Molecular marker for identifying non-photosensitive eggplant and application thereof

Abstract

The invention discloses a molecular marker for identifying a non-photosensitive eggplant and application of the molecular marker, the molecular marker is located at the position from-1959bp to-1234bp of an eggplant SmMYB113 promoter, and the nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 1. The invention finds that the RU repetitive sequence in the promoter SmMYB113 enables the SmMYB113 not to depend on light expression in the non-photosensitive eggplant, so that the accumulation of anthocyanin can be enhanced even in the absence of light, and the RU repetitive sequence can be used as a molecular marker for identifying the non-photosensitive eggplant. By using the molecular marker provided by the invention, the accuracy of verifying 264 eggplant natural populations is 95.8%. The key gene for regulating and controlling the non-photosensitive eggplant is accurately positioned, the molecular marker corresponding to the key gene is developed, technical support can be provided for eggplant molecular marker-assisted selective breeding, and the molecular marker has important application value in production.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and more specifically, relates to a molecular marker for identifying non-photosensitive eggplant and an application thereof. Background Art

[0002] As an important vegetable crop, eggplant has always been an indispensable vegetable product on people's tables. It is deeply loved by the general public because of its diverse fruit types, rich nutritional content and diverse eating methods. At the same time, eggplant is also a vegetable crop with important economic value worldwide, and is listed as one of the three major vegetables of the Solanaceae family along with tomatoes and peppers.

[0003] Eggplant cultivation is widely distributed in my country. Shandong, Henan, Hebei, Liaoning, Jiangsu, Sichuan and other provinces are all major eggplant producing areas. The Central Plains region is dominated by purple-black round eggplants, purple-red round eggplants and Henan's green-skinned oval eggplants. Northeast China's purple-black long eggplants, East China's purple-red long eggplants, Central China's purple-black long eggplants, and South China's purple-red long eggplants are different in terms of consumption demand for eggplant color. Eggplant peel colors vary, and can be roughly divided into white eggplants, green eggplants, and purple eggplants. Studies have shown that the main pigments that determine the color of eggplant fruit are chlorophyll and anthocyanins, and the final color is affected by a variety of environmental factors such as light. Purple eggplants can be divided into three categories: purple-red eggplants, photosensitive purple-black eggplants, and non-photosensitive purple-black eggplants. The phenotype of non-photosensitive purple-black eggplants is different from that of ordinary photosensitive purple-black eggplants in that during the growth and development process, its fruit coloring does not rely on light, which can greatly increase the uniformity of coloring, especially under weak light conditions, and improve product quality.

[0004] As an important breeding goal and research direction, eggplant peel color diversity has been reported on the formation mechanism of eggplant peel color with the development of molecular biology. For example, YOU et al. showed that SmMYB113 can participate in regulating the biosynthesis of anthocyanins in photosensitive eggplants, but the existing research results cannot explain why non-photosensitive eggplants can still synthesize anthocyanins under dark conditions. Shi et al. also reported that SmMYB75 can also regulate the synthesis of anthocyanins in eggplant peel. However, there are few reports on the research of non-photosensitive (NPS) eggplants. Only He et al. used photosensitive eggplant "LSHX" and non-photosensitive eggplant "145" as parents to construct F2 populations as materials, and precisely located the gene that controls the fruit color of non-photosensitive eggplants: SmFTSH10, explaining that the gene has a difference between photosensitive and non-photosensitive due to the absence of "C" bases in the sequence.

[0005] At present, the differentiation of non-photosensitive eggplants is limited to observing the anthocyanin synthesis under the sepals of the fruit, which is time-consuming and labor-intensive, and there is no efficient molecular marker as an identification method. Therefore, locating the key genes that regulate non-photosensitive eggplants and developing corresponding molecular markers can provide technical support for molecular marker-assisted selection breeding of eggplants, which has important application value in production. Summary of the invention

[0006] Based on this, the object of the present invention is to provide a molecular marker that can identify non-photosensitive eggplant, and a method for identifying non-photosensitive eggplant.

[0007] The technical solutions for achieving the above-mentioned invention objectives include the following.

[0008] In a first aspect of the present invention, a molecular marker tightly linked to the non-photosensitive trait of eggplant is provided. The molecular marker is located at -1959 bp to -1234 bp of the eggplant SmMYB113 promoter, and its nucleotide sequence is shown in SEQ ID NO:1.

[0009] In a second aspect of the present invention, primers for amplifying the above-mentioned molecular markers are provided, including a forward primer with a sequence as shown in SEQ ID NO:2 and a reverse primer as shown in SEQ ID NO:3, a forward primer with a sequence as shown in SEQ ID NO:4 and a reverse primer as shown in SEQ ID NO:5, and a forward primer with a sequence as shown in SEQ ID NO:6 and a reverse primer as shown in SEQ ID NO:7.

[0010] The third aspect of the present invention provides a kit for detecting non-photosensitive eggplant varieties, comprising the above primers.

[0011] A fourth aspect of the present invention provides the use of the above-mentioned molecular markers, primers or kits in identifying or screening non-photosensitive eggplant varieties.

[0012] A fifth aspect of the present invention provides a method for identifying non-photosensitive eggplant varieties, using the DNA of the eggplant to be tested as a template and performing real-time fluorescence quantitative PCR amplification with the above primers.

[0013] A sixth aspect of the present invention provides a method for screening non-photosensitive eggplant varieties, using the DNA of the eggplant to be tested as a template and performing real-time fluorescence quantitative PCR amplification with the above primers.

[0014] The present invention uses green eggplant "21E26" and non-photosensitive purple eggplant "21E27" as parents, conducts genetic analysis of eggplant fruit color, BSA mixed pool sequencing, parent resequencing, genotyping of F2 segregating populations, and 4：5By screening recombinant plants in the population and other technical means, the key QTL interval related to the non-photosensitive trait was narrowed to 33.58kb, with a genetic distance of 0.1cM. In the positioning interval, only one gene SmMYB113 was identified, and there was a difference in sequencing depth only in the region from -1959bp to -1234bp upstream of the ATG of the SmMYB113 gene in the non-photosensitive purple eggplant "21E27". By designing the front primer upstream of the region, designing the rear primer in the region, and conducting genetic complementation experiments with tomatoes as materials, it was verified that the region was repeated only in non-photosensitive eggplant. Therefore, the RU repeat sequence in the SmMYB113 promoter (the region from -1959bp to -1234bp upstream of the ATG, the sequence is shown in SEQ ID NO: 1) makes SmMYB113 expression independent of light in non-photosensitive eggplant, thereby enhancing the accumulation of anthocyanins even in the absence of light, and can be used as a molecular marker for identifying non-photosensitive eggplant. According to the molecular marker of the present invention, primers suitable for amplifying the molecular marker are designed (sequences are shown in SEQ ID NO: 2 to SEQ ID NO: 7), and the accuracy of identifying non-photosensitive eggplants in 264 natural eggplant populations is 95.8%.

[0015] The present invention accurately locates the key gene regulating non-photosensitive eggplant and develops the corresponding molecular marker, which can provide technical support for molecular marker-assisted selection breeding of eggplant and has important application value in production. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the phenotypic identification and genetic law analysis of the parental materials in Invention Example 1.

[0017] Figure 2 This is the sequence cloning analysis of the SmFTSH10 gene in Example 1 of the present invention in different materials.

[0018] Figure 3 The results are the fine positioning of the NPS gene and the sequence alignment and expression level identification results of the candidate genes in different materials in Example 1 of the present invention.

[0019] Figure 4 This is an amino acid sequence comparison analysis of SmMYB113 in different materials in Example 1 of the present invention.

[0020] Figure 5 This is a sequence alignment of SmMYB113 in 21E26, 21E27E, 22E85, guiqie1, and HQ-1315 in Example 1 of the present invention.

[0021] Figure 6 This is the promoter sequence analysis and cis-acting element prediction of SmMYB113 in different eggplant materials in Example 1 of the present invention.

[0022] Figure 7 It is a repeating unit in different types of fruit color materials in Example 1 of the present invention.

[0023] Figure 8 This is the transgenic complementation verification of SmMYB113 in Example 1 of the present invention.

[0024] Fig. 9 This is the molecular marker identification of the molecular marker 23QP715 in Example 1 of the present invention in eggplants with different fruit colors. DETAILED DESCRIPTION

[0025] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0026] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0027] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or conditions recommended by the manufacturers. The various commonly used chemical reagents used in the examples are all commercially available products.

[0028] The inventors of the present invention measured the anthocyanin content in the peel of two parent groups, bagged and non-bagged green eggplants "21E26" and non-photosensitive purple-black eggplants "21E27", and an F1 segregation group, and found that no significant difference in anthocyanin content was observed in the bagged and non-bagged peel parts of 21E27 and F1, indicating that the anthocyanin synthesis in these materials occurred in a light-independent manner; in the 21E30 F2 segregation group, it was found that the peel color met the Mendelian genetic segregation ratio of 3:1, indicating that the non-photosensitive (NPS) trait was controlled by a single dominant gene; since no mutations in the potential candidate gene SmFTSH10 for the NPS trait in existing studies were found in multiple non-photosensitive eggplant materials or other fruit color eggplants, it is speculated that there are other genes that regulate the synthesis of anthocyanins in non-photosensitive eggplants. Furthermore, by BSA mixed pool sequencing, the parent green eggplant "21E26" and the non-photosensitive purple eggplant "21E27" were resequenced, and the different SNP sites between the two parents were selected for the development of molecular markers. The developed molecular markers were used to statistically analyze the genotyping results and phenotypic data of the F2 segregating population, and the initial positioning interval of the key QTL was obtained, which was located in the 86kb interval with a genetic distance of 0.58cM. 4：5Eleven recombinant plants were screened from the population, narrowing the interval to 33.58kb, with a genetic distance of 0.1cM; only one gene SmMYB113 was identified within the positioning interval, and expression analysis showed that SmMYB113 was highly expressed in 21E27 regardless of whether the fruit was bagged or not, but was almost not expressed in 21E26. It was speculated that SmMYB113 was a key candidate gene for NPS. Further, no mutations were detected in the SmMYB113 genomic region between the photosensitive eggplant (22E85, HQ1315 and guiqie1) and the non-photosensitive NPS eggplant 21E27, while only the non-photosensitive NPS eggplant 21E27 had a difference in sequencing depth in the region from -1959bp to -1234bp upstream of ATG; amplification primer 23QP925 was developed on both sides of the abnormal region to analyze the sequence in this interval. After gel electrophoresis and Sanger sequencing, a 725bp repeat unit (RU) was found in 21E27, which was repeated four times in the non-photosensitive eggplant 21E27, while only one copy existed in the green eggplant 21E26 and the photosensitive purple eggplant 22E85. The repeat unit in the SmMYB113 promoter was further verified by the new amplification primer 23QP723 (the forward primer was located upstream of the RU region and the reverse primer was located in the RU region). Based on the repeating unit sequence and its flanking sequences, amplification primers 23QP715 were designed, with a total of three pairs of primers (23QP715-F1 / R1, 23QP715-F2 / R2 and 23QP715-F3 / R3). The relative copy numbers of RU in 21E26, 21E27, 22E85 and 92 other eggplant varieties were analyzed by quantitative real-time PCR. The results showed that the RU copy number in non-photosensitive eggplant (p = 4.4092 e-22 ) was significantly higher than that of photosensitive eggplant. Based on these results, it is speculated that the RU repeat sequence in the SmMYB113 promoter makes the expression of SmMYB113 independent of light in non-photosensitive eggplant, thereby enhancing the accumulation of anthocyanins even in the absence of light. Genetic complementation experiments were carried out using tomatoes as materials, verifying that the RU repeat sequence in the SmMYB113 promoter plays a role in regulating the synthesis of anthocyanins in non-photosensitive eggplant fruits. Therefore, the RU repeat sequence in the SmMYB113 promoter (sequence shown in SEQ ID NO: 1) can be used as a molecular marker for identifying non-photosensitive eggplant.

[0029] In some embodiments of the present invention, a molecular marker tightly linked to the non-photosensitive trait of eggplant is disclosed. The molecular marker is located at -1959 bp to -1234 bp of the eggplant SmMYB113 promoter, and its nucleotide sequence is shown in SEQ ID NO:1.

[0030] In other embodiments of the present invention, the application of the above molecular markers in identifying or screening non-photosensitive eggplant varieties is disclosed.

[0031] In other embodiments of the present invention, a primer for amplifying the above-mentioned molecular marker is disclosed, comprising a forward primer having a sequence as shown in SEQ ID NO:2 and a reverse primer as shown in SEQ ID NO:3, a forward primer having a sequence as shown in SEQ ID NO:4 and a reverse primer as shown in SEQ ID NO:5, and a forward primer having a sequence as shown in SEQ ID NO:6 and a reverse primer as shown in SEQ ID NO:7.

[0032] In other embodiments of the present invention, the use of the above primers in identifying or screening non-photosensitive eggplant varieties is disclosed.

[0033] In other embodiments of the present invention, a kit for detecting non-photosensitive eggplant varieties is disclosed, comprising the above primers.

[0034] In other embodiments of the present invention, the use of the above-mentioned kit in identifying or screening non-photosensitive eggplant varieties is disclosed.

[0035] In other embodiments of the present invention, a method for identifying non-photosensitive eggplant varieties is disclosed, wherein the DNA of the eggplant to be tested is used as a template and the above primers are used to perform real-time fluorescence quantitative PCR.

[0036] In some embodiments, the method further comprises calculating the relative number of repetitions of the nucleotide sequence in the region shown in SEQ ID NO: 1, wherein the relative number of repetitions = 2^(-(Cq F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 ))), where Cq F1 / R1 is the Cq value obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO: 2 and the reverse primer shown in SEQ ID NO: 3, Cq F2 / R2 is the Cq value obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO:4 and the reverse primer shown in SEQ ID NO:5, Cq F3 / R3 is the Cq value obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO: 6 and the reverse primer shown in SEQ ID NO: 7.

[0037] In other embodiments of the present invention, a method for screening non-photosensitive eggplant varieties is disclosed, wherein the DNA of the eggplant to be tested is used as a template and the above primers are used to perform real-time fluorescence quantitative PCR.

[0038] In some embodiments, the method further comprises calculating the relative repeat number of the region of the nucleotide sequence as shown in SEQ ID NO: 1, and screening eggplant varieties with a relative repeat number ≥ 2, wherein the relative repeat number = 2^(-(Cq F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 )), where Cq F1 / R1 is the Cq value obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO: 2 and the reverse primer shown in SEQ ID NO: 3, Cq F2 / R2 is the Cq value obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO:4 and the reverse primer shown in SEQ ID NO:5, Cq F3 / R3 is the Cq value obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO: 6 and the reverse primer shown in SEQ ID NO: 7.

[0039] In the following embodiments of the present invention, the experimental materials used include: the eggplant high-generation inbred lines were obtained by conventional breeding at South China Agricultural University, and the phenotypes of these inbred lines are as follows: 21E26, 22E81 and 24AE006 are green eggplant fruit materials; 22E82 is a white eggplant fruit material; 22E85 is a photosensitive purple fruit material; 21E27 and 24AE005 are non-photosensitive (NPS) purple-black fruit materials. 264 natural eggplant varieties were purchased from the farm of Jiaoyang Agriculture Co., Ltd., Guangzhou, Guangdong Province. All 264 varieties were planted in the fall of 2021, and commercial mature fruits were used for phenotypic analysis. The population used for gene positioning was hybridized with green eggplant 21E26 and 21E27 non-photosensitive (NPS) purple eggplant as parents. The 21E30 F2 population (21E26×21E27) was planted and cultivated at South China Agricultural University in Guangzhou in the fall of 2020. The F3, F4, and F5 populations of self-pollinated progeny, as well as the 24AE009F2 segregating population (24AE005 × 24AE006) were planted at the farm of Guangzhou Jiaoyang Agriculture Co., Ltd., Guangdong Province. The genotype and phenotypic data of guiqie1 and 67 / 3 eggplants were obtained from the Solanaceae Genome website (https: / / solgenomics.net / ).

[0040] In the following examples of the present invention, the materials were treated as follows: ① For eggplant materials, immediately after pollination, they were bagged with opaque kraft paper and shaded for 14 days to promote fruit growth in complete darkness. The lower half of the bag was then removed, and after 7 days, the eggplant fruits were sampled for color analysis, anthocyanin quantification, and gene expression studies. ② Tomato materials were bagged in the same manner, but for 25 days, and tomato peels under different treatment conditions were collected, quickly frozen in liquid nitrogen, and stored at -80°C until further analysis.

[0041] In the following examples of the present invention, the anthocyanin content of eggplant exocarp was determined by spectrophotometric differential pH method, and the specific operation was as follows: 100 mg of eggplant sample was ground into powder in liquid nitrogen; added to 2 mL of working solution (pH=1.0 buffer and pH=4.5 buffer) respectively; centrifuged at 14000 rpm, 10 min, 4°C; the supernatant was taken and measured with a spectrophotometer at a wavelength of 510 nm. The calculation formula is: total anthocyanins (mg / g FW) = (A1-A2) × 484.8 / 24.825 × dilution factor, wherein A1 represents the reading of the supernatant in pH = 1.0 buffer (50mM KCl and 150mM HCl) at a wavelength of 510nm; A2 represents the reading of the supernatant in pH = 4.5 buffer (400mM sodium acetate and 204mM HCL) at a wavelength of 510nm; 484.8 is the molecular weight of cyanidin-3-O-glucoside; 24.825 is the molar absorbance at a wavelength of 510nm.

[0042] In the following examples of the present invention, the method for determining the chlorophyll content of the outer skin of commercial ripe eggplant is based on the method of Alan et al. (1994). Alan R W. 1994. The Spectral Determination of Chlorophylls a and b, as well as Total Carotenoids, Using Various Solvents with Spectrophotometers of Different Resolution. Journal of Plant Physiology, 144 (3): 307-313.

[0043] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0044] Example 1: Discovery of genes regulating anthocyanin synthesis in "non-photosensitive" eggplant peel

[0045] In this example, the green eggplant fruit material 21E26 was used as the male parent, the non-photosensitive (NPS) purple-black eggplant fruit material 21E27 was used as the female parent, and the F1 and 21E30 F2 populations (21E26×21E27) were used as research objects to explore the genes that regulate the synthesis of anthocyanins in the "non-photosensitive" eggplant peel.

[0046] 1. Genetic rules of fruit color in non-photosensitive (NPS) eggplant

[0047] The characteristics of the two parental groups of green eggplant "21E26" and non-photosensitive purple-black eggplant "21E27" and the F1 segregating group were investigated and statistically analyzed. The phenotype of 21E26 is that the fruit skin color is green and has a high chlorophyll content, while the phenotype of 21E27 and F1 is that the fruit skin color is purple-black and contains high anthocyanins and chlorophyll ( Figure 1 a)

[0048] To identify the phenotype of the parental material, the chlorophyll and anthocyanin content in the bagged and non-bagged fruit peels was measured. The specific operation was that the fruit was bagged for 14 days after pollination, and then the bag was removed from the lower half of the fruit. After 7 days, the peels of the continuously bagged and unbagged parts were analyzed. The results showed that the chlorophyll level of the unbagged part of 21E26, 21E27 and F1 fruits was significantly higher than that of the bagged part ( Figure 1 However, no significant difference in anthocyanin content was observed between bagged and non-bagged fruit peels in 21E27 and F1 ( Figure 1 c), indicating that anthocyanin synthesis in these materials occurs in a light-independent manner.

[0049] Among the 175 21E30 F2 segregating populations, 121 plants showed non-photosensitive purple fruit skin (NPS phenotype), and 54 plants showed green fruit skin ( Figure 1 d) in the figure, which conforms to the Mendelian genetic segregation ratio of 3:1 (χ2=1.8867, P=0.157), indicating that the non-photosensitive (NPS) trait is controlled by a single dominant gene.

[0050] Studies have shown that SmFTSH10 is considered a potential candidate gene for the NPS trait, and the reason for this is explained to be the loss of the C base. However, the inventors did not find this mutation site in multiple non-photosensitive eggplant materials or other fruit color eggplants (see Figure 2 ), it is speculated that there are other genes (hereinafter referred to as NPS genes) that regulate the synthesis of anthocyanins in non-photosensitive eggplants.

[0051] 2. Fine localization of the NPS gene

[0052] 1. BSA pool sequencing

[0053] The fruit color of the F2 population was statistically analyzed, and 20 extreme green eggplant populations and 20 extreme purple-black eggplant populations were selected according to the fruit color distribution. The DNA of the two populations was mixed in equal amounts to form a green eggplant pool and a purple-black eggplant pool for BSA mixed pool sequencing. The parents "green eggplant 21E26" and "non-photosensitive purple eggplant 21E27" were resequenced, with a parent sequencing depth of 20× and a green eggplant pool and a purple-black eggplant pool sequencing depth of 30×. Eggplant HQ-1315 was used as the reference genome (https: / / solgenomics.net / ), and reliable SNP sites were obtained through BWA, SAM, and GATK software. Then, the parent "21E27" was used as a reference to calculate the SNP-index of each SNP site in each mixed pool. According to the obtained data, the SNP-index of the green eggplant pool was subtracted from the SNP-index of the purple-black eggplant pool to obtain △(SNP-index), and the distribution map of SNP-index and △(SNP-index) was drawn based on the above data. Based on the eggplant reference genome HQ-1315 published in the Sol Genomics Network database (SGN), the SNP sites of "green eggplant 21E26" and "non-photosensitive purple eggplant 21E27" in the parental resequencing results were compared, and the different SNP sites between the two parents were selected for the development of molecular markers.

[0054] Among them, eggplant genomic DNA was extracted by using a modified CTAB method (2% CTAB reagent, the formula is shown in Table 1, the prepared CTAB was sterilized in an autoclave at 121° C. for 20 min, and after cooling, 1 / 1000 β-mercaptoethanol was added in a fume hood).

[0055] Table 1

[0056] Reagents Usage Tris 12.12g NaCl 82g EDTA 7.44g PVP 2g CTAB 20g <![CDATA[ddH2O]]> Up to 1000mL

[0057] The specific steps are as follows:

[0058] a. Sampling: Take young eggplant leaves and place them in a 2 mL centrifuge tube;

[0059] b. Freeze drying: open the lid of the 2 mL centrifuge tube containing the leaves and place it in a freeze dryer at -80°C and 1 mbar for 48 hours;

[0060] c. Tissue disruption: Add 2 steel beads to a 2 mL centrifuge tube, grind in a tissue disruptor at 60 Hz for 1 min, and then centrifuge at 10,000 rpm for 30 s.

[0061] d. Extraction: Add 750 μL of 2% CTAB extracting solution and shake vigorously to allow the sample to fully react with it. Place the centrifuge tube in a constant temperature metal bath at 65°C for 45 minutes, shaking once every 20 minutes during the process.

[0062] e. Phase separation: Add 750 μL of chloroform:isoamyl alcohol (24:1) mixture to a 2 mL centrifuge tube in a fume hood, shake vigorously to mix thoroughly, and then centrifuge at 10,000 rpm for 6 min.

[0063] f. Precipitate DNA: After centrifugation, take 375 μL of supernatant into a new 1.5 mL centrifuge tube, add 750 μL of pre-cooled anhydrous ethanol, shake gently to mix, and place in a -20°C low-temperature refrigerator for 1 hour.

[0064] g. Purification: Place the centrifuge tube in a centrifuge and centrifuge at 12,000 rpm for 6 minutes, discard the supernatant, add 750 μL 70% ethanol to rinse twice, dry the liquid on the surface of the centrifuge tube with a paper towel, place it in a 65°C oven for 1 to 2 hours, and dry it.

[0065] h. Dissolution and storage: Add 100 μL of sterilized ultrapure water to each centrifuge tube to dissolve, place on a horizontal shaker at 30 rpm at room temperature for 12 hours, and finally store in a -20°C low-temperature refrigerator.

[0066] 2. Construction of genetic linkage map and preliminary gene location

[0067] The available KASP molecular markers were designed and screened within the 95% confidence interval discovered by BSA-seq, and genotyping was performed in different types of segregating populations. The results were organized into an EXCEL table. The genotype identical to the green eggplant parent was replaced with "0", the genotype identical to the purple-black eggplant parent was replaced with "2", the heterozygous type was replaced with "1", and the undefined or no signal was replaced with "-1". The genetic distance was calculated using the MAP function of QTL Ici Mapping 4.2 to construct a genetic linkage map. The Kosambi mapping function was used to convert the recombination frequency to estimate the mapping distance in cM. The BIP function of QTL Ici Mapping was then used to perform QTL analysis on the eggplant fruit color trait, and the LOD value of 2.5 was used as the threshold for judging the existence of QTL to obtain the gene positioning results. Through the BSA-seq results and the statistical analysis of the genotyping results and phenotypic data of the F2 segregating population using polymorphic molecular markers developed within its interval, the initial positioning interval of the key QTL was obtained, which was located within the 86kb interval with a genetic distance of 0.58cM.

[0068] Among them, the genotyping method is as follows:

[0069] (1) Dilute the extracted genomic DNA of the sample to be tested to 50 ng / μL as a template for the amplification reaction. P1 (its 5' end is modified with a FAM fluorescent linker GAAGGTGACCAAGTTCATGCT), the front primer F P2 (whose 5' end was modified with a HEX fluorescent linker GAAGGTCGGAGTCAACGGATT) and rear primer R as KASP amplification primer (designed according to the existing conventional method based on the KASP molecular marker and synthesized by Shanghai Sangon Biotechnology Co., Ltd.), PCR amplification was performed using the PCR reaction system in Table 2 (needs to be carried out on ice, and KASP MIX needs to be stored away from light. After the system is prepared, centrifuge it at 1200 rpm for 1 min) and the PCR reaction program in Table 3.

[0070] Table 2 PCR reaction system

[0071]

[0072]

[0073] Table 3 PCR reaction program

[0074] Program number Operation requirements time 1 94℃ 15min 2 94℃ 20s 3 78℃ 10s 4 65℃(0.5℃ drop for each cycle) 1min 5 Return to step 2, 10 cycles 6 94℃ 20s 7 57℃ 1min 8 Return to step 6, 30 cycles 9 Plate reading

[0075] (2) Genotyping data analysis

[0076] The final fluorescence signal was analyzed using the CFX Maestro V4.1 analysis software that comes with the C1000 Touch to obtain the SNP typing results. The yellow circles that are displayed on the X-axis, that is, the signal of the Allele 1 channel reported by the sample, are the allele types connected to the FAM fluorescent connector; the blue squares that are displayed on the Y-axis, that is, the signal of the Allele 2 channel reported by the sample, are the allele types connected to the HEX fluorescent connector; the samples that are displayed as green triangles above the diagonal of the XY axis are the heterozygous types of the two alleles.

[0077] 3. Fine positioning

[0078] By 864 strain F 4：5 Eleven recombinant plants were screened from the population (using two markers on both sides of the gene localization region to perform genotyping analysis on the plants in the isolated population, and the two markers detected plants with different genotypes). The NPS gene was further located between 23QP578 and 21QP381, narrowing the interval to 33.58 kb, with a genetic distance of 0.1 cM ( Figure 3b). Only one gene, SmMYB113, was identified within the localization interval. It was reported to encode the R2R3-MYB transcription factor involved in regulating the biosynthesis of anthocyanins in eggplant. Sequence analysis showed that compared with 21E27, the SmMYB113 gene in 21E26 had multiple mutation sites, including a 26 bp fragment deletion (the first intron and the second exon overlapped), two insertion sites (a 56 bp and a 1 bp insertion located in the second intron and the third exon, respectively), and 18 SNP sites (9 in introns and 9 in exons) ( Figure 3 c). The 26 bp deletion in the 21E26 material caused alternative splicing, resulting in protein truncation ( Figure 4 Expression analysis showed that SmMYB113 was highly expressed in 21E27 (bagged and non-bagged peels), but was barely expressed in 21E26 ( Figure 3 d), it is speculated that SmMYB113 is the key candidate gene of SmNPS10.1.

[0079] 3. Identification of the 725 bp repeat unit in the promoter region of SmMYB113 in non-photosensitive eggplant

[0080] 1. No mutations were detected in the SmMYB113 genomic region (ATG to TAA, including exons and introns) between the photosensitive eggplants (22E85, HQ1315 and guiqie1) and the photosensitive NPS eggplant 21E27 (see Figure 5 ). To this end, we studied the sequence information of the promoter region of SmMYB113. By using Integrative Genomics Viewer (IGV) to read and align the reference genomes of guiqie1, 67 / 3, and HQ1315, we found that compared with the photosensitive eggplant (22E85, guiqie1, 67 / 3, and HQ1315), only 21E27 had a difference in sequencing depth in the region from -1959bp to -1234bp upstream of ATG, and no sequence differences were detected in other regions ( Figure 6 In 21E27, the sequencing depth of this region was 2.92 times that of its surrounding regions. However, in the light-sensitive eggplants, including 21E26 (~1.03 times), S86 (~0.70 times), 22E81 (~0.91 times), 22E82 (~1.08 times), 22E85 (~1.17 times), and 22E86 (~0.97 times, Figure 6 b) in the study—no such difference was found.

[0081] 2. We further developed amplification primers 23QP925 (F: TGCTTACCTATACACC CCGTCTA, SEQ ID NO: 8; R: TGCAATGCACAGATCTAAAAGTCA, SEQ ID NO: 9) for both sides of the abnormal region to analyze the sequence within this interval. The results showed that the PCR product in 21E27 (PCR reaction system and reaction procedure are shown in Tables 2 and 3) was 748 bp and 2175 bp longer than that in 21E26 and 22E85, respectively. Figure 6 c). Sanger sequencing analysis revealed a 725 bp repeat unit (RU) in 21E27, which was repeated four times in the non-photosensitive eggplant 21E27 and only one copy in the photosensitive eggplant 22E85 ( Figure 6 d in the figure). Since the amplification primer 23QP925 is used for analysis, the expensive KOD FX PCR enzyme (TOYOBO, KFX-101) is required, and PCR amplification cannot be performed on some eggplant materials (the possible reason is that the RU sequence is too long and the sequence is complex, resulting in low amplification efficiency), so the amplification primer has no practical application value, and a new amplification primer needs to be developed.

[0082] 3. To further verify the repeating unit in the SmMYB113 promoter, we developed new amplification primers 23QP723 (F: CCAGGCTATCATCATATAGGGTGTT, SEQ ID NO: 10; R: AAAGTGAAATAATACGAAAAACCCCAT, SEQ ID NO: 11), with the forward primer located upstream of the RU region and the reverse primer located in the RU region ( Figure 6 d in Figure ). Consistent with the sequencing results, four ladder-shaped bands (~400 bp, ~1200 bp, ~1800 bp, ~2500 bp) were detected in the PCR product of 21E27, while only one band was detected in 21E26 and 22E85 ( Figure 6 d). Since the amplification primer 23QP723 was used for analysis, the stability was poor and the amplification efficiency was low in some materials, a new amplification primer 23QP715 was further developed.

[0083] 4. Using the new amplification primer 23QP715, a total of 3 pairs of primers (Table 4), real-time fluorescence quantitative PCR was used to analyze the relative copy number of RU in 21E26, 21E27, 22E85 and other 92 eggplant varieties. Figure 7 As shown, the RU copy number in non-photosensitive eggplant (p = 4.4092 e-22 ) was significantly higher than that of photosensitive eggplant.

[0084] The method of real-time fluorescence quantitative PCR is as follows:

[0085] The extracted genomic DNA of the eggplant sample to be tested was diluted to 50 ng / μL as a template for the amplification reaction, and real-time fluorescence quantitative PCR amplification was performed using the three pairs of primers shown in Table 4.

[0086] Table 423 QP715 molecular marker sequence information

[0087]

[0088]

[0089] After the real-time fluorescence quantitative PCR amplification is completed, the relative number of repeats (2^(-(Cq F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 ))).

[0090] 4. Analysis of cis-acting elements

[0091] Analysis of cis-acting elements in the RU region of SmMYB113 revealed that there were 51 cis-acting elements in the RU region, of which 8 were related to light response, including AE-box, Box4, AT1-motif, TCCC-motif, AAAC-motif and I-box.

[0092] Based on the above research results, it is speculated that the RU repeat sequence in the SmMYB113 promoter (nucleotide sequence is shown in SEQ ID NO: 1) makes the expression of SmMYB113 independent of light in non-photosensitive eggplant, thereby enhancing the accumulation of anthocyanins even in the absence of light.

[0093] SEQ ID NO:1

[0094] AGTAAAATATTATTTAATTATATTATTAAAAAATATTGACTTTTAGATCTGTGCATTGCACA

[0095] AAATTATCGTAACTACCAAATTAATTAATGGTACTCTAGTTATGTCATATGCCAATCATTTT

[0096] TTGACTTTTTTAATTTCCTCCATTATTAATATTATCCATGTGGTGGAAAGGGGGTCAAGAA

[0097] ACAATCCTATTTGGTCACTACCAAAACTATTTTTTATTTTTACCAAATTAAATAATGGTACTT

[0098] TAGTTGGGCCATATGTCACTTGTTTTTTGATCATTCGAGTAATTTGCAATTTGCACCCATA

[0099] ATATATGCGTTTTTTTGTAATTTGCCCCTTATTTTATCATTTTTTGTGATTTGCACCTTAATTT

[0100] TTTTATTTCCTTACAAAATTGAGTATAATTTGTGATTTGCACCCCTAATGTATGCCCTTTTT

[0101] TGTGGCTTGCACCTTATTCTATCATTTTTTGTGATTGGCACCTCAATCTTTTTATTTCATTG

[0102] CAAAATCATAAAAATTTAAAAAAAAAATCCAACAATTTTCAAAGGGTAAACAAGGAAA

[0103] ACAATGAATATTTCTATAAAAAGTATTTTATTCACGAGAAAATTAGGTGGATCCTCTTCTT

[0104] CTATCTTGGCAACATATAAAACAATTTAAAGGAAGCTTAAGTTTTGATTGTAAAATGAA

[0105] ACCCATATTTTTTTTGTGAGCCAAGAAAATGAAGCAGGAGAGGGAGATGAT

[0106] Example 2 Verification of SmMYB113 regulating anthocyanin biosynthesis in a light-independent manner in non-photosensitive eggplant fruits

[0107] In order to verify the role of RU repeat sequence in the regulation of anthocyanin synthesis in non-photosensitive eggplant fruit by SmMYB113 gene, this example carried out genetic complementation experiment with Micro-Tom tomato as material, and obtained proSmMYB113 21E26 :SmMYB113 21E26 、proSmMYB113 21E27 :SmMYB113wt and proSmMYB113 22E85 :SmMYB113 wt of transgenic strains.

[0108] 1. Cloning of the target gene coding region and promoter region and vector construction

[0109] Using the DNA of 21E27 eggplant as a template, F: CCATGATTACGAATTCCCTCGGGTCTCTTTCTA (SEQ ID NO: 12) and R: ATGGTCTAGAGGATCCATCAAGTAGATTCCATAAATCAAT (SEQ ID NO: 13) as primers, PCR enzyme KOD FX (purchased from Toyobo (Shanghai) Biotechnology Co., Ltd.) was used to clone the target gene (SmMYB113) and the promoter region. The reaction system is shown in Table 5. The amplification program is shown in Table 6.

[0110] Table 5 KOD FX amplification reaction system

[0111] Composition Usage / uL 2xPCR buffer for KODFX 10 2mM dNTPs 4 F / R 1 Template DNA 1 KODFX 0.5 <![CDATA[ddH2O]]> 3.5

[0112] Table 6 KOD FX reaction amplification program

[0113] Program number Operation requirements time 1 95℃ 2min 2 95℃ 10s 3 55℃ 20s 4 68℃ 3min 5 Return to step 2, 10 cycles 6 95℃ 10s 7 68℃ 3min 8 68℃ 1min 9 Return to step 6, 24 cycles 10 12℃ ∞

[0114] After the cloned product was purified (PCR product was recovered according to the DNA gel recovery kit of Qingke Biotechnology Co., Ltd.), it was connected to the binary expression vector pCAMBIA2300 by one-step cloning method (HieffClone Plus one step cloning Kit rapid cloning kit of Yisheng Biotechnology Co., Ltd.), and transformed into Agrobacterium GV3101 by heat shock method, at -80°C, and the glycerol bacteria were kept for use. The one-step cloning reaction system is shown in Table 7.

[0115] Table 7 One-step cloning reaction system

[0116] Components Recombination reaction Linearized vector 5μL Insert 3μL 2xHieffCloneEnzymePremix 10μL <![CDATA[ddH2O]]> Up to 20 μL

[0117] 2. Tomato genetic transformation

[0118] The experimental process is as follows:

[0119] (1) Explant preparation: clean tomato seeds, disinfect with 70% alcohol for 45 seconds, and rinse with sterile water three times; treat with 10% sodium hypochlorite for 30 minutes on a clean bench, shake continuously, and rinse with sterile water 5-6 times to completely remove residual sodium hypochlorite; transfer the sterilized seeds to 1 / 2MS culture medium for germination, place in a 4°C refrigerator for 3-4 days, and culture in a light incubator at 28°C / 16h and 20°C / 8h (treating in the dark before germination can increase the consistency of germination); after 7-9 days (it is best if the true leaves have not yet emerged), collect the cotyledons in a moist culture dish; after all the cotyledons have been collected, transfer them to the pre-culture medium and pre-culture at 28°C in the dark for 2 days.

[0120] (2) Preparation of Agrobacterium: Streak plates (YEB solid medium, 25 mg / L rifampicin, 50 mg / L kanamycin) 4-5 days in advance and culture at 28°C for 2 days to obtain well-isolated single clones; select single clones and transfer to YEB liquid medium (containing 25 mg / L rifampicin, 50 mg / L kanamycin) and shake at 28°C at 200 rpm until OD 600 =0.5-0.8 (about 30-48h); after centrifugation at 4°C, 6000rpm for 5min, the bacteria were collected on a clean bench and suspended in MSO liquid culture medium (containing 100ug / L acetosyringone) to prepare for transformation.

[0121] (3) Co-cultivation: Soak the explants in the Agrobacterium suspension for 10-15 minutes, then use sterile filter paper to absorb the Agrobacterium liquid remaining on the explants, transfer them to the pre-cultivation medium (with the upper surface of the cotyledons facing up), and culture them in the dark at 28°C for 2-3 days. During the operation, try to avoid damage to the explants by the instruments.

[0122] (4) Selective regeneration culture: After 2-3 days of co-cultivation, transfer the cotyledons to the screening medium with the upper surface of the cotyledons facing up. Transfer to a new screening medium every 2 weeks; cut the callus with bud primordia into small pieces after 3-4 weeks and transfer to the bud elongation medium for culture; after 2-3 weeks of culture on the bud elongation medium, transfer the compact green callus (with or without green buds, small clusters of buds) to a new screening medium for continued culture; transfer small buds of about 1 cm to a new bud elongation medium; discard black / brown callus and loose or white callus. Transfer once every two weeks, or more quickly if necessary; when the stem grows to 3-5 cm, cut the buds from the callus and transfer them to the rooting medium. Do not keep any callus on the stem. After about 2-3 weeks, the seedlings should have a good root system. If not, cut the stem again and transfer to a fresh rooting medium; seedlings of about 5-7 cm can be transplanted to sterile soil.

[0123] 3. Anthocyanin extraction from transgenic tomato lines

[0124] (1) Extraction solution preparation (as shown in Table 8)

[0125] Table 8

[0126] Reagents Usage Anhydrous methanol 32ml Concentrated HCl 1ml <![CDATA[ddH2O]]> 66ml

[0127] (2) Take 1 g of fresh sample in a mortar and grind it with liquid nitrogen;

[0128] (3) Transfer 0.5 g of sample powder to a 10 ml centrifuge tube and add 5 ml of extraction solution and mix well;

[0129] (4) Wrap in tin foil (protect from light) and store in a refrigerator at 4°C overnight;

[0130] (5) Take out the centrifuge tube containing the sample and centrifuge at 5000 rpm, 4°C for 6-10 min;

[0131] (6) Carefully aspirate (5 ml syringe) the supernatant, filter through a 0.45 μm filter, and remove 3-4 ml;

[0132] (7) Using UV spectrophotometer, measure the absorbance values ​​of A535 and A650.

[0133] The content of anthocyanin C (mg / 100g) = (A*MW*DF*V)*100 / (ε*L*Wt), wherein A: absorbance; ε: extinction coefficient of cyanidin-3-glucoside; 26900DF: dilution factor; MW: 449.2V of cyanidin-3-glucoside: final volume (ml); L: optical path (1cm); Wt: sample mass.

[0134] 4. Phenotypic analysis of transgenic lines

[0135] The results are as follows Figure 8 As shown, from Figure 8 It can be seen that in proSmMYB113 21E27 :SmMYB113 wt and proSmMYB113 22E85 :SmMYB113 wt Anthocyanin accumulation was detected in the unbagged pericarp of 21E26 :SmMYB113 21E26 No anthocyanin accumulation was detected in Figure 8 a and b), confirming that the mutation of SmMYB113 in 21E26 caused loss of function. 22E85 :SmMYB113 wt Compared with bagged tomatoes, proSmMYB113 21E27:SmMYB113 wt The bagged fruits showed a darker purple color and higher anthocyanin content ( Figure 8 The results showed that SmMYB113 expression in proSmMYB113 was significantly higher in bagged and unbagged tomato fruits than in unbagged tomato fruits. 21E27 :SmMYB113 wt The expression of β-actin in the fruit peel of the strains was high, which was consistent with the anthocyanin content ( Figure 8 c) in.

[0136] The results of this example show that in the non-photosensitive eggplant 21E27, the RU repeat sequence in the SmMYB113 promoter enables it to transcribe and activate the synthesis of anthocyanins independently of light induction.

[0137] Based on the results of Example 1 and Example 2, the RU repeat sequence in the SmMYB113 promoter (nucleotide sequence as shown in SEQ ID NO: 1) is a molecular marker closely linked to the eggplant non-photosensitive trait. The primers for amplifying the molecular marker (named 23QP715) include three pairs of primers, as shown in Table 4.

[0138] Take the DNA of the eggplant material to be tested, use the primers in Table 4 to perform real-time fluorescence quantitative PCR, and calculate the relative repeat number of the target fragment based on the obtained Cq value 2^(-(Cq F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 )), if the relative repetition number 2^(-(Cq F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 ))≥2, the eggplant material to be tested is a non-photosensitive eggplant variety.

[0139] Example 3 Validation of molecular marker 23QP715 in natural populations of eggplant

[0140] 264 eggplant varieties exhibited at the 20th Guangdong Seed Expo (2021) were used as materials, and their DNA was extracted respectively. Real-time fluorescence quantitative PCR was performed using primer 23QP715 to verify the accuracy of the molecular marker of the present invention. The results are shown in Table 9 and Fig. 9 shown.

[0141] Table 9264 Eggplant Natural Group Material Information

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149] From Table 9 and Fig. 9 The results show that, in 264 natural populations, the accuracy of the molecular marker of the present invention verified by primer 23QP715 was 95.8% (253 / 264). Therefore, the molecular marker of the present invention can be used to identify non-photosensitive eggplant.

[0150] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A molecular marker tightly linked to the non-photosensitive trait of eggplant, characterized in that: The molecular marker is located at -1959 bp to -1234 bp of the eggplant SmMYB113 promoter, and its nucleotide sequence is shown in SEQ ID NO:

1.

2. Use of the molecular marker according to claim 1 in identifying or screening non-photosensitive eggplant varieties.

3. A primer for amplifying the molecular marker according to claim 1, characterized in that: It includes a forward primer with a sequence as shown in SEQ ID NO:2 and a reverse primer with a sequence as shown in SEQ ID NO:3, a forward primer with a sequence as shown in SEQ ID NO:4 and a reverse primer with a sequence as shown in SEQ ID NO:5, and a forward primer with a sequence as shown in SEQ ID NO:6 and a reverse primer with a sequence as shown in SEQ ID NO:

7.

4. Use of the primers according to claim 3 in identifying or screening non-photosensitive eggplant varieties.

5. A kit for detecting non-photosensitive eggplant varieties, characterized in that: Comprising the primer described in claim 3.

6. Use of the kit according to claim 5 in identifying or screening non-photosensitive eggplant varieties.

7. A method for identifying non-photosensitive eggplant varieties, characterized in that: The real-time fluorescence quantitative PCR amplification is performed using the DNA of the eggplant to be tested as a template and the primers described in claim 3.

8. The method for identifying non-photosensitive eggplant varieties according to claim 7, characterized in that: The method also includes calculating the relative number of repetitions of the nucleotide sequence in the region shown in SEQ ID NO: 1, wherein the relative number of repetitions = 2^(-(Cq F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 )), where Cq F1 / R1 is the Cq value obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO: 2 and the reverse primer shown in SEQ ID NO: 3, Cq F2 / R2 is the Cq value obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO:4 and the reverse primer shown in SEQ ID NO:5, Cq F3 / R3 is the Cq value obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO: 6 and the reverse primer shown in SEQ ID NO:

7.

9. A method for screening non-photosensitive eggplant varieties, characterized in that: The real-time fluorescence quantitative PCR amplification is performed using the DNA of the eggplant to be tested as a template and the primers described in claim 3.

10. The method for screening non-photosensitive eggplant varieties according to claim 9, characterized in that: The method further comprises calculating the relative repeat number of the region of the nucleotide sequence as shown in SEQ ID NO: 1, and screening eggplant varieties with a relative repeat number ≥ 2, wherein the relative repeat number = 2^(-(Cq F3 / R3 -average(Cq F1 / R1 +Cq F2 / R2 )), where Cq F1 / R1 is the Cq value obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO: 2 and the reverse primer shown in SEQ ID NO: 3, Cq F2 / R2 is the Cq value obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO:4 and the reverse primer shown in SEQ ID NO:5, Cq F3 / R3 is the Cq value obtained by amplifying the eggplant DNA to be tested using the forward primer shown in SEQ ID NO: 6 and the reverse primer shown in SEQ ID NO: 7.

Images