Nucleic acid aptamer drug conjugate, pharmaceutical composition and application of nucleic acid aptamer drug conjugate

Abstract

The invention belongs to the field of medicines, and discloses a nucleic acid aptamer medicine conjugate, a medicine composition and application of the nucleic acid aptamer medicine conjugate. The nucleic acid aptamer drug conjugate comprises a nucleic acid aptamer of a targeted hepatocyte growth factor receptor, a linking group and a drug molecule group which are connected in sequence, the linking group is shown as a formula (I):-L3-(L2) x-L1-, and x is 0 or 1; in the formula (I), L1 is selected from maleimide residues, L2 is selected from dipeptide residues such as valine-citrulline residues or tetrapeptide residues such as glycine-glycine-phenylalanine-glycine residues, and L3 is selected from carboxyl residues, carboxyethyl residues and the like. The drug molecule group is selected from: a drug molecule group having a modification residue linked to L3. The nucleic acid aptamer drug conjugate disclosed by the invention is relatively good in stability and relatively good in targeting property, and proliferation of a c-Met positive cell line can be specifically inhibited.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to a Chinese patent application filed on October 27, 2023, with application number 202311415830.6 and titled “A Nucleic Acid Aptamer-Drug Conjugate, a Pharmaceutical Composition and Uses Thereof”. Technical Field

[0003] The present invention relates to the field of nucleic acid aptamer drug conjugates, and in particular to a nucleic acid aptamer drug conjugate and an application thereof. Background Art

[0004] c-Met (cellular-Mesenchymal epithelial Transition factor) is a proto-oncogene (Edakμni G, Sasatomi E, Satoh T, et al. Expression of the hepatocyte growth factor / c-Met pathway is increased at the cancer front in breast carcinoma. [J]. Pathology International, 2010, 51(3): 172-178), located on the long arm of human chromosome 7 (7q31), with a size of more than 120 kb, encoding a c-Met protein precursor with a molecular weight of about 150 kDa. The c-Met protein precursor undergoes local glycosylation to generate a 170 kDa glycoprotein, which is further cleaved into two subunits with molecular weights of 50 kDa and 140 kDa, respectively, which are connected by disulfide bonds to form a mature c-Met protein receptor. The transcriptional and translational product of c-Met protein receptor is hepatocyte growth factor receptor, which is consistent with HGF (Hepatocyte Growth Factor receptor). Its precursor is a single chain, which is broken into α chain and β chain after various modifications and connected by disulfide bonds. The c-Met protein receptor is mainly divided into two parts on the cell: intracellular and extracellular. The extracellular region of the β chain includes SD (Sema Domain) region, PSID (Plexin-Semaphorin-Integrin) region and IPTD (Immμnoglobulin-like regions in Plexins and Transcription factors) region, and the intracellular region mainly includes JD (Juxtamembrane Domain) and TKCD.

[0005] c-Met is a HGF receptor protein. When HGF binds to c-Met, the structure of c-Met changes, activating intracellular protein tyrosine kinase, leading to the phosphorylation of its own structure, mainly phosphorylating Try1235 and Try1234 sites. After c-Met is activated, it leads to the phosphorylation of Try1349 and Try1356 at the end of the β chain. When HGF binds to c-Met, multiple signaling pathways are triggered: first, the Ras-Rac signaling pathway leads to the movement of the cytoskeleton. Second, the Ras-MAPK cascade promotes cell division and differentiation; third, the PI3K-FAK signaling pathway promotes cell migration and invasion; fourth, the PI3K-AKT signaling pathway promotes cell survival. In summary, the HGF / c-Met signaling pathway promotes the growth and migration of tumor cells.

[0006] In vivo, c-Met is a tyrosine kinase receptor on the cell membrane, which is abnormally overexpressed in many tumors and is one of the important targets for tumor treatment. It is expressed in lung cancer, gastric cancer, head and neck squamous cell carcinoma, hypopharyngeal cancer, renal cell carcinoma, colorectal cancer, ovarian cancer, liver cancer, breast cancer, bladder cancer, and non-small cell carcinoma. The high expression of c-Met in tumor cells and the low expression in normal cells make c-Met an excellent target for targeted therapy.

[0007] Currently, the c-Met-targeting biological drugs in the research or clinical stage are mainly monoclonal antibodies and antibody drug conjugates (ADCs). However, due to the complexity of the c-Met signaling pathway and other reasons, many previous clinical trials of c-Met-specific targeted inhibitors have ended in failure. Pharmaceutical companies in the industry have turned to developing improved drugs of c-Met monoclonal antibodies. This type of antibody-drug conjugate combines the specific recognition of c-Met antibodies and the killing effect of small molecule toxins, and plays a tumor-killing role while efficiently targeting. However, antibody-drug conjugates have defects such as large antibody molecular weight, poor tissue penetration, large batch-to-batch differences, immunogenicity, and high preparation costs.

[0008] In view of this, it is urgent to provide a new type of therapeutic drug. This patent provides a nucleic acid aptamer drug conjugate, which not only has high activity and targeting, but also has low cytotoxicity and precise drug release function.

[0009] Aptamer-Drug Conjugate (ApDC) is a type of biological drug that connects a biologically active drug (Drug) and an aptamer (Aptamer) through a chemical linker (Linker). Aptamer-drug conjugates, similar to antibody-drug conjugates, bring small molecule anti-tumor drugs to the tumor site to achieve targeted therapy. Compared with commonly used targeted molecular antibodies, aptamers have more advantages, such as not being restricted by immune conditions and immunogenicity, being able to be artificially synthesized in vitro, being simple and fast to prepare, being reversible in denaturation and renaturation, being modifiable and easy to store for a long time and transport at room temperature. More importantly, the target molecules of aptamers are more extensive, and can be proteins, nucleic acids, small peptides, amino acids, organic matter, and even metal ions. Aptamers also have the following advantages, such as: stable chemical properties, no reports of immunogenicity or toxicity, high affinity, strong specificity, and easy to modify. These characteristics make aptamers widely used in the field of biomedical research and become an indispensable and powerful tool. Summary of the invention

[0010] The present invention provides a nucleic acid aptamer drug conjugate targeting hepatocyte growth factor receptor (c-Met) and a preparation method and application thereof. The present invention also provides a pharmaceutical composition comprising the nucleic acid aptamer drug conjugate (ApDC) and their application in preparing drugs for treating or preventing cancer.

[0011] In an embodiment of the present invention, a nucleic acid aptamer drug conjugate targeting hepatocyte growth factor receptor (c-Met) is provided, and the nucleic acid aptamer drug conjugate includes three parts: a nucleic acid aptamer (Aptamer), a drug molecule group (drug), and a linker (Linker). The nucleic acid aptamer targets c-Met high-expressing tumor cells, and the nucleic acid aptamer and the drug molecule group are connected by a linker. The linker is shown in formula (I):

[0012] -L3-(L2) x -L1-, x is 0 or 1; (I)

[0013] Among them, L1 is connected to the nucleic acid aptamer, L3 is connected to the drug molecule group, and when x is 1, the two ends of L2 are connected to L1 and L3 respectively.

[0014] L1 is selected from, a and b are 0 or positive integers, and a and b are not 0 at the same time; this general formula represents the composition of the L1 part of the linking group, and does not represent a fixed arrangement order. For example, "-CH2CH2O-" and "-CH2-" can be interchanged. For another example, the O in "-CH2CH2O-" can replace the position of the connected carbon atom in "-CH2CH2O-".

[0015] Preferably, a and b are 0 or positive integers of 1-20.

[0016] Preferably, the maleimide residue is selected from

[0017] L2 is selected from,

[0018] Dipeptides: valine-citrulline (Val-Cit) residues, valine-alanine (Val-Ala) residues, valine-lysine (Val-Lys) residues, valine-arginine (Val-Arg) residues, phenylalanine-lysine (Phe-Lys) residues, cyclobutane-1,1-dicarboxamide-citrulline (cBu-Cit) residues;

[0019] Tetrapeptides: glycine-glycine-phenylalanine-glycine (GGFG) residues;

[0020] 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (MCC) residue, N-succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylic acid (SMCC) residue, dimethylethylenediamine (DMED) residue, p-aminobenzyl alcohol residue (PAB), p-aminobenzyloxycarbonyl residue (PABC), etc., or a combination of the above residues, such as Lys-SMCC, etc.; or a combination thereof.

[0021] Preferably, L2 is selected from a Val-Cit residue, a Val-Ala residue, a Val-Lys residue, a Val-Arg residue, a Phe-Lys residue, a GGFG residue, an MMC residue, an SMCC residue or a combination of the above residues;

[0022] Preferably, L2 is selected from a Val-Cit residue, a Val-Ala residue, a Val-Lys residue, a GGFG residue, an MMC residue, an SMCC residue or a combination of the above residues;

[0023] Preferably, L2 is selected from a Val-Cit residue, a GGFG residue or a combination of the above residues.

[0024] L3 is selected from the group consisting of a carboxyl residue, a carboxyethyl residue, a hydrazone residue, a disulfide bond residue, a p-aminobenzyl alcohol (PAB) residue, a p-aminobenzyloxycarbonyl (PABC) residue, a monophosphate residue, and the like;

[0025] Preferably, L3 is selected from a carboxyl residue, a carboxyethyl residue, a PAB residue, a PABC residue;

[0026] Preferably, L3 is selected from a carboxyl residue, a carboxyethyl residue, a PABC residue.

[0027] According to one embodiment of the present invention, the linking group includes but is not limited to the following structures:

[0028]

[0029] According to one embodiment of the present invention, the structure of the nucleic acid aptamer drug conjugate is shown in formula (II):

[0030]

[0031] in:

[0032] is a nucleic acid aptamer;

[0033] D is a drug molecule group having a modified residue connected to L3, such as a primary amino residue, a secondary amine residue, etc.; L3-(L2)x-L1 is a connecting group, wherein x is 0 or 1; M is a modified thiol residue on the nucleic acid aptamer; q is the number of connecting groups connected to the nucleic acid aptamer through the modified thiol residue on the nucleic acid aptamer, which is an integer from 1 to 20; L3 is connected to D through the modified residue on the drug molecule group; L1 is connected to the modified thiol residue on the nucleic acid aptamer. The drug molecule group may be the same as the number of modified thiol residues on the nucleic acid aptamer, or may be less than the number of modified thiol residues on the nucleic acid aptamer. According to one embodiment of the present invention, q is the number of thiol residues bound to the connecting group, excluding thiol residues not connected to the connecting group. According to one embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer is selected from the HF3 sequence, and the specific nucleotide sequence of the HF3 sequence is as follows:

[0034] 5'-TTGGAGCAGC GTGGAGGATATGCTTCCGACCGTGTTCGT TTGTTATAAC GCTGCTCC-3' (SEQ ID NO. 1);

[0035] The structure of aptamers and their modified residues determine the targeting and stability of aptamer-drug conjugates.

[0036] When the aptamer is modified by a thiol residue, the thiol residue is selected from -(CH2CH2O) d -(CH2) c -S-, c, d are 0 or positive integers, c and d are not 0 at the same time. This general formula represents the composition of the thiol residue, and does not represent the fixed arrangement order of the parts. For example, "-(CH2CH2O)-" and "-CH2-" can be interchanged. For another example, the O in "-(CH2CH2O)-" can replace the position of the connected carbon atom in "-(CH2CH2O)-".

[0037] Preferably, c and d are positive integers of 1-20.

[0038] Preferably, the sulfhydryl residue is selected from, but not limited to, -(CH2)3-S-, -(CH2)4-S-, -(CH2)5-S-, -(CH2)6-S-, -(CH2CH2O)3-S-, -(CH2CH2O)4-S-, -(CH2CH2O)5-S-, -(CH2CH2O)6-S-, -(CH2CH2O)-(CH2)3-S-, -(CH2CH2O)2-(CH2)5-S-. Particularly preferred are modifications by -(CH2)5-S-, -(CH2)6-S-, (CH2CH2O)5-S-, -(CH2CH2O)6-S-, -(CH2CH2O)-(CH2)3-S-, -(CH2CH2O)2-(CH2)5-S-.

[0039] According to one embodiment of the present invention, in the nucleic acid aptamer sequence, the bases of the nucleotide sequence can be modified by thiol residues, and the modification positions are selected from the 5' end or the 3' end or the middle non-targeted key bases, and the number of modifications is an integer ranging from 1 to 20. The modification sites are preferably the 5' end, the 3' end, and the middle non-targeted key bases.

[0040] The non-targeted key site bases include bases 2-11, 19-25, and 50-57 numbered from the 5' to 3' end. According to one embodiment of the present invention, the drug molecule group is selected from auristatin cytokine molecules, including but not limited to MMAE or MMAF or their derivatives. Alternatively, the drug molecule group is selected from camptothecin cytotoxic molecules, including but not limited to Exatecan, Irinotecan (Irinotecan, CPT-11), or their derivatives DXd; more preferably, the drug molecule group is selected from MMAE and Exatecan.

[0041] According to one embodiment of the present invention, the nucleic acid aptamer drug conjugate is selected from the following compounds:

[0042]

[0043]

[0044] in,

[0045] q is from 1 to 20, a, b, c, d are 0 or positive integers, a and b cannot be 0 at the same time, and c and d cannot be 0 at the same time.

[0046] According to another aspect of the present invention, there is provided a pharmaceutical composition comprising any of the aforementioned nucleic acid aptamer-drug conjugates and a pharmaceutically acceptable carrier.

[0047] According to another aspect of the present invention, there is provided a use of the nucleic acid aptamer drug conjugate and its pharmaceutical composition as described in any of the above in the preparation of a drug for treating a c-Met-mediated disease or condition. The c-Met-mediated disease or condition includes c-Met-positive cancer, and c-Met-positive cancer includes lung cancer, gastric cancer, liver cancer, non-small cell lung cancer, breast cancer, pancreatic cancer, colorectal cancer, papillary renal cell carcinoma, esophageal cancer and brain cancer. Or the c-Met-mediated disease or condition includes solid tumors, such as lung cancer, gastric cancer, non-small cell lung cancer and liver cancer.

[0048] According to another aspect of the present invention, a stereoisomer, a pharmaceutically acceptable salt, a hydrate, a solvate or an isotope compound having a structure of the general formula II is provided, wherein the general formula II is:

[0049]

[0050] The linking group in the embodiments of the present invention has good stability, reduces the release of the drug during delivery to the target (e.g., in the blood), thereby reducing side effects and toxicity. In some specific embodiments, the linking group of the present invention is selected from a cleavable linker, such as a disulfide-based linker (which selectively breaks in tumor cells with a higher concentration of sulfhydryl groups), a peptide linker (which is cleaved by enzymes in tumor cells). BRIEF DESCRIPTION OF THE DRAWINGS

[0051] By reading the following detailed description with reference to the accompanying drawings, the above and other objects, features and advantages of the exemplary embodiments of the present invention will become readily understood. In the accompanying drawings, several embodiments of the present invention are shown in an exemplary and non-limiting manner, and the same or corresponding reference numerals represent the same or corresponding parts, wherein:

[0052] Figure 1 The gel imaging diagram of the stability test of nucleic acid aptamer drug conjugate ApDC-05-1* in 10% fetal bovine serum is shown;

[0053] Figure 2 A grayscale statistical value diagram of the gel imaging image of the stability test of the nucleic acid aptamer drug conjugate ApDC-05-1* in 10% fetal bovine serum is shown;

[0054] Figure 3 A schematic diagram showing the dose-effect curve of the cell binding test drug and tumor cell binding level of nucleic acid aptamer drug conjugate ApDC-05-1*;

[0055] Figure 4 A schematic diagram showing the inhibition curve of ApDC-05-1 on MKN45 cell line;

[0056] Figure 5 A schematic diagram showing the inhibition curve of ApDC-05-1 on HT-29 cell line;

[0057] Figure 6 A schematic diagram showing the inhibition curve of ApDC-05-1 on the EBC-1 cell line;

[0058] Figure 7 A schematic diagram showing the inhibition curve of ApDC-05-1 on SNU-5 cell line;

[0059] Figure 8 A schematic diagram showing the inhibition curve of ApDC-05-1 on the MV-4-11 cell line is shown. DETAILED DESCRIPTION

[0060] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0061] It should be understood that the terms "include" and "comprises" used in the description and claims of the present invention indicate the presence of described features, wholes, steps, operations, elements and / or components, but do not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or collections thereof.

[0062] It should also be understood that the terms used in this specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. As used in the specification of the present invention and the claims, the singular forms of "a", "an" and "the" are intended to include the plural forms unless the context clearly indicates otherwise. It should also be further understood that the term "and / or" used in the specification of the present invention and the claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0063] In order to make the present invention more easily understood, some technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in the present invention, all other technical and scientific terms used in the present invention have the meanings commonly understood by those skilled in the art to which the present invention belongs.

[0064] The abbreviations "TBTU" refer to O-benzotriazole-N,N,N',N'-tetramethyluronium tetrafluoroborate, a coupling reagent; "DIPEA" refers to N,N-diisopropylethylamine; "NPC" refers to di(p-nitrobenzene) carbonate; "DMF" refers to N,N-dimethylformamide; "Et3N" refers to triethylamine; "TCEP" refers to tri-(2-carboxyethyl)phosphine, a very effective thiol reducing agent, widely used as a quantitative reducing agent for disulfide bonds in protein chemistry and proteomics research; "DMSO" refers to dimethyl sulfoxide; "PBS" refers to phosphate buffered saline; "DBCO" refers to benzocyclooctyne; "HOBt" refers to 1-hydroxybenzotriazole; "PHAb" refers to phage antibody; "Exatecanmesylate", "Dx8951f", "Exatecan MsOH" refer to the drug molecule group isotecan mesylate; HF3 refers to the nucleic acid aptamer sequence SEQ ID NO.1; "OD" is Optical Density is the abbreviation of optical density, which indicates the optical density absorbed by the detected object, and refers to the solution with an absorbance of 1A at a wavelength of 260nm in a 1ml standard cuvette with a 1cm optical path.

[0065] The cell lines used in the present invention are all c-Met high-expressing cells, NCI-H1650 refers to human non-small cell lung cancer cells, MKN45 refers to human gastric cancer cell semi-adherent cell line, SNU-5 refers to human gastric cancer adherent cell line, Hs746T refers to human gastric cancer cell line, HT-29 refers to human colorectal adenocarcinoma cells, and EBC-1 refers to human lung cancer squamous cell carcinoma cell line.

[0066] The term "c-Met" or "c-Met receptor" refers to the receptor tyrosine kinase that binds hepatocyte growth factor (HGF).

[0067] As used in the present invention, "nucleic acid aptamer conjugate" or "nucleic acid aptamer unit" includes any part of the nucleic acid aptamer conjugate structure within its scope. In some embodiments, the linking group is covalently linked to the sulfur atom of the nucleic acid aptamer.

[0068] The term "non-targeted key site bases" used in the present invention refers to the numbering from 5' to 3' ends, and bases at positions 2-11, 19-25, and 50-57 are defined as "non-targeted key site bases", which are bases that do not affect the targeting function and can be structurally modified.

[0069] The term "linking group" used in the present invention refers to the part of the aptamer drug conjugate (i.e., ApDC) that connects the aptamer to the drug. It can be cleavable or non-cleavable. The cleavable linking group (i.e., a cleavable linker or a biodegradable linker) can be cleaved in or on the target cell to release the drug.

[0070] The term "drug-linker" used in the present invention refers to the part of ApDC that connects the "linker" to the "drug", that is, the part of the nucleic acid aptamer modified with the thiol residue removed from ApDC.

[0071] The nucleic acid aptamers used in the nucleic acid aptamer drug conjugates in the embodiments of the present invention include, but are not limited to, antibodies against cell surface receptors and tumor-associated antigens. Such tumor-associated antigens are well known in the industry and can be prepared by nucleic acid aptamer preparation methods and information well known in the industry.

[0072] The specific embodiments of the present invention are described in detail below.

[0073] General method for the synthesis of "drug-linker":

[0074] Weigh a certain amount of a reagent containing a maleimide residue group, TBTU, and DIPEA (molar ratio 1:1:2) and dissolve them in DMF (N,N-dimethylformamide) to completely dissolve them, and stir them magnetically at a temperature of 5-15° C. to obtain a clear first solution;

[0075] Weigh a certain amount of drug molecules, add them to a certain amount of DMF, stir them magnetically at a temperature of 5-15° C. to form a turbid solution, add a certain amount of triethylamine to the turbid solution according to a molar ratio of drug molecules to triethylamine of 1:1.12, and obtain a clear second solution;

[0076] The first solution was slowly added dropwise to the second solution, and the mixture was stirred magnetically at 5-15°C for 1h-2h. The reaction was determined to be complete by TLC (thin layer chromatography) detection.

[0077] After the reaction is completed, the mixture is extracted with purified water and dichloromethane, the organic phase solution is taken, the mixture is extracted with purified water again, the organic phase solution is taken again, anhydrous sodium sulfate is added for drying, the filtrate is filtered, and the crude product is obtained by vacuum distillation. The crude product is purified by silica gel column chromatography to obtain the product "drug-linker".

[0078] The synthesis of aptamer-drug conjugates adopts the general conjugation method:

[0079] The reducing agent is prepared with purified water as follows: 1-20mM TCEP (Tris-2-Carboxyethyl-Phosphine). The amount of reducing agent can be added within a certain concentration range according to the required coupling rate. TCEP is mixed with a certain concentration (e.g., 5-30mg / mL) of nucleic acid aptamer at a certain volume ratio (e.g., 1:20). The final molar ratio of TCEP to nucleic acid aptamer is 1:1-10:1. The reaction is stirred at 25°C for 1h-5h. The nucleic acid aptamer after TCEP reduction can be directly coupled.

[0080] A certain concentration (20 mM) of "drug-linker" was prepared and dissolved in DMSO (Dimethyl Sulfoxide). According to the molar ratio of "drug-linker" to nucleic acid aptamer of 2:1-20:1, the "drug-linker" was added to the nucleic acid aptamer solution after TCEP reduction, and the reaction was stirred at 25°C for 4h-24h. After the reaction, the nucleic acid aptamer drug conjugate was obtained by purification by preparative HPLC and concentration and drying by low-temperature centrifugal concentrator.

[0081] According to one embodiment of the present invention, the compound comprises (CH2) a -(CH2CH2O) b The general synthetic route of ApDC-01 is as follows:

[0082]

[0083] In the above formula, the compound Mal-(CH2) a -(CH2CH2O) b -COOH reacts with the drug molecule Exatecan mesylate to obtain L-01-Exatecan, wherein a and b are 0 or positive integers, but a and b are not 0 at the same time. Then, L-01-Exatecan is coupled with a nucleic acid aptamer to obtain ApDC-01 with a stable linker structure, and q is the number of thiol residues modified on the nucleic acid aptamer.

[0084] Example 1

[0085] Synthesis of ApDC-01-1:

[0086] The first step is the synthesis of the drug-linker group L-01-1-Exatecan:

[0087]

[0088] Weigh 30 mg (0.14 mmol) of 6-maleimidocaproic acid (Mal-(CH2)5-COOH), add 5 mL of DMF to completely dissolve it, then add 54 mg (0.14 mmol) of TBTU and 35 mg (0.27 mmol) of DIPEA, control the temperature in the range of 5-15°C with magnetic stirring, and obtain a clear first solution;

[0089] Weigh 49 mg (0.092 mmol) of Exatecan mesylate, add 5 mL of DMF, control the temperature in the range of 5-15°C and stir magnetically until the solution becomes turbid, then add 0.015 mL (0.11 mmol) of triethylamine to obtain a clear second solution;

[0090] The first solution was slowly added dropwise to the second solution, the temperature was controlled within the range of 5-15°C with magnetic stirring, and the reaction was monitored by TLC tracking until the reaction was completed. Then purified water was added, extracted once with dichloromethane to obtain an organic phase solution, and then extracted twice with purified water to obtain an organic phase solution, anhydrous sodium sulfate was added to dry, and the filtrate was filtered to obtain a filtrate, and the filtrate was distilled under reduced pressure to obtain a yellow oil. Purification by silica gel column chromatography gave 65 mg of a light yellow solid powder, which was the "drug-linker" L-01-1-Exatecan, with a yield of 73.4% and MS of 630.6.

[0091] Step 2: Synthesis of nucleic acid aptamer conjugate ApDC-01-1:

[0092]

[0093] Take 3OD (102μg, 5.56nmol) of thiol-modified nucleic acid aptamer [HS-(CH2)6]2-HF3, add 40μL PBS to dissolve; then add 2.6μL 10mM TCEP aqueous solution, control the temperature to 25℃, and shake on a mixer for 3h; add 2.7μL 20mM L-01-1-Exatecan DMSO solution, shake on a mixer at 25℃ for 5h. Purify by preparative HPLC, collect the target product solution, centrifuge at low temperature, concentrate and dry, and obtain 100μg of white solid powder, namely ApDC-01-1, with a yield of 91.8% and MS of 19548.3.

[0094] Example 2

[0095] Synthesis of ApDC-01-2:

[0096] Step 1: Synthesis of the “drug-linker” L-01-2-Exatecan

[0097]

[0098] Weigh 44 mg (0.14 mmol) of Mal-(CH2)2-(CH2CH2O)3-COOH, add 5 mL of DMF to completely dissolve it, then add 54 mg (0.14 mmol) of TBTU and 35 mg (0.27 mmol) of DIPEA, control the temperature in the range of 5-15°C with magnetic stirring to obtain a clear first solution;

[0099] Weigh 49 mg (0.092 mmol) of Exatecan mesylate, add 5 mL of DMF, control the temperature in the range of 5-15°C and stir magnetically until the solution becomes turbid, then add 0.015 mL (0.11 mmol) of triethylamine to obtain a clear second solution;

[0100] The first solution was slowly added dropwise to the second solution, the temperature was controlled within the range of 5-15°C with magnetic stirring, and the reaction was monitored by TLC tracking until the reaction was completed, then purified water was added, and the mixture was extracted once with dichloromethane to obtain an organic phase solution, and then extracted twice with purified water to obtain an organic phase solution, and anhydrous sodium sulfate was added to dry, and the filtrate was filtered to obtain a yellow solution, and the solution was distilled under reduced pressure. Purification by silica gel column chromatography gave 86 mg of a light yellow solid powder, namely L-01-2-Exatecan, 84.1%, MS: 732.8.

[0101] Step 2: Synthesis of nucleic acid aptamer conjugate ApDC-01-2

[0102]

[0103] Take 3OD (102μg, 5.56nmol) of thiol-modified nucleic acid aptamer [HS-(CH2CH2O)6]2-HF3, add 40μL PBS to dissolve; then add 2.6μL 10mM TCEP aqueous solution, shake on a mixer at 25°C for 3h. Add 2.7μL 20mM L-01-2-Exatecan DMSO solution, shake on a mixer at 25°C for 5h. HPLC purification, collect the target product solution, centrifuge at low temperature, concentrate and dry, and obtain 90μg of white solid powder, namely ApDC-01-2, with a yield of 81.7%, MS: 19752.0.

[0104] According to one embodiment of the present invention, the general synthetic route of ApDC-02 comprising a linking group GGFG residue (Glycyn-Glycyn-Phenylalanyn-Glycyn) is as follows:

[0105]

[0106] In the above-mentioned general synthesis route of ApDC-02, exatecan mesylate (DX8951f) is used as the starting material, and the compound L-02-DXd is obtained through a two-step amide reaction; then the traditional cysteine ​​coupling strategy is adopted, TCEP is used to open the interchain disulfide bond, and L-02-DXd is coupled with the nucleic acid aptamer to obtain ApDC-02.

[0107] Example 3

[0108] Synthesis of ApDC-02-1:

[0109] The first step is the synthesis of the "drug-linker" L-02-1-DXd:

[0110]

[0111] The synthesis of the “drug-linker” L-02-1-DXd is the same as in Example 1 in terms of steps and conditions, and will not be described in detail here.

[0112] Step 2: Synthesis of ApDC-02-1-DXd, a nucleic acid aptamer conjugate:

[0113]

[0114] Take 3OD (102μg, 5.56nmol) of thiol-modified nucleic acid aptamer [HS-(CH2)6]2-HF3, add 40μL PBS to dissolve; then add 2.6μL 10mM TCEP aqueous solution, shake on a mixer at 25℃ for 3h; add 2.7μL 20mM L-02-1-DXd DMSO solution, shake on a mixer at 25℃ for 5h. Purify by preparative HPLC, collect the target product solution, centrifuge at low temperature, concentrate and dry, and obtain 96μg of white solid powder, namely ApDC-02-1, with a yield of 84.6% and MS of 20355.1.

[0115] Example 4

[0116] Synthesis of ApDC-02-2:

[0117] The first step, "Synthesis of drug-linker L-02-2-DXd:

[0118]

[0119] The synthesis of the “drug-linker” L-02-2-DXd is the same as in Example 1 in terms of steps and conditions, and will not be described in detail here.

[0120] Step 2: Synthesis of nucleic acid aptamer conjugate ApDC-02-2

[0121]

[0122] Take 3OD (102μg, 5.56nmol) of thiol-modified nucleic acid aptamer [HS-(CH2)6]2-HF3, add 40μL PBS to dissolve; then add 2.6μL 10mM TCEP aqueous solution, shake on a mixer at 25℃ for 3h; add 2.7μL 20mM L-02-2-DXd DMSO solution, shake on a mixer at 25℃ for 5h. Purify by preparative HPLC, collect the target product solution, centrifuge at low temperature, concentrate and dry, and obtain 100μg of white solid powder, which is compound ApDC-02-2, with a yield of 87.3% and MS of 20535.3.

[0123] According to one embodiment of the present invention, the general synthetic route of ApDC-03 containing the dipeptide Val-Cit residue is as follows:

[0124]

[0125] Mal-(CH2) a -(CH2CH2O) b -Val-Cit-PAB reacts with bis(p-nitrophenyl) carbonate (NPC) to obtain the "linker" Mal-(CH2) a -(CH2CH2O) b -Val-Cit-PAB-PNP; the "linker" reacts with Exatecan mesylate to obtain L-03-DXd, and finally L-03-DXd is coupled with the nucleic acid aptamer to obtain ApDC-03 with a stable linker structure.

[0126] Example 5

[0127] Synthesis of ApDC-03-1:

[0128] The first step is the synthesis of the "drug-linker" L-03-1-DXd:

[0129]

[0130] Into the reaction bottle, add 4mL DMF, 200mg Mal-(CH2)5-Val-Cit-PAB, stir and dissolve, add 116mg di(p-nitrobenzene) carbonate (NPC) and 45mg DIPEA. React at 20-30℃ for 18h, add 47mg 1-hydroxybenzotriazole (HOBt), 4mL DMF, 167mg Exatecan mesylate, 304μL pyridine and 135mg DIPEA, react at 20-30℃ for 48h, concentrate under reduced pressure, purify by preparative HPLC, and obtain 264mg off-white solid powder, namely compound L-03-1-DXd, yield: 73.1%, MS: 1034.1.

[0131] Step 2: Synthesis of nucleic acid aptamer conjugate ApDC-03-1

[0132]

[0133] Take 3OD (102μg, 5.56nmol) of thiol-modified nucleic acid aptamer [HS-(CH2)6]2-HF3, add 40μL PBS to dissolve; then add 2.6μL 10mM TCEP aqueous solution, shake on a mixer at 25℃ for 3h; add 2.7μL 20mM L-03-1-DXd DMSO solution, shake on a mixer at 25℃ for 5h. Purify by preparative HPLC, collect the target product solution, centrifuge at low temperature, concentrate and dry, and obtain 92μg of white solid powder, which is compound ApDC-03-1, with a yield of 81.0% and MS of 20355.2.

[0134] Example 6

[0135] Synthesis of ApDC-03-2:

[0136] Step 1: Synthesis of the “drug-linker” L-03-2-Exatecan

[0137]

[0138] The synthesis of the “drug-linker” L-03-2-Exatecan was performed in the same steps and under the same conditions as in Example 5 and will not be described in detail here.

[0139] Step 2: Synthesis of ApDC-03-2

[0140]

[0141] Take 3OD (102μg, 5.56nmol) of thiol-modified nucleic acid aptamer [HS-(CH2)6]2-HF3, add 40μL PBS to dissolve; then add 2.6μL 10mM TCEP aqueous solution, shake on a mixer at 25°C for 3h; add 2.7μL 20mM L-03-2-DXd DMSO solution, shake on a mixer at 25°C for 5h. Purify by preparative HPLC, collect the target product solution, centrifuge at low temperature, concentrate and dry, and obtain 87μg of white solid powder, which is compound ApDC-03-2, with a yield of 76.0% and MS of 20535.3.

[0142] According to one embodiment of the present invention, the compound comprises (CH2) a -(CH2CH2O) b The general synthetic route of ApDC-04 with -PABC residues is as follows:

[0143]

[0144] Compound Mal-(CH2) a -(CH2CH2O) b -PAB reacts with NPC to obtain Mal-(CH2) a -(CH2CH2O) b -PAB-PNP, and then react with Exatecan mesylate to obtain L-04-DXd, and finally L-04-DXd is coupled with the nucleic acid aptamer to obtain ApDC-04 with a stable linker structure.

[0145] Example 7

[0146] Synthesis of ApDC-04-1:

[0147] Step 1: Synthesis of the “drug-linker” L-04-1-DXd

[0148]

[0149] Into the reaction bottle, add 4mL DMF, 114mg Mal-(CH2)6-PAB, stir to dissolve, add 116mg NPC and 45mg DIPEA. React at 20-30℃ for 18h, add 47mg HOBt, 4mL DMF, 167mg Exatecan mesylate, 304μL pyridine and 135mg DIPEA, react at 20-30℃ for 48h, concentrate under reduced pressure, purify by preparative HPLC, and obtain 220mg off-white solid powder, i.e. L-04-1-DXd, with a yield of 80.7% and MS of 789.8.

[0150] Step 2: Synthesis of nucleic acid aptamer conjugate ApDC-04-1

[0151]

[0152] Take 3OD (102μg, 5.56nmol) of thiol-modified nucleic acid aptamer [HS-(CH2)6]2-HF3, add 40μL PBS to dissolve; then add 2.6μL 10mM TCEP aqueous solution, shake on a mixer at 25℃ for 3h; add 2.7μL 20mM L-04-1-DXd DMSO solution, shake on a mixer at 25℃ for 5h. Purify by preparative HPLC, collect the target product solution, centrifuge at low temperature, concentrate and dry, and obtain 91μg of white solid powder, namely ApDC-04-1, with a yield of 82.1% and MS of 19866.7.

[0153] Example 8

[0154] Synthesis of ApDC-04-2:

[0155] Step 1: Synthesis of the “drug-linker” L-04-2-DXd

[0156]

[0157] Into the reaction bottle, add 4mL DMF, 165mg Mal-(CH2CH2O)4-PAB, stir to dissolve, add 116mg NPC and 45mg DIPEA. React at 20-30℃ for 18h, add 47mg HOBt, 4mL DMF, 167mg Exatecan mesylate, 304μL pyridine and 135mg DIPEA, react at 20-30℃ for 48h, distill under reduced pressure, purify by preparative HPLC, and obtain 260mg off-white solid powder, i.e. compound L-04-2-DXd, yield: 77.8%, MS: 911.9.

[0158] Step 2: Synthesis of nucleic acid aptamer conjugate ApDC-04-2

[0159]

[0160] Take 3OD (102μg, 5.56nmol) of thiol-modified nucleic acid aptamer [HS-(CH2)6]2-HF3, add 40μL PBS to dissolve; then add 2.6μL 10mM TCEP aqueous solution, shake on a mixer at 25℃ for 3h; add 2.7μL 20mM L-04-2-DXd DMSO solution, shake on a mixer at 25℃ for 5h. Purify by preparative HPLC, collect the target product solution, centrifuge at low temperature, concentrate and dry, and obtain 84μg of white solid powder, namely ApDC-04-2, with a yield of 74.9% and MS of 20110.9.

[0161] According to an embodiment of the present invention, the general synthetic route of ApDC-05 containing Val-Cit dipeptide is as follows:

[0162]

[0163] Mal-(CH2) a -(CH2CH2O) b -Val-Cit-PAB reacts with NPC to obtain Mal-(CH2) a -(CH2CH2O) b -Val-Cit-PAB-PNP, and then react with MMAE to obtain L-05-MMAE, and finally L-05-MMAE is coupled with nucleic acid aptamer to obtain ApDC-05 with a stable linker structure.

[0164] Example 9

[0165] Synthesis of ApDC-05-1:

[0166] Step 1: Synthesis of the “drug-linker” L-05-1-MMAE

[0167]

[0168] 200 mg Mal-(CH2)5-Val-Cit-PAB and 4 mL DMF were added to a three-necked round-bottom flask in sequence, stirred at room temperature until dissolved, and then 117 mg NPC and 45 mg DIPEA were added, and stirred at 20-30°C for 18 h. Then 90 mg DIPEA, 0.3 mL pyridine, 47 mg HOBt and 251 mg MMAE were added to the above reaction solution in sequence, and the reaction was continued at 20-30°C for 48 h. The product was purified by preparative HPLC to obtain 380 mg of off-white solid powder, namely L-05-1-MMAE, with a yield of 82.6% and MS of 1316.6.

[0169] Step 2: Synthesis of nucleic acid aptamer conjugate ApDC-05-1

[0170]

[0171] Take 3OD (102μg, 5.56nmol) of thiol-modified nucleic acid aptamer [HS-(CH2)6]2-HF3, add 40μL PBS to dissolve; then add 2.6μL 10mM TCEP aqueous solution, shake on a mixer at 25℃ for 3h; add 2.7μL 20mM L-05-1-MMAE DMSO solution, shake on a mixer at 25℃ for 5h. Purify by preparative HPLC, collect the target product solution, centrifuge at low temperature, concentrate and dry, and obtain 94μg of white solid powder, namely ApDC-05-1, with a yield of 80.6% and MS of 20920.2.

[0172] Example 10

[0173] Synthesis of ApDC-05-2:

[0174] Step 1: Synthesis of the “drug-linker” L-05-2-MMAE

[0175]

[0176] The synthesis of the “drug-linker” L-05-2-MMAE is the same as in Example 9 in terms of steps and conditions, and will not be described in detail here.

[0177] Step 2: Synthesis of nucleic acid aptamer conjugate ApDC-05-2

[0178]

[0179] Take 3OD (101μg, 5.55nmol) of thiol-modified nucleic acid aptamer [HS-(CH2)5]2-HF3, add 40μL PBS to dissolve; then add 2.6μL 10mM TCEP aqueous solution, shake on a mixer at 25℃ for 3h; add 2.7μL 20mM L-05-2-MMAE DMSO solution, shake on a mixer at 25℃ for 5h. HPLC purification, collect the target product solution, centrifuge at low temperature, concentrate and dry, and obtain 99μg of white solid powder, namely ApDC-05-2, with a yield of 84.2% and MS of 21248.6.

[0180] According to one embodiment of the present invention, the compound involved comprises (CH2) a -(CH2CH2O) b -PAB's general synthesis route for ApDC-06 is as follows:

[0181]

[0182] Mal-(CH2) a -(CH2CH2O) b -PAB reacts with NPC to obtain Mal-(CH2) a -(CH2CH2O) b -PAB-PNP, and then react with MMAE to obtain L-06-MMAE, and finally L-06-MMAE is coupled with the nucleic acid aptamer to obtain ApDC-06 with a stable linker structure.

[0183] Embodiment 11

[0184] Synthesis of ApDC-06-1:

[0185] The first step is the synthesis of the "drug-linker" L-06-1-MMAE:

[0186]

[0187] 110 mg Mal-(CH2)8-PAB and 4 mL DMF were added to a three-necked round-bottom flask in sequence, stirred at room temperature until dissolved, and then 117 mg NPC and 45 mg DIPEA were added, and stirred at 20-30°C for 18 h. Then 90 mg DIPEA, 0.3 mL pyridine, 47 mg HOBt and 251 mg MMAE were added to the above reaction solution in sequence, and the reaction was continued at 20-30°C for 48 h. The product was purified by preparative HPLC to obtain 277 mg of off-white solid powder, namely L-06-1-MMAE, with a yield of 81.9% and MS of 1102.4.

[0188] Step 2: Synthesis of nucleic acid aptamer conjugate ApDC-06-1

[0189]

[0190] Take 3OD (101μg, 5.55nmol) of thiol-modified nucleic acid aptamer [HS-(CH2)5]2-HF3, add 40μL PBS to dissolve; then add 2.6μL 10mM TCEP aqueous solution, shake on a mixer at 25℃ for 3h; add 2.7μL 20mM L-06-1-MMAE DMSO solution, shake on a mixer at 25℃ for 5h. Purify by preparative HPLC, collect the target product solution, centrifuge at low temperature, concentrate and dry, and obtain 90μg of white solid powder, namely ApDC-06-1, with a yield of 79.5% and MS of 20463.8.

[0191] Example 12

[0192] Synthesis of ApDC-06-2:

[0193] The first step is the synthesis of the drug-linker group L-06-2-MMAE:

[0194]

[0195] 120 mg Mal-(CH2CH2O)4-PAB and 4 mL DMF were added to a three-necked round-bottom flask in sequence, stirred at room temperature until dissolved, and then 117 mg NPC and 45 mg DIPEA were added, and stirred at 20-30°C for 18 h. Then 90 mg DIPEA, 0.3 mL pyridine, 47 mg HOBt and 251 mg MMAE were added to the above reaction solution in sequence, and the reaction was continued at 20-30°C for 48 h. The product was purified by preparative HPLC to obtain 230 mg of off-white solid powder, namely L-06-2-MMAE, with a yield of 72.3% and MS of 1194.5.

[0196] Step 2: Synthesis of nucleic acid aptamer conjugate ApDC-06-2

[0197]

[0198] Take 3OD (103μg, 5.56nmol) of thiol-modified nucleic acid aptamer [HS-(CH2)6]4-HF3, add 40μL PBS to dissolve; then add 2.6μL 10mM TCEP aqueous solution, shake on a mixer at 25℃ for 3h; add 2.7μL 20mM L-06-2-MMAE DMSO solution, shake on a mixer at 25℃ for 5h. HPLC purification, collect the target product solution, centrifuge at low temperature, concentrate and dry, and obtain 101μg of white solid powder, namely ApDC-06-2, with a yield of 78.0% and MS of 23327.4.

[0199] Embodiment 13

[0200] Stability of ApDC-05-1* in 10% fetal bovine serum

[0201] The 24-base of the nucleic acid aptamer HF3 was modified with a 6-carboxyfluorescein (6-FAM fluorescein) fluorescent group, and then ApDC-05-1* containing a fluorescent marker was synthesized according to the synthesis method of ApDC-05-1, and a fetal bovine serum stability experiment was performed.

[0202] Prepare a culture medium solution of 1 μM concentration of ApDC-05-1* and 10% fetal bovine serum, incubate at 37°C, take out 10 μL of incubation solution at 0h, 0.5h, 1h, 2h, 4h, 8h, 24h, 48h, and 72h, and immediately add 1 μL of ETA-Na2 (0.5M) mother solution, and prepare another tube of con group, i.e. 1 μM concentration of ApDC-05-1*+PBS solution. Then place the sample in a 95°C metal bath for 10 minutes for denaturation, and place it in a -20°C refrigerator for freezing. After all time samples are prepared, run a 20% urea-polyacrylamide gel imager to take pictures and observe, and use Image J software (a public image processing software for Java developed by the National Institutes of Health) to count the gray value.

[0203] Figure 1 The figure shows the gel imaging of the stability test of nucleic acid aptamer drug conjugate ApDC-05-1* in 10% fetal bovine serum.

[0204] Figure 2 The grayscale statistical value diagram of the gel imaging image of the stability test of the nucleic acid aptamer drug conjugate ApDC-05-1* in 10% fetal bovine serum is shown. The stability results of ApDC-05-1* in 10% FBS are shown in FIG. Figure 1 and Figure 2 As shown, from 0h to 72h, the main band began to degrade slowly over time. Compared with 0h, at 4h, the retention rate of band 1 was about 80%; at 24h, the retention rate of band 1 was about 75%; at 48h, the retention rate of band 1 was about 65%; at 72h, the retention rate of band 1 was about 60%. It can be seen that ApDC-05-1* has good stability in 10% FBS and can exist stably for a long time.

[0205] Embodiment 14

[0206] Cell binding assay of aptamer-drug conjugate (ApDC-05-1*)

[0207] The 24-base of the nucleic acid aptamer HF3 was modified with a 6-carboxyfluorescein (6-FAM fluorescein) fluorescent group, and then ApDC-05-1* containing a fluorescent marker was synthesized according to the synthesis method of ApDC-05-1, and a cell binding experiment was performed.

[0208] Cells were revived and NCI-H1650 (source: Cell Resource Center, Shanghai Institutes for Life Sciences, Chinese Academy of Sciences), MKN45 (source: Cell Resource Center, Institute of Basic Medicine, Chinese Academy of Medical Sciences), SNU-5 (source: Cell Resource Center, Shanghai Institutes for Life Sciences, Chinese Academy of Sciences), Hs746T (source: Cell Resource Center, Shanghai Institutes for Life Sciences, Chinese Academy of Sciences), HT-29 (source: Cell Resource Center, Shanghai Institutes for Life Sciences, Chinese Academy of Sciences), EBC-1 (source: Bohui Biotech (Guangzhou) Co., Ltd.) and negative control MV-4-11 (source: Cell Resource Center, Shanghai Institutes for Life Sciences, Chinese Academy of Sciences) were collected in the logarithmic growth phase with different c-Met expression levels; BB buffer was used to prepare 2× working solution of the drug to be tested (6-FAM fluorescently labeled ApDC-05-1*), and the 2× working concentrations were 1 μM, 200 nM, 40 nM, 8 nM, 400 pM, and 80 pM, respectively; cells were washed once with PBS, and the cell density was adjusted to 4.0×10 after counting with BB buffer. 6 / mL; prepare a 96-well cell culture plate, set up a blank control group and a test drug group, where the test drug group has 2 replicate wells, add 50μL of cell suspension to each well; add 2× test drug working solution, 50μL / well, mix well, and incubate on ice for 30min; wash once with WB buffer, add Cyto-Fast TM Fix in Fix / Perm Buffer at room temperature for 20 minutes; wash once with WB buffer, resuspend the cells and detect 6-FMA fluorescence on the flow cytometer. Based on the 6-FMA fluorescence label in the structure of the aptamer-coupled drug ApDC-05-1*, flow cytometry was used to detect the in vitro binding level of the drug ApDC-05-1* at a given concentration with the c-Met target on the surface of 7 cell lines, including the c-Met positive percentage and the average fluorescence intensity index. Graphpad Prism software, version 8.0, was used to perform nonlinear S-curve regression fitting on the drug test concentrations (500nM, 100nM, 20nM, 4nM, 200pM and 40pM) and c-Met positive rate data, draw the dose-effect curve, and calculate the EC 50 .

[0209] Figure 3 A schematic diagram showing the dose-effect curve of the cell binding test drug of the nucleic acid aptamer drug conjugate (ApDC-05-1*) and the binding level of the tumor cells.

[0210] like Figure 3As shown, the drug binding level to tumor cells (c-Met positive percentage), the in vitro binding EC of ApDC-05-1* to NCI-H1650, MKN45, SNU-5, Hs746T, HT-29, EBC-1 and negative control MV-4-11 cells 50 EC 50 The smaller the size, the stronger the binding ability and the better the targeting, so ApDC-05-1* has the best targeting to EBC-1. 50 The value is 106.230nM.

[0211] Embodiment 15

[0212] Cytotoxic activity of aptamer-drug conjugate ApDC-05-1

[0213] The cells EBC-1 (source: Bohui Biotech (Guangzhou) Co., Ltd.), SNU-5 (source: Cell Resource Center, Shanghai Institutes for Life Sciences, Chinese Academy of Sciences), HT-29 (source: Cell Resource Center, Shanghai Institutes for Life Sciences, Chinese Academy of Sciences), MKN45 (source: Cell Resource Center, Institute of Basic Medicine, Chinese Academy of Medical Sciences) with different c-Met expression levels in the exponential doubling phase and MV-4-11 (source: Cell Resource Center, Shanghai Institutes for Life Sciences, Chinese Academy of Medical Sciences) negative control cells without c-Met expression were counted and the cell density was adjusted to 5×10 4The cells were inoculated into 96-well plates at 100 μL / well and cultured overnight at 37°C and 5% CO2. A blank control, a test aptamer-coupled drug ApDC-05-1, a linker group + drug molecule group L-05-1-MMAE, and a drug molecule group MMAE group were set up respectively, and the test drug concentrations were all: 1 μM, 200 nM, 40 nM, 8 nM, 2 nM, 400 pM, 80 pM, and 3 replicate wells; the next day, 2×ApDC-05-1, L-05-1-MMAE and MMAE were prepared, respectively: 2 μM, 400 nM, 80 nM, 16 nM, 4 nM, 800 pM, 160 pM; Add test drugs: aspirate and discard the cell culture medium in the culture dish (centrifugation operation is added for semi-attached and semi-suspended and suspended cells), and add the above-prepared 2×drug solution to the experimental wells, 50 μL / well, and at the same time add 50 μL of culture medium to the blank control wells, and add 50 μL of cell culture medium to each well. After culturing for 4 hours at 37°C and 5% CO2, replace the medium without drug (centrifugation is added for semi-attached and semi-suspended cells and suspension cells), 100 μL / well. Repeat the above steps to add drugs at 24h and 48h after drug addition, and continue culturing until 72h after the first drug addition; use CellTiter- The luminescence value of live cells in tumor cell lines was detected by luminescence cell viability detection kit (CTG). Then, Graphpad Prism software, version 8.0, was used to perform nonlinear S-curve regression fitting on the test concentrations of the drug (1 μM, 200 nM, 40 nM, 8 nM, 400 pM and 80 pM) and the cell proliferation rate, draw the dose-effect curve, and calculate the IC 50 .

[0214] Table 1. IC values ​​of aptamer-drug conjugate ApDC-05-1 against five cytotoxicity 50 (nM) Data

[0215] <![CDATA[IC 50 (nM)]]> MKN-45 HT-29 EBC-1 SNU-5 MV-411 ApDC-05-1 1256.5 591.4 88.5 39.8 387.8

[0216] The results are shown in Table 1. The toxicity level of the drug on tumor cells (IC 50 (nM)), IC of ApDC-05-1 against MKN45, HT-29, negative control MV-4-11, EBC-1, and SNU-5 cells 50 They are 1256.5nM, 591.4nM, 387.8nM, 88.5nM, and 39.8nM, respectively. IC 50 The smaller it is, the stronger its killing ability and the stronger its cytotoxicity.

[0217] Figure 4 A schematic diagram showing the inhibition curve of ApDC-05-1 on MKN45 cell line;

[0218] Figure 5 A schematic diagram showing the inhibition curve of ApDC-05-1 on HT-29 cell line;

[0219] Figure 6 A schematic diagram showing the inhibition curve of ApDC-05-1 on the EBC-1 cell line;

[0220] Figure 7 A schematic diagram showing the inhibition curve of ApDC-05-1 on SNU-5 cell line;

[0221] Figure 8 A schematic diagram showing the inhibition curve of ApDC-05-1 on MV-4-11 cell line;

[0222] like Figures 4 to 8 As shown in Figure 2, the tested aptamer-coupled drug ApDC-05-1 can specifically inhibit the proliferation of EBC-1 and SNU-5 cell lines, IC 50 The specific killing ability of MKN45 and HT-29 was weak, IC 50 The IC values ​​for the c-Met negative cell line MV-4-11 are 1256.5nM and 591.4nM respectively. 50 It was 387.8nM, and no specific killing effect was observed.

[0223] Example 16

[0224] The efficacy of aptamer-drug conjugate ApDC-05-1 on subcutaneous transplanted tumors of human lung squamous cell carcinoma EBC-1 in Balb / c nude mice

[0225] EBC-1 tumor cells (source: Bohui Biotechnology (Guangzhou) Co., Ltd.) were resuspended in a PBS:Matrigel mixture (volume ratio 1:1) and adjusted to a concentration of 1×10 8 / mL, inoculated subcutaneously in the right flank of experimental mice, 100 μL / mouse, and the tumor cell inoculation volume was 1×10 7 / mouse. When the average tumor volume reaches 60-100mm 3The mice were divided into 4 groups, each with 6 BALB / c nude female mice aged 6-8 weeks, including Vehicle (PBS) group, aptamer-drug conjugate ApDC-05-1 (0.5 mg / kg) group, aptamer-drug conjugate ApDC-05-1 (1.5 mg / kg) group, and aptamer-drug conjugate ApDC-05-1 (5 mg / kg) group. Each group was intravenously injected with a dosing frequency of once every 4 days, a dosing cycle of 2 weeks, and an observation period of 1 week. The long diameter, short diameter, and body weight of the tumor were measured twice a week during the dosing period. The tumor inhibition rate (TGI) was calculated on the 21st day after dosing. RTV ) and tumor weight inhibition rate (TGI TW ) for efficacy evaluation.

[0226] Calculation formula:

[0227] Tumor volume: TV = D1 × D22 / 2, where D1 and D2 represent the long diameter and short diameter of the tumor, respectively;

[0228] Relative tumor volume: RTV = TV n / TV0, where TV0 is the tumor volume before drug administration, TV n is the tumor volume at each measurement;

[0229] Relative tumor inhibition rate: TGI RTV (%) = (1-T RTV / C RTV )×100%, T RTV Indicates the drug-treated group or positive control group RTV, C RTV represents the negative control group RTV;

[0230] Tumor weight: TW;

[0231] Tumor weight inhibition rate: TGI TW (%) = (1-T / C) × 100%;

[0232] T / C = mean TW of treatment group / mean TW of control group.

[0233] Table 2. The volume, weight and inhibition rate of subcutaneous transplanted tumors in EBC-1 mice in each experimental group and control group

[0234]

[0235] Note: The dosage volume is 10 μL / g.

[0236] Results and Conclusions:

[0237] The inhibitory effects of each group of test substances (ApDC-05-1) on the EBC-1 tumor volume are shown in Table 2. After grouping, the tumors of mice in group G1 continued to grow. At the end of the PG-D20 experiment, the average tumor volume of mice in group G1 reached 2407 mm 3 In the ApDC test substance iv (intravenous) injection treatment group, the mean TV value of the G2 group at the end of the experiment was 1285 mm 3 , TGI TV The mean TV value curves of G3 and G4 groups continued to decrease in the later stage of the experiment and all tumors completely disappeared at the end of the experiment, that is, TV was 0±0 mm. 3 , the corresponding TGI TV (%) were all 100%; the statistical analysis results showed that at the end of the experiment, there was no statistical difference in tumor volume among the groups (p>0.05).

[0238] The inhibitory effects of each test substance on EBC-1 tumor weight are shown in Table 2. At the end of the PG-D20 experiment, the mean tumor weights of mice in groups G1-G4 were 2.15 g, 1.16 g, 0.00 g, and 0.00 g, respectively. The TGI of each treatment group was TW The results of statistical analysis showed that at the end of the experiment, there was no statistical difference in tumor weight among the groups (p>0.05).

[0239] In the EBC-1 human lung cancer subcutaneous xenograft model, intravenous injection of low, medium, and high doses of ApDC-05-1 test substance (twice a week, 2 weeks of administration, 1 week of rest) significantly inhibited tumor growth. TV (%) reached 47%-100%. During the experiment, the treated mice had a stable body weight and were in good condition, indicating that the mice tolerated the drug well. The experimental results showed that the aptamer drug conjugate ApDC-05-1 had a significant tumor inhibition effect on subcutaneous transplanted tumors in EBC-1 nude mice.

[0240] Although multiple embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Those skilled in the art may conceive of many changes, modifications, and alternatives without departing from the thought and spirit of the present invention. It should be understood that in the process of practicing the present invention, various alternatives to the embodiments of the present invention described herein may be adopted. The appended claims are intended to define the scope of protection of the present invention, and therefore cover equivalents or alternatives within the scope of these claims.

Claims

1. A nucleic acid aptamer drug conjugate, characterized in that: include: The nucleic acid aptamer targeting hepatocyte growth factor receptor, the linker group and the drug molecule group are sequentially connected, The connecting group is shown in formula (I): -L3-(L2)x-L1-, x is 0 or 1; (I) Among them, L1 is connected to the nucleic acid aptamer, and L3 is connected to the drug molecule group. L1 is selected from: The maleimide residue of a, b is 0 or a positive integer, and a, b are not 0 at the same time; L2 is selected from a combination of one or more of the following residues: Dipeptides: valine-citrulline residues, valine-alanine residues, valine-lysine residues, valine-arginine residues, phenylalanine-lysine residues, cyclobutane-1,1-dicarboxamide-citrulline residues, Tetrapeptides: Gly-Gly-Phe-Gly residues, 4-(N-maleimidomethyl)cyclohexane-1-carboxylate residue, N-succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylic acid residue, p-aminobenzyl alcohol residue, p-aminobenzyloxycarbonyl residue, dimethylethylenediamine residue; L3 is selected from the group consisting of: a carboxyl residue, a carboxyethyl residue, a hydrazone residue, a disulfide bond residue, a p-aminobenzyl alcohol residue, a p-aminobenzyloxycarbonyl residue, and a monophosphate residue; The drug molecule group is selected from: a drug molecule group having a modified residue connected to L3; The nucleic acid aptamer is modified by a thiol residue, and the thiol residue is selected from -(CH2CH2O) d -(CH2) c -S-, c and d are 0 or positive integers, and c and d cannot be 0 at the same time.

2. The nucleic acid aptamer drug conjugate according to claim 1, characterized in that: The a and b are positive integers of 1-20.

3. The nucleic acid aptamer drug conjugate according to claim 1, characterized in that: The c and d are positive integers of 1-20.

4. The nucleic acid aptamer drug conjugate according to claim 1, characterized in that: The nucleotide sequence of the nucleic acid aptamer is SEQ ID NO.

1.

5. The nucleic acid aptamer drug conjugate according to claim 1, characterized in that: The number of thiol residues on the nucleic acid aptamer is q, where q is an integer of 1-20.

6. The nucleic acid aptamer drug conjugate according to claim 1, characterized in that: The modification sites of the thiol residues of the nucleic acid aptamer are selected from the 5' end, the 3' end and the non-target key site bases.

7. The nucleic acid aptamer drug conjugate according to claim 6, characterized in that: The non-targeted key site bases include bases numbered 2-11, 19-25, and 50-57 from the 5' to 3' end direction of the nucleic acid aptamer.

8. The nucleic acid aptamer drug conjugate according to claim 1, characterized in that: The drug molecule group includes tubulin inhibitors or DNA damaging agents, The microtubule protein inhibitors include dolastatin and its derivatives, auristatin and its derivatives, maytansine and its derivatives; The DNA damaging agents include calicheamicin and its derivatives, duocarmycin and its derivatives, anthramycin and its derivative PBD, camptothecin and its derivatives, and delutecan.

9. The nucleic acid aptamer drug conjugate according to claim 1, characterized in that: The linking group is selected from:

10. The nucleic acid aptamer drug conjugate according to claim 1, characterized in that: The structure of the nucleic acid aptamer drug conjugate is shown in formula (II): in: is a nucleic acid aptamer; D is a drug molecule group having a modified residue connected to L3; L3-(L2) x -L1 is a linking group, and x is 0 or 1; M is the modified thiol residue on the aptamer; q is the number of linking groups connected to the nucleic acid aptamer through the modified thiol residues on the nucleic acid aptamer, which is an integer from 1 to 20; L3 is connected to D through the modified residue on the drug molecule group; L1 is connected to the modified thiol residue M on the nucleic acid aptamer.

11. The nucleic acid aptamer drug conjugate according to claim 10, characterized in that: The nucleic acid aptamer drug conjugate is selected from the following compounds: in, q is an integer from 1 to 20; a, b, c, d are 0 or positive integers respectively; a and b are not 0 at the same time, and c and d are not 0 at the same time. 12 . A pharmaceutical composition comprising the nucleic acid aptamer-drug conjugate according to any one of claims 1 to 11 and a pharmaceutically acceptable carrier.

13. Use of the nucleic acid aptamer drug conjugate according to any one of claims 1 to 11 or the pharmaceutical composition according to claim 12 in the preparation of a drug for treating a c-Met-mediated disease or condition.

14. The use according to claim 13, characterized in that The c-Met-mediated diseases or conditions include c-Met-positive cancers, c-Met-positive cancers include lung cancer, stomach cancer, liver cancer, non-small cell lung cancer, breast cancer, pancreatic cancer, colorectal cancer, papillary renal cell carcinoma, esophageal cancer, and brain cancer.

15. A stereoisomer, a pharmaceutically acceptable salt, a hydrate, a solvate or an isotope compound having the structure of the general formula II as claimed in claim 10.

Images