium pseudoverticilli and Fusarium graminearum. The purified Fusarium gDNA was quantified by spectrophotometer and then diluted with library dilution buffer (full gold Beijing, China) was diluted step by step, and the detection concentration range was: 3000pg / μL (10 5 aM)、300pg / μL(10 4 aM)、30pg / μL(10 3 aM)、3pg / μL(10 2 aM)、0.3pg / μL(10 1 aM)、0.03pg / μL(10 0 aM)、0.003pg / μL(10 - 1 aM) and 0.0003pg / μL (10 -2 aM).

[0114] Reaction conditions: Dissolve one tube of lyophilized recombinant enzyme in 17.5 μL of distilled water, then add 25 μL of 2× reaction buffer, 2 μL of 10 μM front primer, and 2 μL of 10 μM back primer. Once the enzyme is completely dissolved, add 1 μL of gDNA diluent and 2.5 μL of 280 mM magnesium acetate. After the reaction mixture is thoroughly mixed, incubate at 39°C for 30 minutes. At the end of the reaction, add 50 μL of phenol: chloroform: isoamyl alcohol (25:24:1) mixture, then centrifuge at 12,000 rpm for 5 minutes to remove the enzyme components in the reaction, and analyze the purified supernatant by electrophoresis on 2% agarose gel.

[0115] Figure 7 Conclusion: It can be -1 The target band was seen at aM, proving that our optimized RAA amplification system and conditions have high sensitivity. The target nucleic acid molecules at the aM level can be detected, which meets the sensitivity requirements of the World Health Organization for point-of-care molecular testing (POCT) technology.

[0116] 3. CRISPR / Cas12a system detection:

[0117] 3.1 The Cas12a enzyme includes but is not limited to one or more of AsCas12a protein, BbCas12a protein, BoCas12a protein, FnCas12a protein, LbaCas12a protein, HkCas12a protein, OsCas12a protein and mutants thereof.

[0118] The preferred FnCas12a protein of the present invention can be purchased or purified by prokaryotic expression.

[0119] 3.2 The reaction buffer includes but is not limited to NEBufferTM2.1, NEBuffer purchased from New England Biolabs (NEB) TM 3.1, NEBuffer TM CutSmart or Cas commercial reaction buffer. The buffer in the reaction system is conducive to maintaining the high activity of the Cas12 enzyme and improving the trans-cleavage activity of the Cas12 enzyme after it is activated during the reaction. The preferred NEBuffer of the present invention TM 2.1.

[0120] 3.3 The crRNA is obtained by whole gene synthesis or in vitro transcription

[0121] In vitro transcription specific method: use HiFi DNA polymerase (TransGen, Beijing, China) annealed the ssDNA oligonucleotide corresponding to the reverse complement of the target DNA sequence (see the table below) to the backbone containing the T7 promoter for sequence extension. The PCR product was verified by 2% agarose gel electrophoresis and then used Oligo Clean & Concentrator TM Kit (Zymo Research, California, USA) was used for purification. The purified PCR product was used as a DNA template and purified using TranscriptAid TM T7 high-yield transcription kit (Thermo Scientific, Massachusetts, USA) was used to perform in vitro transcription according to the manufacturer's protocol to obtain the corresponding crRNA. Subsequently, Oligo Clean & Concentrator TM crRNA was purified and concentrated using a Zymo Research kit (Zymo Research, California, USA), quantified using a Nanodrop spectrophotometer, and stored at -80°C.

[0122] Oligonucleotides for crRNA construction

[0123]

[0124] Reaction components for synthesizing crRNA DNA template:

[0125]

[0126] Reaction procedure for synthesizing DNA template for crRNA:

[0127]

[0128] In vitro transcription reaction components based on crRNA-based DNA templates:

[0129]

[0130]

[0131] The in vitro transcription reaction procedure of the crRNA-based DNA template was as follows: After incubation at 37°C for 2 h, 2 μL DNase I (1 U / μL) was added and incubated at 37°C for 20 min. Subsequently, the corresponding crRNA was obtained by purification and recovery using oligo clean&concentrator (Zymo Research, California, USA). The specific sequence is shown in the table below and stored at -80°C.

[0132] Table crRNA sequence

[0133]

[0134] 3.4 The fluorescent single-stranded DNA (ssDNA) reporter probe is labeled with a fluorescent group carboxyfluorescein (FAM), a quencher group black hole quencher (BHQ) including one or more of black hole quencher 1 (BHQ-1), black hole quencher 2 (BHQ-2) or black hole quencher 3 (BHQ-3), and biotin, i.e., 5'-FAM-NNNNN-BHQ1-NNNNN-Biotin-3' (the combined base N represents A, T, C or G).

[0135] In addition, the same effect can be achieved by mixing FAM and BHQ dual-labeled ssDNA probe (FAM-NNNNN-BHQ1) and FAM and Biotin dual-labeled ssDNA probe (FAM-NNNNN-Biotin). The corresponding reactions are:

[0136]

[0137] The triple labeled probe 5'-FAM-TTATT-BHQ1-TTATT-Biotin-3' was used in the experiment.

[0138] 3.5 Reaction system: 2 μL of unpurified fresh RAA product was added to the Cas12a detection reaction for further analysis. The 30 μL Cas12a reaction solution contained 1×NEBuffer 2.1 buffer (New England Biolabs, Beijing, China), 50 nM FnCas12a, 500 nM crRNA, 200 nM triple-labeled ssDNA reporter probe and 1 U / μL RNase inhibitor (Thermo Scientific, Beijing, China).

[0139] Add 2 μL of fresh RAA product (without purification) to the Cas12a detection reaction, mix well, incubate at 39°C, and observe the fluorescence results with the naked eye by irradiation with a 470nm LED light. Unless otherwise stated, the subsequent reaction system is based on the description of the above-mentioned "RAA-Cas12a-Fluo detection".

[0140] Mix the reaction solutions of two RAA-Cas12a-Fluo detection parallel reactions in one centrifuge tube to obtain 60 μL of sample reaction solution. Cas12 / 13-specific nucleic acid detection test strips (Tiosbio, Beijing, China) were inserted and incubated at room temperature for 3-5 minutes. If two lines appeared on the test strip, it was a positive result, while a single control line was a negative result. This method is called "RAA-Cas12a-FLS detection".

[0141] 3.6 CRISPR test strip detection technology / RAA-Cas12a-FLS reaction system optimization

[0142] Cas12a concentration optimization ( Figure 8 ): 30 μL Cas12a reaction solution contains 1×NEBuffer 2.1 buffer, 25nM, 50nM, 100nM, 150nM or 200nM FnCas12a, 500nM crRNA, 200nM triple-labeled ssDNA reporter probe (5'-FAM-TTATT-BHQ1-TTATT-Biotin-3') and 1U / μL RNase inhibitor (Thermo Scientific, Beijing, China). Add 2 μL of fresh RAA amplification product and incubate at 39°C for 30 minutes. Mix two parallel reactions to obtain 60 μL of CRISPR / Cas12a system detection solution in a centrifuge tube and insert the Cas12 / 13 special nucleic acid detection test strip ( Cas12 / 13-specific nucleic acid detection test strips (Tiosbio, Beijing, China) were incubated at room temperature for 3 min.

[0143] Results: Cas12a protein above 50nM inhibited CRISPR test strip detection, and the reaction concentration range was 25nM-50nM. 50nM Cas12a protein was preferred in subsequent experiments.

[0144] crRNA concentration optimization ( Figure 8): 30 μL Cas12a reaction solution contains 1×NEBuffer 2.1 buffer, 50nM FnCas12a, 125nM, 250nM, 500nM, 750nM or 1000nM crRNA, 200nM triple-labeled ssDNA reporter (5'-FAM-TTATT-BHQ1-TTATT-Biotin-3') and 1U / μL RNase inhibitor (Thermo Scientific, Beijing, China). Add 2 μL of fresh RAA amplification product and incubate at 39°C for 30 minutes. Mix two parallel reactions to obtain 60 μL of CRISPR / Cas12a system detection solution in a centrifuge tube and insert the Cas12 / 13 special nucleic acid detection test strip ( Cas12 / 13-specific nucleic acid detection test strips (Tiosbio, Beijing, China) were incubated at room temperature for 3 min-5 min.

[0145] Results: As the crRNA concentration increases, the color of the detection line becomes darker, which means the reaction efficiency is higher. The reaction concentration range is 125nM-1000nM. 500nM crRNA is preferred in subsequent experiments.

[0146] Optimization of triple-labeled ssDNA reporter probe concentration ( Figure 8 ): 30 μL Cas12a reaction solution contains 1×NEBuffer2.1 buffer, 50nM FnCas12a, 500nM crRNA, 50nM, 100nM, 150nM, 200nM or 250nM triple-labeled ssDNA reporter molecules and 1U / μl RNase inhibitor (Thermo Scientific, Beijing, China). Add 2 μL of fresh RAA amplification product and incubate at 39°C for 30 minutes. Mix two parallel reactions to obtain 60 μL of CRISPR / Cas12a system detection solution in a centrifuge tube and insert the Cas12 / 13 special nucleic acid detection test strip ( Cas12 / 13-specific nucleic acid detection test strips (Tiosbio, Beijing, China) were incubated at room temperature for 3 min-5 min.

[0147] Results: As the concentration of ssDNA reporter probe increases, the color of the detection line becomes darker, which means the reaction efficiency is higher. The reaction concentration range is 50nM-250nM. 200nM ssDNA reporter probe is preferred in subsequent experiments.

[0148] 3.7 Specificity of CRISPR test strip detection technology

[0149] The RAA-specific amplification product is used as the DNA template of the CRISPR / Cas12a detection system. The Cas12a-crRNA complex recognizes the PAM site within the amplicon ( Figure 3 and Figure 4 ), and specifically binds the target strand to crRNA. Therefore, CRISPR / Cas12a detection further enhances the specificity of the detection experiment based on RAA specific amplification. Based on literature reports, its specificity can even reach the recognition of single base mismatches.

[0150] 3.8 Sensitivity of CRISPR test strip detection technology

[0151] Purified Fusarium gDNA was quantified by spectrophotometer and then diluted with library dilution buffer (full gold Beijing, China) were diluted to 3000 pg / μL (10 5 aM)、300pg / μL(10 4 aM)、30pg / μL(10 3 aM)、3pg / μL(10 2 aM) and 0.3pg / μL (10 1 aM).

[0152] Reaction system: (1) RAA reaction: Dissolve one tube of freeze-dried recombinant enzyme in 17.5 μL of distilled water, then add 25 μL of 2× reaction buffer, 2 μL of 10 μM F primer and 2 μL of 10 μM R primer. Once the enzyme is completely dissolved, add 1 μL of the above-mentioned Fusarium gDNA dilution and 2.5 μL of 280 mM magnesium acetate. After the reaction mixture is thoroughly mixed, incubate it at 39°C for 30 min. (2) CRISPR detection: 30 μL Cas12a reaction solution contains 1× NEBuffer 2.1 buffer, 50 nM FnCas12a, 500 nM crRNA, 200 nM triple-labeled ssDNA reporter probe (5'-FAM-TTATT-BHQ1-TTATT-Biotin-3') and 1 U / μL RNase inhibitor (Thermo Scientific, Beijing, China). Add 2 μL of unpurified fresh RAA product and incubate at 39°C for 30 min. Mix two parallel reactions to obtain 60 μL of CRISPR / Cas12a system detection solution in a centrifuge tube and insert the Cas12 / 13 special nucleic acid detection test strip ( Cas12 / 13-specific nucleic acid detection test strips, Tiosbio, Beijing, China) at room temperature for 3 min-5 min.

[0153] Result determination: If the control line and the test line appear at the same time, it indicates that the test sample contains the target bacterial DNA amplification product; if only the control line appears, it indicates that the test sample does not contain the target bacterial DNA amplification product or the target bacterial DNA concentration is too low.

[0154] Fig. 9 Conclusion: The detection of Fv target of Fusarium graminearum and Fg target of Fusarium graminearum can be achieved within 10 2 The target band was seen at aM, indicating that the detection sensitivity for Fusarium graminearum and Fusarium graminearum was 10 2 aM, that is, 120 copies per 60μL reaction system. This proves that the system and conditions of our optimized CRISPR test strip detection technology have high sensitivity.

[0155] 3.9 Establishment of CRISPR fluorescence detection technology / RAA-Cas12a-Fluo reaction system

[0156] Although CRISPR test strip detection technology has advantages such as easy portability and storage, as an endpoint detection method, it means that the process of displaying and judging the results is also the termination of the reaction.

[0157] The longer the CRISPR / Cas12a detection time, the lower its detection limit will be, which is beneficial for the detection of low-concentration targets (see Fig.11 and Fig.12 ). However, in actual testing, in order to save time, people often hope to complete the test as quickly as possible. This creates a contradiction.

[0158] Our detection uses a triple-labeled probe or a strategy of mixing two double-labeled probes, which can present two visual results of the same experiment. On the basis of saving detection costs and time costs, it completes the double verification of the same experimental results.

[0159] It is recommended that during the CRISPR reaction, the fluorescence brightness should be observed in real time by irradiating with a 470nm blue LED light to determine the reaction results. When significant fluorescence appears, the reaction should be paused immediately, and the experimental results should be reconfirmed and judged using a test strip.

[0160] The advantage of using the test strips for re-identification is that, on the one hand, it can solve the subjective misjudgment of fluorescence brightness by operators without testing experience, and on the other hand, it can avoid the interference of other molecules in the sample that fluoresce under blue-violet light on the determination of experimental results, such as chlorophyll ( Fig.10 ).

[0161] The crude nucleic acid extraction method of the present invention is used to crush wheat leaves inoculated with Fusarium to obtain a crude nucleic acid extract. The target gene is further amplified using the RAA amplification technology described in the present invention. CRISPR fluorescence detection is performed using the RAA amplification product as a target. (-) represents a negative control, i.e., wheat leaves without Fusarium, (+) represents the addition of 2μL RAA amplification product for CRISPR fluorescence detection, and (++) represents the addition of 4μL RAA amplification product for CRISPR fluorescence detection, and compared with the detection results of the purified Fusarium gDNA extract.

[0162] Reaction system: (1) RAA reaction: Dissolve one tube of freeze-dried recombinant enzyme in 13.5 μL of distilled water, then add 25 μL of 2x reaction buffer, 2 μL of 10 μM upstream primer and 2 μL of 10 μM downstream primer. Once the enzyme is completely dissolved, add 5 μL of sample lysate (obtained from the first step of bead beating lysis) and 2.5 μL of 280 mM magnesium acetate. After the reaction mixture is fully mixed, incubate at 39°C for 30 minutes. (2) CRISPR detection: 30 μL Cas12a reaction solution contains 1×NEBuffer2.1 buffer, 50 nM FnCas12a, 500 nM crRNA, 200 nM triple-labeled ssDNA reporter probe and 1 U / μL RNase inhibitor (Thermo Scientific, Beijing, China). Add an appropriate amount of RAA amplification product and incubate at 39°C for 30 minutes. Irradiate with 470 nm LED light and observe fluorescence with the naked eye.

[0163] Principle supplement: In the presence of target nucleic acid, the screened crRNA can accurately identify the target and activate the nonspecific cleavage activity of the Cas12a enzyme. This activity causes the FAM and BHQ1 reporters to be cut, thereby generating a fluorescent signal. However, in the absence of target nucleic acid, the system does not generate fluorescence. The crRNA screened by the present invention can specifically identify the RAA amplification product of its corresponding target. Bright fluorescence can be generated by cutting the reporter molecule.

[0164] Fig.10 Conclusion: Chlorophyll in crude leaf extracts emits red fluorescence under blue light, which affects the determination of the results. Therefore, double verification is required during field testing.

[0165] 3.9.1 Is the detection system optimized by CRISPR test strip detection technology suitable for CRISPR fluorescence detection?

[0166] according to Fig.11Determine the reaction system: 30 μL Cas12a reaction solution contains 1×NEBuffer 2.1 buffer, 50 nM FnCas12a, 500 nM crRNA, 200 nM triple-labeled ssDNA reporter probe and 1 U / μL RNase inhibitor (ThermoScientific, Beijing, China). Add 2 μL of RAA amplification product of Fusarium gDNA (30 pg / μL) and incubate at 39°C for 30 min. Irradiate with 470 nm LED light and observe fluorescence with naked eyes. The negative control is the product of RAA amplification using ddH2O as the test sample.

[0167] Fig.11 Conclusion: Fluorescence can be observed with the naked eye for both bacteria 5 minutes after the reaction begins.

[0168] 3.9.2 Sensitivity of CRISPR fluorescence detection

[0169] Purified Fusarium gDNA was quantified by spectrophotometer and then diluted with library dilution buffer (full gold Beijing, China) were diluted in 10-fold gradients to: 3000 pg / μL (10 5 aM)、300pg / μL(10 4 aM)、30pg / μL(10 3 aM)、3pg / μL(10 2 aM)、0.3pg / μL(10 1 aM) and 0.03pg / μL (10 0 aM).

[0170] Reaction system: (1) RAA reaction: Dissolve one tube of freeze-dried recombinant enzyme in 17.5 μL of distilled water, then add 25 μL of 2x reaction buffer, 2 μL of 10 μM upstream primer and 2 μL of 10 μM downstream primer. Once the enzyme is completely dissolved, add 1 μL of the above-mentioned Fusarium oxysporum gDNA and 2.5 μL of 280 mM magnesium acetate. After the reaction mixture is thoroughly mixed, incubate it immediately at 39°C for 30 minutes. (2) CRISPR detection: 30 μL Cas12a reaction solution contains 1×NEBuffer 2.1 buffer, 50nM FnCas12a, 500nM crRNA, 200nM triple-labeled ssDNA reporter probe and 1U / μL RNase inhibitor (ThermoScientific, Beijing, China). Add 2 μL of unpurified fresh RAA product, and use CFX 96 real-time PCR detection system (BioRad, California, USA) to monitor the fluorescence intensity in real time at 39°C, with a fluorescence intensity detection interval of 1 min. At the same time, use 470nm LED blue light to observe the reaction fluorescence intensity. NC: negative control, sterile ddH2O instead of gDNA diluent.

[0171] Fig.12 Conclusion: CRISPR fluorescence detection technology can reach a sensitivity of 1aM level in 1 hour at 39°C. 4. Compared with the traditional PCR method:

[0172] Reference primers and literature:

[0173]

[0174] PCR reaction system:

[0175]

[0176] PCR reaction procedure:

[0177]

[0178] Fig.13 Conclusion: The traditional PCR method for the detection of Fusarium requires precise temperature control equipment and an amplification time of more than 1 hour. It also has high requirements for the purity and concentration of Fusarium gDNA, which means greater nucleic acid extraction costs and time (half an hour to one hour).

[0179] In a laboratory environment that meets the above conditions, the sensitivity of PCR for detection of Fusarium is 30pg / μL (10 3aM), which is 1000 times that of the CRISPR fluorescence detection technology / RAA-Cas12a-Fluo of the present invention, and 100 times that of the CRISPR test strip detection technology / RAA-Cas12a-LFS.

[0180] In summary, the detection method for Fusarium oxysporum of the present invention has higher sensitivity, shorter time, simpler operation and lower cost.

[0181] 5. Field experiment:

[0182] The strain was cultured on potato dextrose agar (PDA) at 28°C for 5-7 days until the hyphae were fully grown and covered the medium. The fungal hyphae plugs obtained from the PDA medium were cultured in sodium carboxymethylcellulose (CMC) medium at 28°C for 2-4 days. Before inoculation, the fresh spore suspension of Fusarium was washed and diluted with 0.85% NaCl solution. The spore suspension and its dilution were quantified using a hemocytometer, and the quantitative results of the bacterial suspension were further verified by plate colony counting method.

[0183] 10 5 Up to 10 1 500 μL of each spore dilution with a conidia / mL concentration was taken and centrifuged at 12,000 rpm for 5 minutes. All the supernatant was aspirated with a pipette to leave the spores on the tube wall. Subsequently, 500 μL of rainwater, 100 mg of soil or 100 mg of wheat leaves were added to each tube and diluted to 500 μL with nuclease-free water. Rainwater, soil or wheat leaf samples without Fusarium spores were used as negative controls.

[0184] The crude extract was extracted using the bead mill lysis method optimized by the present invention, and 5 μL of the crude extract was subjected to target-specific amplification for 30 min using the RAA reaction conditions optimized by the present invention. 2 μL of the RAA amplification product was taken and subjected to the test strip detection after reacting for 1 hour using the CRISPR test strip detection method optimized by the present invention, and the test results were immediately photographed.

[0185] Fig.14 Conclusion: By simulating in situ field detection, we used the technology of the present invention to detect spiked samples in a non-laboratory environment, and the negative control (NC) was a sample without fungal spores. The experiment showed that the detection limit of this technology for the Fv target of Pseudomonas verticillioides and the Fg target of Fusarium graminearum in rainwater samples was 10 2 conidia / mL; the detection limit for the target of Fusarium spp. Fv and Fusarium graminearum Fg in soil samples was 10 3 conidia / mL; the detection limits of the target Fv of Fusarium spp. and the target Fg of Fusarium graminearum in wheat plant samples were 10 2conidia / mL and 10 3 conidia / mL.

[0186] Explanation: The detection sensitivity of rainwater samples is higher than that of plant samples and soil samples. This is because the complex substances contained in soil and plant samples have a significant impact on the efficiency of nucleic acid amplification. Here, the purpose of improving the detection sensitivity can be achieved by purifying the sample nucleic acid. However, the purification process will also increase the cost of detection (for example, magnetic bead purification method) and detection time.

[0187] If Fusarium graminearum or Fusarium graminearum is detected in rainwater, drainage should be carried out as soon as possible to avoid siltation of rainwater, and fungicides targeting Fusarium should be applied as soon as weather permits to prevent the occurrence of the disease, such as foliar spraying of prothioconazole and fluopicolide, especially during the peak infection period of the pathogen during the growing season.

[0188] If Fusarium graminearum or Fusarium graminearum is detected in the soil, soil disinfection can be carried out, using hot water or chemical agents to reduce the survival of pathogens. Crop rotation can break the life cycle of pathogens and reduce the accumulation of pathogens in the soil. Increasing soil organic matter and improving soil microbial diversity can enhance soil health.

[0189] If Fusarium graminearum or Fusarium verticillium is detected in the plant, the infected plant should be isolated immediately to prevent the spread of the disease, and disease-resistant varieties should be selected for planting to enhance resistance. The toxin-producing ability of Fusarium should be further confirmed in the laboratory. Potential mycotoxins that may be present in the plant seeds should be tested and detoxified, such as:

[0190] Deoxynivalenol and fumonisin, the main toxins produced by Fusarium oxytocin, can be detoxified and attenuated through high-temperature treatment, chemical degradation, microbial degradation, enzymatic degradation, adsorbent treatment and other means. For example, high-temperature heating can be used to destroy the chemical structure of toxins, ultraviolet light can be used to degrade toxins on the surface of grain, and ozone, hydrogen peroxide and other oxidants can be used to reduce the toxin content.

[0191] Deoxynivalenol and zearalenone, the main products of Fusarium graminearum, can be degraded by physical separation of contaminated grains, treatment with high temperature or moist heat, and chemical degradation methods such as application of ozone or activated carbon.

[0192] Field rapid detection technology plays a vital role in the prevention and control of Fusarium disease in cereals. By quickly and accurately detecting Fusarium spp. and Fusarium graminearum, this technology provides farmers and agricultural managers with timely information to guide them to take scientific preventive measures, such as adjusting field management strategies and optimizing crop harvesting and storage conditions. Effective early detection can not only reduce the accumulation of toxins in crops, but also reduce potential threats to food safety, ensure food quality, and reduce economic losses caused by toxin pollution. The research and development of this technology is of great significance to ensuring agricultural production safety and improving food safety levels. Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A field detection kit for Fusarium spp. in cereals, characterized in that: include Specific RAA primer pair 1: Fg-F:GGCTTGCGTTGCTCATGGATGATCTGGATA Fg-R: AAGATGGCTAAACAGCACGAATGCCCGACTTG crRNA 1: Fg-crRNA: GGGAAUUUCUACUGUUGUAGAUAAGGGCUGGCGCUUCUCG Specific RAA primer pair 2: Fv-F: CTTTCCTGGTTCGTAGTATCCCAAGACGATTATAG Fv-R:GATCTCCTCCTCAGAGTCGGTATCCTTCAT crRNA II: Fv-crRNA: GGGAAUUUCUACUGUUGUAGAUCCUAAUGGUUAGUACUCG.

2. The field detection kit for Fusarium spp. in cereals according to claim 1, characterized in that: Also included are primers for constructing crRNA DNA crRNA-F: TAATACGACTCACTATAGGGAATTTCTACTGTTGTAGAT Fg-cr-R: CGAGAAGCGCCAGCCCTTATCTACAACAGTAGAAATT Fv-cr-R: CGAGTACTAACCATTAGGATCTACAACAGTAGAAATT.

3. The field detection kit for Fusarium spp. in cereals according to claim 1 or 2, characterized in that: Also included is a ssDNA reporter: 5'-FAM-TTATT-BHQ1-TTATT-Biotin-3' triple labeled probe.

4. The field detection kit for Fusarium spp. in cereals according to claim 3, characterized in that: The reaction system includes RAA reaction system and CRISPR / Cas12a reaction system; The RAA reaction system is: recombinase, 2× reaction buffer, RAA primer pair 1 or RAA primer pair 2, 280 mM magnesium acetate; The CRISPR / Cas12a reaction system is: 1×NEBuffer 2.1 buffer, 50nM FnCas12a, 500nM crRNA 1 or crRNA 2, 200nM triple-labeled probe 5'-FAM-TTATT-BHQ1-TTATT-Biotin-3', 1U / μL RNase inhibitor.

5. A method for detecting Fusarium spp. in cereals in the field, characterized in that: The steps are as follows ⑴ Obtaining the template for RAA detection: Take the sample and place it in a centrifuge tube with zirconium oxide beads, add sterile water without nuclease to wet the sample and zirconium oxide beads, and use an oscillator to shake for 10 minutes or grind with a pestle to obtain a cell lysate as a template for RAA detection; ⑵RAA reaction Add 2× reaction buffer, 10μM upstream primer and 10μM downstream primer to the recombinant enzyme powder. Once the enzyme is completely dissolved, add the RAA detection template and 280mM magnesium acetate. After the reaction mixture is fully mixed, the amplification technology can complete the exponential amplification of the target gene within 10min-30min at 35℃-43℃ to obtain the RAA amplification product. (3) CRISPR / Cas12a reaction The Cas12a reaction solution contains 1×NEBuffer 2.1 buffer, 50nM FnCas12a, 500nM sequence 1 crRNA or 500nM sequence 2 crRNA, 200nM triple-labeled ssDNA reporter probe and 1U / μL RNase inhibitor. (4) Real-time fluorescence naked eye observation: add 2 μL RAA amplification product, incubate at 39°C for 5-60 minutes, and observe the fluorescence results in real time with naked eyes under 470nm LED light; ⑸Test strip detection: Add 2 μL RAA amplification product and incubate at 39°C for 30-60 min. After the reaction is completed, mix the two parallel reactions to obtain 60 μL CRISPR / Cas12a system detection solution in a centrifuge tube, insert the Cas12 / 13 special nucleic acid detection test strip and incubate at room temperature for 3 min. Specific RAA primer pair Fg-F:GGCTTGCGTTGCTCATGGATGATCTGGATA Fg-R: AAGATGGCTAAACAGCACGAATGCCCGACTTG crRNA sequence Fg-crRNA: GGGAAUUUCUACUGUUGUAGAUAAGGGCUGGCGCUUCUCG Specific RAA primer pair Fv-F: CTTTCCTGGTTCGTAGTATCCCAAGACGATTATAG Fv-R:GATCTCCTCCTCAGAGTCGGTATCCTTCAT crRNA sequence II Fv-crRNA: GGGAAUUUCUACUGUUGUAGAUCCUAAUGGUUAGUACUCG.

6. A method for detecting Fusarium spp. in cereals in the field according to claim 5, characterized in that: The crRNA sequence 2 and crRNA sequence 1 amplification primers are: crRNA-F: TAATACGACTCACTATAGGGAATTTCTACTGTTGTAGAT Fg-cr-R: CGAGAAGCGCCAGCCCTTATCTACAACAGTAGAAATT Fv-cr-R: CGAGTACTAACCATTAGGATCTACAACAGTAGAAATT.

Images