Non-denaturing mass spectrometry detection method for determining interaction between aptamer and small molecule target

Abstract

The invention discloses a non-denaturing mass spectrometry detection method for determining interaction between an aptamer and a small molecule target. The method comprises a spray needle coated with a conductive coating; preparing an aptamer and a target molecule stock solution; carrying out primary mass spectrometry analysis on the mixed solution to obtain the binding ratio of the two solutions; analyzing the stability of compound ions in a tandem mass spectrum mode; according to the detection method provided by the invention, on one hand, a nano-sized electrospray emission spray needle is used, for a non-volatile salt sample solution with relatively high concentration, adducts and ionic clusters formed by a compound are remarkably reduced, the resolving power and the signal-to-noise ratio are improved, the operation is simple and convenient, and the sample dosage is small; on the other hand, the combined stoichiometric relationship and the stability change of the aptamer before and after combination can be intuitively obtained through non-denaturing mass spectrometry detection; the method can rapidly and accurately identify the interaction between the aptamer and the target molecule, and is expected to be further applied to rapid screening and sequence optimization of the aptamer.

Description

Technical Field

[0001] The invention relates to the technical field of biological analysis and detection, in particular to a non-denaturing mass spectrometry detection method for determining the interaction between an aptamer and a small molecule target. Background Art

[0002] Aptamers, as an artificially screened oligonucleotide sequence, have high affinity and good selectivity for target molecules and are widely used in cell imaging, drug delivery, disease treatment, and microbial detection. At present, the research methods for the interaction between nucleic acid aptamers and small molecule targets include fluorescence polarization / anisotropy, surface plasmon resonance, microthermophoresis, etc., but these methods require sample labeling or surface immobilization, which may affect the spatial structure of the aptamer and thus change the binding process between the aptamer and the small molecule target. Although isothermal titration calorimetry does not require sample labeling, the sample usage is large; nuclear magnetic resonance requires milligram-level sample amounts and the data analysis process is complicated. Although x-ray crystallography can provide atomic-level resolution structural data, the sample needs to have a certain crystal structure, which limits the wide application of this method in the field of research on the interaction between aptamers and small molecule targets.

[0003] As a rapid and sensitive analytical method, non-denaturing mass spectrometry has developed rapidly in the fields of characterizing non-covalent biomolecular interactions and studying the higher-order structures of biomolecular complexes. It also has the following advantages in rapidly evaluating the interaction between aptamers and small molecule targets: small sample volume (10-100 μL), low sample concentration (as low as μM), no need for chemical labeling of samples, and sample measurement can be completed in a short time (5-10 s). Moreover, non-denaturing mass spectrometry can introduce aptamers and their complexes into the gas phase for mass spectrometry analysis through electrospray ionization under near-physiological conditions, retaining their structural and functional characteristics, and more accurately and completely characterizing the interaction between aptamers and small molecule targets.

[0004] Due to the polyanionic nature of nucleic acids, relatively high concentrations of monovalent and divalent cations are required in the solution to effectively suppress the electrostatic repulsion between the backbone phosphate groups, allowing them to fold into a three-dimensional conformation, thereby specifically recognizing and binding to small molecule targets. Aptamer samples usually have a high concentration of non-volatile salts to maintain the spatial structure of nucleic acid aptamers, but this reduces the sensitivity and signal-to-noise ratio of mass spectrometry detection, making non-covalent complexes difficult to distinguish. The electrospray ion source in the mass spectrometry device used in the present invention uses a spray needle with a narrow tip diameter, which significantly reduces the addition of salt ions to the aptamer and small molecule target complex, and can effectively improve the signal-to-noise ratio. Summary of the invention

[0005] The purpose of the present invention is to provide a non-denaturing mass spectrometry detection method for determining the interaction between an aptamer and a small molecule target, so as to solve the problems raised in the above-mentioned background technology. By using a spray needle with a smaller inner diameter for sampling, the interaction between the aptamer and the small molecule target is studied in a non-denaturing state, the charge state distribution of the aptamer and the aptamer-small molecule target complex formed by a high salt concentration buffer is distinguished, and the binding stoichiometric relationship between the aptamer and the small molecule target is obtained; the stability of the non-covalent complex ions is studied by the high-energy collision dissociation mode of the tandem mass spectrometry. The device and the detection method can significantly reduce the degree of internalization of salt and non-volatile molecules to the aptamer complex ions, reduce the formation of salt adducts and salt clusters, use less sample, fast signal acquisition speed, and accurate results.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides a non-denaturing mass spectrometry detection method for determining the interaction between an aptamer and a small molecule target, comprising the following steps:

[0008] (1) preparing aptamer aqueous solution, small molecule target stock solution, and ammonium acetate buffer;

[0009] Preparation of aptamer aqueous solution: dissolve the aptamer in water, vortex and centrifuge, and use a micro-ultraviolet spectrophotometer to determine the concentration of the aptamer aqueous solution to obtain the aptamer stock solution, which is frozen and stored at -20°C.

[0010] Preparation of small molecule target stock solution: Dissolve the small molecule target in deionized water, vortex and oscillate to obtain the small molecule target stock solution, and store it at 4°C.

[0011] Preparation of buffer solution: dissolve ammonium acetate in deionized water, and adjust the pH of the solution to 6.8-7.4 with 25% ammonia water to obtain ammonium acetate buffer solution;

[0012] (2) adding the small molecule target stock solution and the aptamer stock solution to an ammonium acetate buffer solution and mixing them evenly, and incubating them for 30 minutes to obtain a complex; performing primary mass spectrometry analysis on the binding sample with the aid of a nano-sized spray to obtain a primary spectrum of the interaction between the aptamer and the target molecule, and calculating the binding stoichiometry of the two based on the charge number and m / z value of the signal peak;

[0013] (3) Using tandem mass spectrometry mode, the stability of the complex ion was analyzed by high-energy collision dissociation technology: the complex ion formed by the aptamer and the target molecule with a binding stoichiometric ratio of 1:2 was used as the parent ion, and a series of energy values ​​E were applied to the parent ion using the high-energy collision dissociation technology of mass spectrometry. The relative signal intensity of the parent ion and the fragment ion was recorded as the energy value changed during this process. A parameter IRa was introduced here, which was defined as the ratio of the complex ion formed by the aptamer and the target molecule to the total amount of all complexed and free aptamers, as shown in formula (1). The corresponding IRa value was obtained at a specific fragmentation energy value, and the obtained set of data was subjected to Boltzmann nonlinear fitting, as shown in formula (2), to obtain the dissociation curve of the complex, and then the corresponding fragmentation energy (E) when the IRa value dropped to half was obtained. 1 / 2 ), used to determine the stability of the complex ion, E 1 / 2 The larger the value, the more stable the complex ion is.

[0014]

[0015] m=1-4; x=5-8

[0016] Where, ∑Ir[Apt+mL] x- Represents the sum of the relative abundances of aptamer-target complex ions, ∑Ir[Apt] x- represents the sum of the relative abundances of free aptamer ions; m represents the number of target molecules bound by the aptamer; and x represents the charge number of the aptamer and complex ion peaks.

[0017] IRa=A 1 +A 2 / (1+exp((EE 1 / 2 ) / A 3 )) (2).

[0018] Furthermore, in step (2), the nanometer-sized spray needle used is a borosilicate glass emitter spray needle (BG12-69-2-CE-5, ThermoFisher Scientific) supporting the nano-electrospray ionization source, with a length of 2 cm, an outer diameter of 1.2 mm, an inner diameter of 0.94 mm, and a needle tip inner diameter of 2 μm.

[0019] Furthermore, in step (1), the selected aptamer is named ABA, and the nucleotide sequence of ABA is shown in SEQ ID No: 1. In step (2), the concentration of the aptamer in the complex is 8-15 μmol / L.

[0020] SEQ ID No: 1: ACCTGGGGGAGTATTGCGGAGGAAGGT.

[0021] Furthermore, in step (1), the small molecule target is adenosine; and in step (2), the final concentration of the small molecule target in the complex is 80-150 μmol / L.

[0022] Furthermore, in step (1), the pH of the ammonium acetate buffer is 6.8-7.4, and the concentration of the ammonium acetate buffer in the complex is 10-100 mmol / L.

[0023] Furthermore, in step (2), the concentration ratio of the aptamer to the target molecule in the complex is 1:10.

[0024] Furthermore, in step (2), the primary mass spectrometry analysis conditions are: ion source: electrospray ion source; scanning in negative ion mode, electrospray voltage: -1500 V; ion transfer tube temperature: 300° C.; primary mass spectrometry resolution: 120,000; ion optical radio frequency voltage (RF value): 80%; primary maximum injection time: 100 ms; Normalized AGC Target: 100%.

[0025] Furthermore, in step (3), the tandem mass spectrometry analysis conditions are: secondary mass spectrometry resolution: 120000; secondary maximum injection time: 100ms; NormalizedAGC Target: 100%; ion optics radio frequency voltage RF value: 80%; MS 2 Dissociation mode: high energy collision dissociation, collision energy: 0%~6%.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention discloses a non-denaturing mass spectrometry detection method for determining the interaction between an aptamer and a small molecule target, which overcomes the problems of time-consuming, labor-intensive, and large sample consumption in other detection methods. Compared with a conventional electrospray ion source, the narrow tip diameter spray needle in this method not only effectively overcomes the problems of low resolution of low-abundance complex signals and wide spectral peaks caused by severe salt ion internalization effects in previous nucleic acid mass spectrometry analysis, but also has an injection flow rate of only 20-80 nL / min, a small sample consumption, improved signal intensity, and a stable signal. Figure 4 This is the spectrum of the primary mass spectrometry analysis of the complex of the aptamer ABA and the target adenosine in Example 1 when the narrow tip diameter spray needle mentioned in the method is not used. The signal resolution is low, the detectable charge range is reduced, and the strong salt ion internalization effect leads to a wider spectral peak and a reduced signal-to-noise ratio. On the other hand, the non-denaturing mass spectrometry method retains the structural and functional characteristics of the aptamer and its complex to a greater extent. The present invention can also be used to study the interaction between other aptamers and small molecule targets, and can be further extended to the study of the interaction between different hosts and guests. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the primary mass spectrum of the mixed solution of aptamer ABA and small molecule target adenosine in Example 1;

[0029] Figure 2 The Boltzmann fitting diagram of the IRa value and HCD energy of the 7-charge 1:1 complex ion of the original sequence ABA and the small molecule target adenosine in Example 2;

[0030] Figure 3 The Boltzmann fitting diagram of IRa value and HCD energy of 7-charge 1:1 complex ion of optimized sequence and small molecule target adenosine in Example 2;

[0031] Figure 4 This is the primary mass spectrum of the mixed solution of aptamer ABA and small molecule target adenosine when the spray needle is not used in Example 3;

[0032] Figure 5 This is the primary mass spectrum of the mixed solution of aptamer ABA and small molecule target adenosine in Example 4 under high concentration buffer (100 mmol / L). DETAILED DESCRIPTION

[0033] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] Example 1

[0035] Adenosine stock solution (concentration of 2.0 mmol / L) and aptamer ABA stock solution (concentration of 1321 μmol / L) were added to 20 mmol / L NH4OH at pH 7.4 at a concentration ratio of 10:1. 4 The samples were mixed evenly in OAc buffer, and the final concentration of adenosine in the sample was 100 μmol / L, and the final concentration of the aptamer was 10 μmol / L. The mixed solution was fully vortexed and incubated at room temperature for 30 min to ensure equilibrium to obtain a complex. The complex was subjected to primary mass spectrometry analysis under the following experimental conditions: negative ion scanning mode, electrospray voltage: -1500 V; ion transfer tube temperature: 300 ° C; primary mass spectrometry resolution: 120000; ion optical radio frequency voltage (RF value): 80%; primary maximum injection time: 100 ms; Normalized AGC Target: 100%.

[0036] The nucleotide sequence of ABA is shown in SEQ ID No: 1, SEQ ID No: 1: ACCTGGGGGAGTATTGCGGAGGAAGGT.

[0037] (2) Data processing: The experiment was repeated three times according to the above example. The raw mass spectrometry data was collected using Xcalibur software and processed using Origin 2024. The results are shown in Figure 2. Figure 1 As shown in the figure: within the mass spectrometry scanning range (m / z = 1000-2000), the aptamer was detected to have ion peaks with charge distribution of 8- to 5- (m / z are 1059.68, 1211.06, 1413.07, 1695.49, respectively), among which the ABA ion peak with charge 6- was the base peak; the binding stoichiometric ratio of the aptamer to adenosine was mainly 1:1, with charge distribution of 8- to 5- (m / z are 1093. 06, 1249.21, 1457.59, 1748.90), with relative abundances of 2.12%, 6.23%, 26.97%, 8.85%, respectively; at the same time, there are complex ion peaks with charge distribution of 7-~5- and binding stoichiometry of 1:2 (m / z are 1287.37, 1502.10, 1802.32, respectively), with relative abundances of 4.17%, 21.33%, 4.93%, respectively.

[0038] Example 2

[0039] (1) The sample is the same as the complex of aptamer ABA and small molecule target adenosine in Example 1. The stability of the complex ion was analyzed using tandem mass spectrometry mode: the complex ion with a stoichiometric ratio of 7 charges of 1:1 (m / z=1249.21) was used as the parent ion, the dissociation mode was high-energy collision dissociation, and the energy value was gradually increased from 0 until the relative signal intensity of the parent ion was less than 10%. In order to compare and illustrate the stability of the complex ion, a structurally optimized aptamer (SEQ ID No: 2: ACCTGGGGGAGTGATTCGCGGAGGAAGGT) was used as a control, and the stability of the complex ion formed by it and adenosine molecules was analyzed according to the same research method: the parent ion was still a 1:1 complex ion with 7 charges (m / z=1343.05). The specific conditions were: secondary mass spectrometry resolution: 120000; secondary maximum injection time: 100ms; ion optical radio frequency voltage (RF value): 80%; NormalizedAGC Target: 100%.

[0040] (2) Data processing: The mass spectrum at each energy value was scanned three times, and Xcalibur software was used for data acquisition and processing. The signal intensity of the parent ion and fragment ion was extracted, and the IRa value of the complex ion was calculated. The IRa value obtained from the three parallel experiments was averaged as the final result, and the IRa values ​​of the binding peaks at a series of different energy values ​​were obtained. The data was imported into Origin 2024, and Boltzmann nonlinear fitting was performed to obtain the dissociation curve of the complex. From the fitting results, the E values ​​of the complex ions formed by the original sequence, the structure-optimized sequence, and the small molecule target adenosine were obtained. 1 / 2 The fitting results are shown in Figure 2 , 3 The results showed that the E of the complex ion formed by the original sequence ABA and adenosine 1 / 2 =1.31%, the E of the complex ion formed by the optimized sequence and adenosine 1 / 2 =1.84%, indicating that the complex formed by the aptamer sequence using the structure optimization strategy and adenosine is more stable, which is consistent with the results obtained by the researchers through affinity capillary electrophoresis.

[0041] Example 3

[0042] Note: This example can be used as a comparative example in which the narrow tip diameter spray needle mentioned in the method is not used.

[0043] (1) The sample is the same as the complex of aptamer ABA and small molecule target adenosine in Example 1. The complex is subjected to primary mass spectrometry analysis using a common ESI injection needle (model OPTON-30694), and other experimental conditions are consistent with those in Example 1.

[0044] (2) Data processing: The experiment was repeated three times according to the above example. The raw mass spectrometry data was collected using Xcalibur software and processed using Origin 2024. The results are shown in Figure 2. Figure 4As shown: within the mass spectrometry scanning range (m / z=1000-2000), ion peaks with charge distribution of 7- to 5- (m / z are 1211.06, 1413.07, and 1695.89, respectively) were detected for the aptamer, among which the ABA ion peak with charge 6- was the base peak; the binding stoichiometric ratio of the aptamer to adenosine was mainly 1:1, with charge distribution of 7- to 5- (m / z are 1249.21, 1457.75, and 1749.31, respectively), and the relative abundances were 3.54%, 25.62%, and 21.03%, respectively; at the same time, there were complex ion peaks with charge distribution of 6- and 5- with a binding stoichiometric ratio of 1:2 (m / z are 1508.43 and 1810.52, respectively), and the relative abundances were 20.41% and 19.42%, respectively. According to the experimental spectrum, in this embodiment as a comparative example, when a spray needle with a narrow tip diameter is not used, the signal resolution is low, the signal intensity decreases, the detectable charge range is reduced, and the strong salt ion internalization effect causes the spectral peak to be wider and the signal-to-noise ratio to be reduced.

[0045] Example 4

[0046] Note: This example is a comparative example supplemented with respect to the important parameter of this experiment, namely, the concentration of the buffer solution. One of the advantages of the nanometer-sized electrospray emitting spray needle in this patent is that even in a high concentration of a non-volatile salt sample solution, it can still reduce the adducts and ion clusters formed by the complex, thereby obtaining a spectrum with complete binding information and stable signals.

[0047] (1) The sample is the same as the complex of the aptamer ABA and the small molecule target adenosine in Example 1, wherein the buffer is 100 mmol / L NH 4 OAc solution. Other experimental conditions are consistent with those in Example 1.

[0048] (2) Data processing: The experiment was repeated three times according to the above example. The raw mass spectrometry data was collected using Xcalibur software and processed using Origin 2024. The results are shown in Figure 2. Figure 5As shown in the figure: within the mass spectrometry scanning range (m / z = 1000-2000), the aptamer was detected to have ion peaks with charge distribution of 8- to 5- (m / z are 1059.55, 1211.06, 1413.07, and 1696.08, respectively), among which the ABA ion peak with charge 7- was the base peak; the aptamer and adenosine formed a complex ion with a binding stoichiometric ratio of 1:1, with charge distribution of 8- to 5- (m / z are 1093.18, 12 49.21, 1457.58, 1749.30), with relative abundances of 6.86%, 27.66%, 54.83%, 8.47%, respectively; at the same time, there were complex ion peaks with charge distribution of 8- to 5- and binding stoichiometry of 1:2 (m / z were 1126.32, 1287.51, 1508.59, 1810.51, respectively), with relative abundances of 7.80%, 30.12%, 75.42%, 9.55%, respectively.

[0049] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device.

[0050] It should be noted that the above content only illustrates the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications all fall within the protection scope of the claims of the present invention.

Claims

1. A non-denaturing mass spectrometry method for determining the interaction between an aptamer and a small molecule target, characterized in that: The following steps are involved: (1) preparing aptamer aqueous solution, small molecule target stock solution, and ammonium acetate buffer; (2) adding the small molecule target stock solution and the aptamer aqueous solution to an ammonium acetate buffer solution and mixing them evenly, and incubating them for 30 minutes to obtain a complex; performing primary mass spectrometry analysis on the binding sample using a nano-sized spray to obtain a primary spectrum of the interaction between the aptamer and the target molecule, and calculating the binding stoichiometry of the two based on the charge number and m / z value of the signal peak; (3) Using tandem mass spectrometry mode, the complex ion formed by the aptamer and the target molecule with a binding stoichiometric ratio of 1:2 is used as the parent ion, and a series of energy values ​​(E) are applied to the parent ion using the high-energy collision dissociation technology of mass spectrometry. The relative signal intensity of the parent ion and the fragment ion changes with the energy value during this process. A parameter IRa is introduced here, which is defined as the ratio of the complex ion formed by the aptamer and the target molecule to the total amount of all complexed and free aptamers, as shown in formula (1). The corresponding IRa value is obtained at a specific fragmentation energy value, and the obtained set of data is subjected to Boltzmann nonlinear fitting, as shown in formula (2), to obtain the dissociation curve of the complex, and then the corresponding fragmentation energy (E) when the IRa value drops to half is obtained. 1 / 2 ). Where, ∑Ir[Apt+mL] x- Represents the sum of the relative abundances of aptamer-target complex ions, ∑Ir[Apt] x- represents the sum of the relative abundances of free aptamer ions; m represents the number of target molecules bound by the aptamer, and x represents the charge number of the aptamer and complex ion peaks; <h2 style=";text-align:left;direction:ltr">IRa = A1 + A2 / (1 + exp ((EE<h2 style=";text-align:left;direction:ltr"> 1 / 2 <h2 style=";text-align:left;direction:ltr"> ) / A3)) (2).

2. The non-denaturing mass spectrometry detection method for determining the interaction between an aptamer and a small molecule target according to claim 1, characterized in that: In step (2), the nanometer-sized spray needle used is a borosilicate glass emitter spray needle supporting a nano-electrospray ionization source, with a length of 2 cm, an outer diameter of 1.2 mm, an inner diameter of 0.94 mm, and a needle tip inner diameter of 2 μm.

3. The non-denaturing mass spectrometry detection method for determining the interaction between an aptamer and a small molecule target according to claim 1, characterized in that: In step (1), the selected aptamer is ABA, the nucleotide sequence of which is shown in SEQ ID No:

1. In step (2), the concentration of the aptamer in the complex is 8-15 μmol / L.

4. The non-denaturing mass spectrometry detection method for determining the interaction between an aptamer and a small molecule target according to claim 1, characterized in that: In step (1), the small molecule target is adenosine; in step (2), the final concentration of the small molecule target in the complex is 80-150 μmol / L.

5. The non-denaturing mass spectrometry detection method for determining the interaction between an aptamer and a small molecule target according to claim 1, characterized in that: In step (2), the pH of the ammonium acetate buffer is 6.8-7.4, and the concentration of the ammonium acetate buffer in the complex is 10-100 mmol / L.

6. The non-denaturing mass spectrometry detection method for determining the interaction between an aptamer and a small molecule target according to claim 1, characterized in that: In step (2), the concentration ratio of the aptamer to the target molecule in the complex is 1:

10.

7. The non-denaturing mass spectrometry detection method for determining the interaction between an aptamer and a small molecule target according to claim 1, characterized in that: In step (2), the primary mass spectrometry analysis conditions are: ion source: electrospray ion source; scanning in negative ion mode, electrospray voltage: -1500V; ion transfer tube temperature: 300°C; primary mass spectrometry resolution: 120000; ion optical radio frequency voltage (RF value): 80%; primary maximum injection time: 100ms; NormalizedAGC Target: 100%.

8. The non-denaturing mass spectrometry detection method for determining the interaction between an aptamer and a small molecule target according to claim 1, characterized in that: In step (3), the tandem mass spectrometry analysis conditions are: secondary mass spectrometry resolution: 120000; secondary maximum injection time: 100ms; NormalizedAGC Target: 100%; ion optics radio frequency voltage RF value: 80%; MS 2 Dissociation mode: high energy collision dissociation, collision energy: 0%~6%.

Images