Application of engineering stem cell microneedle in skin wound healing

Abstract

The invention belongs to the field of medicines, and provides application of an engineering stem cell microneedle in skin wound healing. The invention finds that the MN (at) ADSC-WB (a frozen microneedle prepared from adipose-derived stem cells transfected with water bear cytoplasm-rich hot melt protein (CAHS)) can effectively promote the healing of the wound surface on the animal level, and the treatment effect is remarkable. The invention further discloses a preparation method of the MN (at) ADSC-WB (the frozen microneedle prepared from the adipose-derived stem cells transfected with the water bear cytoplasm-rich hot melt protein (CAHS)) and the application of the MN (at) ADSC-WB. Further analysis shows that on one hand, generation of new blood vessels can be promoted, so that wound closure is effectively supported; on the other hand, by reducing the content of inflammatory factors in skin wound tissues, infection is reduced, and wound healing is promoted. A new thought is provided for wound healing treatment of diabetics, and the compound can be used as a promising medicine for accelerating wound healing of the diabetics.

Description

Technical Field

[0001] The invention belongs to the field of medicine, and specifically relates to an application of an engineered stem cell microneedle for treating skin wound healing. Background Art

[0002] The skin is the most critical barrier organ of the human body. It plays a role in isolating external microorganisms and harmful substances from invading the human body. It is the first line of defense for the human body against external pathogenic microorganisms. Wound healing is an urgent clinical challenge, especially for chronic wounds. Taking diabetic wounds as an example, there are hundreds of millions of diabetic patients worldwide, and about 10-25% of diabetic patients face complications such as slow wound healing or diabetic foot ulcers. Chronic wound formation is a complex dynamic process, which is regulated by multiple factors. On the one hand, the main factors that lead to difficult wound healing are diabetic peripheral vascular disease and neuropathy, and persistent infection will further hinder wound healing on this basis. On the other hand, due to the high blood sugar level of patients, the generation of new blood vessels and cell differentiation are seriously affected. The reduction and dysfunction of blood vessels make the wound in a state of hypoxia and lack of nutrition, making it difficult to heal. The physiological process of wound healing can be simply divided into four stages: fibrous clot formation, inflammatory response, revascularization and connective tissue remodeling, and revascularization is the key. However, the angiogenesis process in the wounds of diabetic patients is very slow, and the vascular surface area, branch connection number, total vascular length and total branch number in the wound are significantly reduced. Future therapeutic strategies must target the multiple causes of impaired wound healing in diabetes.

[0003] Studies in recent years have shown that stem cells and extracellular vesicles can promote wound healing. Among them, human adipose-derived stem cells (ADSCs) are abundant, easy to obtain, and have excellent self-renewal ability and multidirectional differentiation potential. The large amount of cytokines they secrete can promote granulation tissue formation and accelerate angiogenesis and other repair processes. ADSCs can accelerate wound angiogenesis and promote the accelerated healing of chronic wounds through multiple mechanisms such as inducing multidirectional differentiation, anti-oxidation apoptosis, and promoting vascularization.

[0004] Further in-depth clinical studies have found that long-term implantation of ADSCs cannot be detected in recipient tissues, which means that the therapeutic mechanism of ADSCs we observed is "hit and run", indicating that ADSCs have low adverse reactions and ectopic risks after administration. There are many ways to apply stem cell therapy to wound healing, such as direct injection, hydrogel excipients, microneedles, etc. In order to achieve the best therapeutic effect and realize precise drug delivery, the present invention adopts microneedle (MNs) technology, which can keep the loaded cells alive and have the mechanical strength to penetrate the skin. However, there are many factors that affect the vitality of the cells during the preparation process. Based on this, the present invention solves the problem of the survival quality of stem cells so that they can exert better therapeutic effects and promote subsequent healing of chronic diabetic wounds. Summary of the invention

[0005] The present invention constructs adipose stem cells that can express cytoplasmic-rich thermosoluble proteins, and uses microneedles, a less invasive and more effective method, to deliver adipose stem cells. The hydrogel cryomicroneedles of the present invention have sufficient mechanical strength to penetrate the skin and deliver cells deep into the wound. By using methacrylylated gelatin (GelMA) hydrogel to construct a living environment for adipose stem cells, they can be stably released on the wound surface, better exerting the potential to accelerate wound healing. The expression of cytoplasmic-rich thermosoluble proteins can keep the cells at a high level of vitality, ensuring the survival rate of cells during the microneedle preparation process, and the living cells can proliferate after being released from the cryomicroneedles, so that they can truly exert their therapeutic effects on the wound surface.

[0006] Cell hydrogel solution

[0007] The present invention provides a cell hydrogel solution, wherein the hydrogel solution comprises stem cells capable of expressing and / or secreting cytoplasmic-abundant heat-soluble (CAHS) proteins secreted by tardigrades.

[0008] In some embodiments, the cell density of the stem cells in the hydrogel solution is 0.1 to 10×10 6 In some specific embodiments, the cell density of the stem cells in the hydrogel solution is 1×10 6 cells / mL.

[0009] In some embodiments, the main material of the cell hydrogel solution is methacryloyl gelatin (GelMA). In some embodiments, the concentration of the methacryloyl gelatin is 1-20% (w / v). In some embodiments, the concentration of the methacryloyl gelatin is 5-10% (w / v). In some specific embodiments, the concentration of the methacryloyl gelatin is 7% (w / v).

[0010] GelMA is a photo-crosslinked three-dimensional porous hydrogel formed through a specific preparation process, with good biocompatibility and controllable mechanical properties. By introducing a high-porosity structure, GelMA hydrogel can better simulate the microenvironment of natural tissues and enhance cell adhesion, proliferation and differentiation.

[0011] In some embodiments, the cell hydrogel solution also contains a freezing medium, and the freezing medium contains one or more cryoprotectants. In some embodiments, the cryoprotectant includes dimethyl sulfoxide (DMSO) and / or sucrose. In some embodiments, the DMSO concentration is 0.1-5% (v / v), and the sucrose concentration is 10-200mM. In some embodiments, the freezing medium is a PBS solution containing 0.1-5% (v / v) DMSO and 10-200mM sucrose solution.

[0012] In order to keep the cells active in a low-temperature environment, the present invention uses dimethyl sulfoxide (DMSO) combined with sucrose as an optimized cryoprotectant, which can protect both cell activity and the integrity of the microneedle structure during demolding, while phosphate buffered saline (PBS) is used as a solvent medium.

[0013] The present invention also provides a method for preparing the cell hydrogel solution, comprising the following steps:

[0014] A. Prepare 5-10% (w / v) GelMA hydrogel solution using freezing medium as the base solution;

[0015] B. Adding stem cells capable of expressing and / or secreting CAHS into the basement fluid to obtain the cell hydrogel solution.

[0016] The present invention also provides an injection or microneedle, wherein the injection or microneedle comprises the cell hydrogel solution.

[0017] Dissolvable microneedles

[0018] The present invention provides a soluble microneedle, which further contains a matrix material on the basis of the cell hydrogel solution, and the matrix material is selected from one or more of polyvinyl alcohol (PVA), polyvinyl pyrrolidone (PVP), polylactic acid (PLA), polylactic acid-glycolic acid copolymer (PLGA), sodium carboxymethyl cellulose (CMC-Na) and sodium hyaluronate (HA).

[0019] In some embodiments, the matrix material is polyvinyl alcohol (PVA). In some embodiments, the matrix material is PVA 1788. In some embodiments, the concentration of the PVA is 1 to 30% (w / v). In some embodiments, the concentration of the PVA is 10 to 20% (w / v).

[0020] The microneedle described in the present invention is a soluble microneedle. The microneedle adopts a soluble backing material of polyvinyl alcohol (PVA) and a needle tip material of methacrylated gelatin (GelMA). It can be dissolved in tissues and has good biocompatibility and in vivo solubility. It also has the advantages of simple preparation method, high drug loading capacity and high safety.

[0021] In some embodiments, the dissolvable microneedles are frozen microneedles.

[0022] In some embodiments, the microneedle comprises a backing layer and a needle tip arrayed on the backing layer. In some embodiments, the needle tip comprises a needle tip solution, and the backing layer comprises a backing substrate liquid. In some embodiments, the needle tip solution comprises the methacrylated gelatin and the stem cells, and the backing substrate liquid contains PVA.

[0023] The present invention prepares ADSC-WB microneedles (MN@ADSC-WB), and observes the changes in collagen content in skin tissue according to Masson staining (Example 7 and Figure 7 ), compared with the control group, the MN@ADSC-WB group had collagen deposition in the skin tissue after treatment and the collagen fibers were arranged regularly, indicating that MN@ADSC-WB promoted collagen deposition and actively promoted the reconstruction of the skin matrix. Among them, MN@ADSC-WB had a better therapeutic effect. Specifically, Example 5 and Figure 4-5 The results showed that the wound surface of diabetic mice treated with MN@ADSC-WB had improved significantly since the 6th day after treatment, and was basically healed around the 12th day. Figure 6-9 The results showed that the skin tissues of diabetic mice in different treatment groups were observed after HE staining, Masson staining, IL-6 immunofluorescence staining, and CD31 immunofluorescence staining. The wounds of diabetic mice in the control group healed slowly, with severe tissue damage, obvious structural damage, and more inflammatory cells diffused in the surface layer of the skin; while the wounds of mice in the MN@ADSC-WB treatment group healed quickly, with reduced skin damage symptoms, a few damaged skin structures, partial inflammatory cell infiltration, a small amount of exudate, almost no IL-6 secretion groups, and obvious new blood vessel formation. Doppler blood flow imaging (Example 9 and Fig.10) more intuitively shows the distribution and volume of blood flow, and the generation of new blood vessels can effectively support wound closure. No significant improvement was observed in the other groups. Therefore, these results show that MN@ADSC-WB can significantly and effectively promote or improve the healing of diabetic wounds.

[0024] The present invention also provides a method for preparing the soluble microneedle, which comprises the following steps:

[0025] a. Prepare 5-10% (w / v) GelMA hydrogel solution using freezing medium as the base solution;

[0026] b. adding the stem cells capable of expressing and / or secreting CAHS to the basal fluid as a needle tip solution;

[0027] c. Dissolve 10-20% (w / v) PVA in water as the microneedle backing substrate;

[0028] d. preparing soluble microneedles using the needle tip solution and the backing substrate solution.

[0029] In some embodiments, the microneedle can be prepared by a freezing method, a mold method, or a light curing method. In some embodiments, the microneedle is prepared by a mold method.

[0030] In some embodiments, the mold method for preparing microneedles is:

[0031] d-1. The needle tip solution is dripped into the mold, and the mold is centrifuged;

[0032] d-2. After centrifugation, the excess solution in the mold is removed and the microneedle backing substrate liquid is added;

[0033] d-3. After freezing and demolding, the soluble microneedles are obtained.

[0034] In some embodiments, the speed and time of the centrifugation in step d-1 are 1500-4000 g for 2-10 min. In some embodiments, the speed and time of the centrifugation are 1500-3000 g for 5-10 min. In some specific embodiments, the speed and time of the centrifugation are 3000 g for 5 min.

[0035] In some embodiments, the mold method for preparing microneedles is specifically as follows: a certain amount of sucrose and DMSO are dispersed in a solution, a certain amount of methacryloyl gelatin (GelMA) hydrogel is added to form a solution of appropriate concentration, and after being treated in an ultrasonic instrument for a certain period of time to fully dissolve, the cells are dispersed therein to obtain a needle tip solution; an appropriate amount of the above needle tip solution is dripped into the mold, and the mold is placed in a centrifuge rotor for centrifugation. After the centrifugation is completed, the excess solution in the mold is removed, and an appropriate amount of PVA matrix material is dripped in, and MN@ADSC-WB is obtained after freezing and demolding.

[0036] Liposomes

[0037] In some embodiments, the method for preparing the liposome comprises the following steps:

[0038] (1-1) Weighing cationic lipids and negatively charged phospholipids, dissolving them in a certain amount of organic solvent, and mixing them in a molar ratio, and then rotary evaporating to obtain a uniform liposome film;

[0039] (1-2) mixing the mRNA RNase-free aqueous solution system with the liposome film to obtain a mixture;

[0040] (1-3) The mixture is sonicated to form a liposome / mRNA complex, i.e., the liposome loaded with the cytoplasmic abundant thermosoluble protein mRNA.

[0041] In some embodiments, the cationic lipid in step (1-1) is selected from DOTAP and DOTMA. In some embodiments, the cationic lipid is DOTAP.

[0042] In some embodiments, the negatively charged phospholipid is selected from phosphatidylserine (PS). In some embodiments, the negatively charged phospholipid is 1-palmitoyl-2-oleoylphosphatidylserine (POPS).

[0043] In some embodiments, the molar ratio of the cationic lipid to the negatively charged phospholipid is 10:0 to 0:10. In some embodiments, the molar ratio of the cationic lipid to the negatively charged phospholipid is 9:1 to 6:4. In some specific embodiments, the molar ratio of the cationic lipid to the negatively charged phospholipid is 7:3.

[0044] In some embodiments, the amino acid sequence of the cytoplasmic abundant thermosoluble protein is shown in SEQ ID NO: 1. In some embodiments, the stem cell contains ribonucleic acid that can be converted to obtain cytoplasmic abundant thermosoluble protein. In some embodiments, the ribonucleic acid is mRNA. In some embodiments, the sequence of the mRNA is shown in SEQ ID NO: 2.

[0045] MPYEKHVEQT VVEKTEQPGH SSTHHAPAQR TVAREQEEVV HKEFTHTDIR VPHIDAPPPIIAASAVGLAE EIVSHGFQAS AARISGASTE VDMRPSPKLA EEARRDAERY QKEHEMINRQ AEATLQKKAEEYRHQTEAEA EKIRRELEKQ HERDIQFRKD LIDQTIEKQK REVDLEAKMA KRELDREAQL AKEALERSRMATNVEVTLDT AAGHTVSGGT TVSSVDKVET VRERKHH

[0046] SEQ ID NO:1

[0047] ATGCCCTACGAGAAGCACGTGGAGCAGACCGTGGTGGAGAAGACCGAGCAGCCCGGCCAC

[0048] AGCAGCACCCACCACGCCCCCGCCCAGAGGACCGTGGCCAGGGAGCAGGAGGAGGTGGTG

[0049] CACAAGGAGTTCACCCACACCGACATCAGGGTGCCCCACATCGACGCCCCCCCCCCCATC

[0050] ATCGCCGCCAGCGCCGTGGGCCTGGCCGAGGAGATCGTGAGCCACGGCTTCCAGGCCAGC

[0051] GCCGCCAGGATCAGCGGCGCCAGCACCGAGGTGGACATGAGGCCCAGCCCCAAGCTGGCC

[0052] GAGGAGGCCAGGAGGGACGCCGAGAGGTACCAGAAGGAGCACGAGATGATCAACAGGCAG

[0053] GCCGAGGCCACCCTGCAGAAGAAGGCCGAGGAGTACAGGCACCAGACCGAGGCCGAGGCC

[0054] GAGAAGATCAGGAGGGAGCTGGAGAAGCAGCACGAGAGGGACATCCAGTTCAGGAAGGAC

[0055] CTGATCGACCAGACCATCGAGAAGCAGAAGAGGGAGGTGGACCTGGAGGCCAAGATGGCC

[0056] AAAGAGGGAGCTGGACAGGGAGGCCCAGCTGGCCAAGGAGGCCCTGGAGAGGAGCAGGATG

[0057] GCCACCAACGTGGAGGTGACCCTGGACACCGCCGCCGGCCACACCGTGAGCGGCGGCACC

[0058] ACCGTGAGCAGCGTGGACAAGGTGGAGACCGTGAGGGAGAGGAAGCACCAC

[0059] SEQ ID NO:2

[0060] In some embodiments, the total liposome material to mRNA mass ratio (g / g) in the mixture in step (1-2) is 0.37-37 g / g. In some embodiments, it is 0.444-35.556 g / g. In some embodiments, it is 0.889-26.667 g / g. In some specific embodiments, the total liposome material to nucleic acid mass ratio (g / g) is 7.111 g / g.

[0061] Stem Cells

[0062] In some embodiments, the stem cell is selected from adult stem cells, mesenchymal stem cells, umbilical cord blood stem cells, hematopoietic stem cells, neural stem cells, adipose stem cells, skin stem cells or muscle stem cells. In some embodiments, the stem cell is an adipose stem cell.

[0063] Adipose stem cells are a type of stem cell with multidirectional differentiation potential isolated from adipose tissue. Adipose tissue has abundant reserves, from which a large number of adipose stem cells with self-renewal, proliferation and multidirectional differentiation potential can be obtained. They can secrete a variety of angiogenic factors and anti-apoptotic factors, resist damage from oxygen free radicals, and are expected to become a source of stem cells for repairing damaged tissues and organs. Stem cell therapy to promote diabetic wound healing has been a topic of great concern in recent years. Mouse diabetic models have found that the use of adipose stem cells, umbilical cord stem cells, bone marrow stem cells or combined treatment with MSCs can accelerate wound healing.

[0064] In some embodiments, the mRNA in the stem cells capable of expressing and / or secreting CAHS is introduced into the stem cells by viral transfection, liposome transfection, electrotransfer, gene editing or mRNA transfection. In some embodiments, the mRNA is introduced into the stem cells by liposome transfection.

[0065] In some embodiments, the method for preparing stem cells capable of expressing and / or secreting CAHS comprises the following steps:

[0066] (1) preparing liposomes loaded with cytoplasmic abundant thermosoluble protein mRNA;

[0067] (2) Co-culturing the liposomes with stem cells to obtain the stem cells capable of expressing and / or secreting CAHS.

[0068] In some embodiments, in the co-culture of step (2), the concentration of the liposomes loaded with the cytoplasmic abundant thermosoluble protein mRNA is 0.096-0.48 mg / mL. In some embodiments, it is 0.096-0.24 mg / mL. In some embodiments, it is 0.192 mg / mL.

[0069] The present invention also provides the use of the cell hydrogel solution, the injection or microneedle, and the soluble microneedle in preparing a cell therapy agent for treating chronic wound healing in diabetic patients and other related dosage forms.

[0070] Compared with the prior art, the technical effects of the present invention are as follows:

[0071] The present invention provides a cell hydrogel solution containing engineered adipose-derived stem cells and cell freezing microneedles for the treatment of chronic diabetic wounds, which is a situation where there is no specific therapeutic drug. Experimental verification shows that MN@ADSC-WB can effectively promote the healing of wounds and the generation of new blood vessels at the animal level, with significant therapeutic effects. In addition, the therapeutic cells are directly encapsulated in the freezing microneedles and remain alive during the manufacturing process, which can avoid complex and redundant procedures and is safe and reliable. It improves patient compliance and provides a new idea for wound healing treatment for diabetic patients.

[0072] the term

[0073] "Microneedle" refers to a minimally invasive device composed of an array of microprotrusions, which penetrates the stratum corneum of the skin to form a temporary microchannel, which can achieve transdermal delivery of drugs. Microneedles are composed of single or multiple micron-level needles, with a diameter of generally several hundred microns and a height of up to millimeters. They can be divided into solid microneedles, hollow microneedles, coated microneedles, dissolvable microneedles, and hydrogel microneedles.

[0074] "Adipose-derived stem cells" (ADSCs) refer to human adipose-derived mesenchymal stem cells, which are stem cells isolated from adipose tissue and have multidirectional differentiation potential.

[0075] "AlamarBlue" refers to a non-toxic, ready-to-use resazurin indicator that can be used as a cell health indicator to quantitatively measure cell viability.

[0076] "PBS" refers to phosphate buffered saline.

[0077] "ADSC-WB" refers to ADSCs that have been transfected with the ability to persistently secrete cytoplasmic-abundant heat-soluble (CAHS) protein of tardigrades (Waterbear, WB).

[0078] “MN@ADSC-WB” refers to cell microneedles prepared from ADSC-WB.

[0079] "GelMA", or gelatin methacrylate, refers to a photo-crosslinkable three-dimensional porous hydrogel formed through a specific preparation process.

[0080] "PVA" means polyvinyl alcohol.

[0081] "IL-6" refers to interleukin-6, a type of cytokine produced by a variety of cells and acting on a variety of cells.

[0082] "CD31" refers to platelet-endothelial cell adhesion molecule.

[0083] "min" refers to time in minutes. "g" refers to centrifugal force.

[0084] "HE" stands for Hematoxylin-eosin staining, or HE staining for short, and is one of the commonly used staining methods in paraffin section technology. Hematoxylin staining is alkaline, which mainly stains the chromatin in the cell nucleus and the nucleic acid in the cytoplasm purple-blue; eosin is an acidic dye, which mainly stains the components in the cytoplasm and extracellular matrix red. HE staining is the most basic and widely used technical method in the teaching and scientific research of histology, embryology, and pathology.

[0085] "Masson" refers to the use of two or three anionic dyes mixed together, with collagen fibers appearing blue and muscle fibers appearing red. It is one of the staining methods used to display fibers and inflammatory factors in tissues. BRIEF DESCRIPTION OF THE DRAWINGS

[0086] Figure 1A For the screening of cryo-microneedles; Figure 1B To investigate the release of soluble dye rhodamine from frozen microneedles.

[0087] Figure 2 The cell viability released by cryo-microneedles was quantitatively detected at different time points (1, 3, and 6D).

[0088] Figure 3 The fluorescence signals monitored after applying different cryo-microneedles on the back skin of mice.

[0089] Figure 4 Representative photos of skin wounds in mice in different drug-administered groups.

[0090] Figure 5 Quantification of skin wound area and wound healing statistics of mice in different drug groups.

[0091] Figure 6 HE staining of mouse skin tissue in different drug-administered groups.

[0092] Figure 7 Masson staining of mouse skin tissue in different drug-treated groups.

[0093] Figure 8 Immunofluorescence staining of IL-6 in mouse skin tissue in different drug groups.

[0094] Fig. 9 CD31 immunofluorescence staining of mouse skin tissue in different drug-administered groups.

[0095] Fig.10 and Fig.11 These are blood flow images and quantitative data graphs of damaged skin areas of mice in different drug-dosing groups.

[0096] Fig.12To evaluate the long-term safety, HE staining, Masson staining, IL-6 and CD31 immunofluorescence staining were performed on the skin tissues of different groups of mice. DETAILED DESCRIPTION

[0097] The embodiments of the present invention will be described clearly and completely below in conjunction with the examples. Obviously, the described examples are only some examples of the present invention, rather than all examples. The following description of at least one exemplary embodiment is actually only illustrative and is by no means intended to limit the present invention and its application or use. Based on the examples in the present invention, all other examples obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention.

[0098] Example 1: Preparation of cryomicroneedles and investigation of the release of soluble dye rhodamine from cryomicroneedles

[0099] 1. Selection of GelMA concentration

[0100] (1) Prepare freezing medium: 2.5% (v / v) DMSO + 100 mM sucrose solution in PBS.

[0101] (2) Preparation of needle tip solution: Using freezing medium to dissolve and ultrasonically prepare 5%, 7%, and 10% (w / v) methacryloyl gelatin GelMA hydrogel solutions as needle tip solutions.

[0102] (3) Preparation of microneedle backing substrate liquid: 15% (w / v) PVA 1788 was dissolved in distilled water to prepare the microneedle backing substrate liquid.

[0103] (4) Microneedles were prepared by the mold replication method. 120 μL of needle tip solution was added to the microneedle mold, which was placed in a rotor and centrifuged at 3000 rpm for 5 min. The excess solution was removed, 200 μL of microneedle backing solution was added and centrifuged for 3 min. The mold was placed in a -20°C freezer for 4 h. After demolding, the mold was transferred to a -80°C freezer for 2 h. Finally, the mold was stored in liquid nitrogen for 1 h to obtain blank frozen microneedles.

[0104] like Figure 1A As shown in the figure, 5% (w / v) methacryloyl gelatin GelMA hydrogel solution is easy to crack, and the microneedles are incomplete after demolding; due to the high viscosity of 10% (w / v) hydrogel solution, the microneedle tips are uneven and easy to break during demolding. The microneedles prepared using 7% (w / v) methacryloyl gelatin GelMA hydrogel solution have better molding and complete demolding. Therefore, 7% (w / v) methacryloyl gelatin GelMA hydrogel solution is used in the subsequent preparation of frozen microneedles.

[0105] 2. Choice of backing material

[0106] On the basis of the above-mentioned frozen microneedles, the PVA 1788 in the microneedle backing substrate liquid in step (3) was replaced with methacrylated hyaluronic acid (HAMA). It was found that the HAMA material had high viscosity and weak mechanical strength. At the same time, the backing material of the prepared microneedle could not be dissolved, and the needle tip was difficult to stay in the wound, and thus the sustained release of the drug in the microneedle could not be achieved. Therefore, the backing material for the subsequent frozen microneedle preparation was selected to be soluble PVA.

[0107] 3. Investigate the release of soluble dye rhodamine from cryo-microneedles

[0108] (1) Preparation of rhodamine cryomicroneedles

[0109] First, prepare the freezing medium: 2.5% (v / v) DMSO + 100mM sucrose solution in PBS. Prepare the needle tip solution: weigh an appropriate amount of rhodamine dye and dissolve it in the freezing medium to make its concentration 0.01mg / mL. Use this solution to ultrasonically prepare 7% (w / v) methacryloyl gelatin GelMA hydrogel solution as the needle tip solution. Dissolve 15% (w / v) PVA 1788 in distilled water as the microneedle backing substrate liquid. Prepare microneedles by mold replication method, add 120μL of needle tip solution to the microneedle mold, put it in a rotor and centrifuge it at 3000rpm for 5min, remove the excess solution, add 200μL of microneedle backing solution, centrifuge it for 3min, and then freeze it at -20℃ for 4h. After demolding, transfer it to -80℃ for freezing for 2h, and finally store it in liquid nitrogen for 1h to obtain rhodamine frozen microneedles.

[0110] (2) Investigating the release of soluble dye rhodamine from cryo-microneedles

[0111] The fresh frozen microneedles were immersed in preheated PBS (37°C) in the dark. At different time points, PBS was aspirated into a black 96-well plate and an equal volume of PBS solution was added. The control group was diluted with the same multiple of rhodamine aqueous solution, and 3 replicates were added at each time point. The fluorescence intensity (excitation 536nm, emission 605nm) was measured using an enzyme reader (SpectraMax M5).

[0112] (3) Experimental results

[0113] Figure 1B The fluorescence intensity released by rhodamine cryo-microneedles at different time points was quantitatively detected. Figure 1B It can be seen that with the increase of time, the fluorescence intensity of rhodamine in the frozen microneedles gradually increased, and the release amount was basically stable after 6 hours.

[0114] Example 2: Investigation of the survival and proliferation of cells released from cryo-microneedles

[0115] (1) Experimental groups: ADSC group and ADSC-WB group.

[0116] (2) Experimental methods:

[0117] ① Cell transfection. Preparation of liposome nanoparticles by thin film ultrasound. Weigh DOTAP and POPS and dissolve them in a certain amount of chloroform, mix them in a molar ratio of 7:3, so that the total mass of lipids is 96μg, and use a rotary evaporator to remove the organic solvent until a uniform film is formed on the chicken heart bottle. Take 13.5μL Waterbear mRNA (1mg / mL) (sequence as shown in SEQ ID NO:2) and dissolve it in 486.5μL RNase-free water. After mixing, add it to the rotary evaporated chicken heart bottle, and ultrasonicate it in an ultrasonicator for 5min to finally form the prepared DOTAP / POPS-Waterbear mRNA solution. Add the prepared DOTAP / POPS-Waterbear mRNA to the cultured cells and continue to culture them in a cell culture incubator for 24h.

[0118] ②Preparation of cryo-microneedles

[0119] First, prepare a freezing medium: 2.5% DMSO + 100mM sucrose solution in PBS. Use the freezing medium to ultrasonically prepare a 7% (w / v) GelMA hydrogel solution as the base solution. Add cells to the base solution to make the cell density 1×10 6 cells / mL, as the needle tip solution. 15% (w / v) PVA 1788 was dissolved in distilled water as the microneedle backing substrate liquid. Microneedles were prepared by mold replication method, 120μL of needle tip solution was added to the microneedle mold, placed in a rotor and centrifuged at 3000rpm for 5min, the excess liquid on the upper layer was removed and continued to be centrifuged for 25min to evaporate the excess water, 200μL of microneedle backing solution was added and centrifuged for 3min, then placed in -20℃ freezer for 4h, after demolding, transferred to -80℃ freezer for 2h, and finally stored in liquid nitrogen for 1h to obtain frozen microneedles.

[0120] ③ Subsequent cell viability determination. After the cells were loaded into the frozen microneedles using the above manufacturing process, these fresh frozen microneedles were immersed in preheated PBS (37°C) and the cell viability was subsequently tested. Six replicate wells were made for each experimental group. AlamarBlue assay was performed on days 1, 3, and 6. 0.1 volumes of AlamarBlue were added to each well. After incubation in a cell culture incubator for 4 hours, the fluorescence intensity was measured using a microplate reader (SpectraMax M5) (excitation 540nm, emission 580nm).

[0121] (3) Experimental results: Figure 2The viability of cells after release was quantitatively detected at different time points (1, 3, and 6D). The viability of cells was different, and these living cells could proliferate after being released from the cryo-microneedles. The subsequent viability and proliferation ability of cells in the ADSC-WB group were significantly better than those in the ADSC group.

[0122] Example 3: Investigating the diffusion of cells after cryomicroneedle delivery into mouse skin.

[0123] (1) Experimental method: BalB / c mice, male, were depilated under anesthesia before use. Blank microneedles and frozen microneedles loaded with DIR-ADSC (ADSC labeled with lipophilic near-infrared fluorescent dye DIR) (manufacturing process is the same as in Example 2) were applied to both sides of the back of the same mouse for 3 minutes. In order to confirm the survival of cells after delivery into the mouse skin, the mice were imaged 12 hours after microneedle treatment under an in vivo imaging system.

[0124] (2) Experimental results: Figure 3 Cryomicroneedles loaded with DIR-ADSC (left) and blank microneedles (right) were applied to both sides of the mouse back to monitor the fluorescent signal in the mouse skin. After transplantation, fluorescent signals were consistently observed at the sites treated with cryomicroneedles loaded with DIR-ADSC, and there was no signal at the sites treated with blank microneedles, indicating that there was no cell spreading after the cryomicroneedles successfully delivered cells.

[0125] Example 4: Preparation of cell-loaded microneedles

[0126] 1. Preparation of ADSC microneedles (MN@ADSC) and blank microneedles

[0127] (1) ADSC microneedles (MN@ADSC): First, prepare a freezing medium: 2.5% DMSO + 100 mM sucrose solution in PBS. Use the freezing medium to ultrasonically prepare a 7% (w / v) GelMA hydrogel solution as the base liquid. Add ADSCs to the base liquid to a cell density of 1×10 6 cells / mL, as the needle tip solution. 15% (w / v) PVA 1788 was dissolved in distilled water as the microneedle backing substrate liquid. Microneedles were prepared by mold replication method, 120μL of needle tip solution was added to the microneedle mold, placed in a rotor and centrifuged at 3000rpm for 5min, the excess liquid on the upper layer was removed and continued to be centrifuged for 25min to evaporate the excess water, 200μL of microneedle backing solution was added and centrifuged for 3min, then placed in -20℃ freezer for 4h, after demolding, transferred to -80℃ freezer for 2h, and finally stored in liquid nitrogen for 1h to obtain microneedles loaded with ADSC, namely MN@ADSC.

[0128] (2) Blank microneedles: Compared with ADSC microneedles (MN@ADSC), blank microneedles do not contain ADSCs, and the base solution is directly used as the needle tip solution. The other steps are the same as those of ADSC microneedles.

[0129] 2. Prepare ADSC-WB microneedles (MN@ADSC-WB).

[0130] Experimental methods:

[0131] ① Cell transfection. Preparation of liposome nanoparticles by thin film ultrasound. Weigh DOTAP and POPS and dissolve them in a certain amount of chloroform, mix them in a molar ratio of 7:3, so that the total mass of lipids is 96μg, and use a rotary evaporator to remove the organic solvent until a uniform film is formed on the chicken heart bottle. Take 13.5μL Waterbear mRNA (1mg / mL) (sequence as shown in SEQ ID NO:2) and dissolve it in 486.5μL RNase-free water. After mixing, add it to the rotary evaporated chicken heart bottle, and ultrasonicate it in an ultrasonicator for 5min to finally form the prepared DOTAP / POPS-Waterbear mRNA solution. Add the prepared DOTAP / POPS-Waterbear mRNA to the cultured cells and continue to culture them in a cell culture incubator for 24h.

[0132] ② Prepare freezing medium: PBS solution of 2.5% DMSO + 100 mM sucrose solution. Use freezing medium to ultrasonically prepare 7% (w / v) high-porosity hydrogel solution as the base liquid, add ADSC-WB to the base liquid, and make the cell density 1×10 6 cells / mL, as the needle tip solution. 15% (w / v) PVA 1788 was dissolved in distilled water as the microneedle backing substrate liquid. Microneedles were prepared by mold replication method, 120μL of needle tip solution was added to the microneedle mold, placed in a rotor and centrifuged at 3000rpm for 5min, the excess liquid on the upper layer was removed and continued to be centrifuged for 25min to evaporate the excess water, 200μL of microneedle backing solution was added and centrifuged for 3min, then placed in -20℃ freezer for 4h, after demolding, transferred to -80℃ freezer for 2h, and finally stored in liquid nitrogen for 1h to obtain microneedles loaded with ADSC-WB, namely MN@ADSC-WB.

[0133] Example 5: Experiment on promoting wound healing in diabetic model mice

[0134] (1) Experimental groups

[0135] BalB / c mice, male, were randomly divided into 4 groups (10 mice in each group), including: Control group (modeling and blank microneedles), MN@ADSC group (modeling and ADSC microneedles), MN@ADSC-WB group (modeling and ADSC-WB microneedles), and direct ADSC injection group (modeling and direct injection of ADSCs not transfected with Waterbear mRNA).

[0136] (2) Experimental methods

[0137] ①Establishment of animal diabetes model and drug administration:

[0138] After the healthy BalB / c mice were adapted, they were fasted but not watered for 12 hours in advance. Streptozotocin (STZ) was dissolved in 0.1M citrate-sodium citrate buffer (pH 4.2-4.5) and placed on an ice box to avoid light for later use. A diabetic mouse model was induced by intraperitoneal injection of 1% STZ solution (50mg / kg) for 5 consecutive days. Blood glucose was measured with a blood glucose monitor one week later. Mice with blood glucose levels higher than 11.1mM were considered successful models. After the successful modeling mice were anesthetized, the back hair was shaved with an electric hair clipper and depilatory cream was used for hair removal. A full-thickness skin wound of 8mm was created on both sides of the spine on the back of the mouse. The prepared microneedles were attached to the wound.

[0139] ② Observe the wound surface: take photos of the wound on the 1st, 4th, 6th, 9th and 12th days, and use image J to count the wound area.

[0140] ③ Subsequent experiments. After 14 days of treatment, some mice were killed and the whole layer of back skin was taken for subsequent experiments. After 5 and 10 days of treatment, mice were randomly selected and wound blood flow was photographed using a Doppler blood flowmeter.

[0141] (3) Experimental results

[0142] Figure 4 Representative photos of skin wounds in different drug-administered groups; Figure 5 The following are the quantitative diagrams of skin wound area and wound healing statistics of different drug administration groups. Figure 4 and Figure 5 As shown in the figure, compared with the control group and MN@ADSC group, the wound healing speed of the MN@ADSC-WB group was significantly faster, and the wound surface had made significant progress from the 6th day after treatment, and was basically healed around the 12th day. The results showed that MN@ADSC-WB can promote the healing of the wound surface of diabetic mice, and the effect is better than the direct injection group and the control group.

[0143] Example 6: Animal level evaluation of cell microneedle treatment of diabetic mice wound skin tissue pathology (hematoxylin-eosin staining)

[0144] (1) Experimental groups: Control group (modeling and blank microneedles), MN@ADSC group (modeling and ADSC microneedles), MN@ADSC-WB group (modeling and ADSC-WB microneedles), and direct ADSC injection group (modeling and direct ADSC injection).

[0145] (2) Experimental method: Skin tissue was obtained 14 days after the animal wound was injected with drug. The skin tissue was fixed in 4% paraformaldehyde tissue fixative for 24 h, dehydrated and embedded in paraffin. After sectioning, it was dewaxed and stained with hematoxylin-eosin (HE) and observed and photographed under a microscope.

[0146] (3) Experimental results: Figure 6 The following are pathological images of HE staining of mouse skin tissue in different drug administration groups. The results showed that the skin tissue of mice in the Control group was severely damaged, with obvious structural damage, diffuse inflammatory cells on the surface of the skin, and a large amount of exudate. Compared with the mice in the Control group, the skin injury symptoms in the MN@ADSC-WB treatment group were alleviated, a few skin structures were damaged, some inflammatory cells infiltrated, a small amount of exudate, and functional tissues such as hair follicles were generated. Therefore, these results show that the MN@ADSC-WB treatment group can treat and promote the healing of mouse skin tissue, and the treatment effect is better than that of the MN@ADSC treatment group. The inflammatory cell infiltration in the direct injection of ADSC group did not show obvious treatment effect.

[0147] Example 7 Animal Level Evaluation of Cell Microneedle Treatment of Diabetic Mice Wound Skin Histopathology (Masson Staining) Determination of Collagen Deposition

[0148] (1) Experimental grouping: The specific grouping is the same as that in Example 6.

[0149] (2) Experimental method: Masson staining of skin tissue sections: Fix the skin tissue in 4% paraformaldehyde tissue fixative for 24 hours, dehydrate and embed in paraffin, and dewax after slicing. Sequentially place the sections in xylene I for 20 minutes, xylene II for 20 minutes, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, and 75% alcohol for 5 minutes, and wash with tap water. Soak the sections in Masson staining kit A solution overnight and wash with tap water. Soak the sections in a mixture of Masson staining kit B solution and Masson staining kit C solution in equal proportions for 1 minute and wash with tap water. Differentiate with 1% hydrochloric acid alcohol and wash with tap water. Soak the sections in Masson D solution for 6 minutes and rinse with tap water. Soak the sections in Masson E solution for 1 minute, do not wash with water, drain slightly and directly stain in Masson F solution for 2-30 seconds. Rinse and differentiate the sections with 1% glacial acetic acid and dehydrate with two cylinders of anhydrous ethanol. Transparent sealing: put the slices into the third cylinder of anhydrous ethanol for 5 minutes, xylene for 5 minutes to make it transparent, and neutral gum to seal the slices. Under a microscope, collagen fibers appear blue; muscle fibers, cellulose and red blood cells appear red, and images are collected and analyzed.

[0150] (3) Experimental results: Figure 7 Masson staining and statistical graphs of mouse skin tissues in different drug-treated groups. Figure 7 As shown in the figure, compared with the Control group, the MN@ADSC-WB group had obvious collagen deposition and regular arrangement of collagen fibers, indicating that MN@ADSC-WB can actively promote the reconstruction of skin matrix. The results show that MN@ADSC-WB can treat and promote the healing of wounds in diabetic mice.

[0151] Example 8: Animal level evaluation of cell microneedle treatment of diabetic mice wound skin tissue pathology (IL-6, CD31 immunofluorescence staining)

[0152] (1) Experimental grouping: The specific grouping is the same as that in Example 6.

[0153] (2) Experimental method: ① Dewaxing of paraffin sections: sequentially place the sections in xylene I for 15 min, xylene II for 15 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, 85% alcohol for 5 min, 75% alcohol for 5 min, and wash with distilled water.

[0154] ② Antigen repair: Place the tissue sections in a repair box filled with citric acid antigen repair buffer (PH 6.0) in a microwave oven for antigen repair. Heat on medium heat for 8 minutes, stop heating for 8 minutes, and switch to medium-low heat for 7 minutes. During this process, prevent excessive evaporation of the buffer and do not allow the slides to dry out. After cooling naturally, place the slides in PBS (PH 7.4) and wash them on a decolorizing shaker for 3 times, 5 minutes each time.

[0155] ③ Quenching of autofluorescence by drawing circles: After the slices are slightly dried, use a histology pen to draw circles around the tissue (to prevent the antibody from flowing away), add autofluorescence quencher in the circle for 5 minutes, and rinse with running water for 10 minutes.

[0156] ④ Serum blocking: Add BSA in the circle and incubate for 30 minutes.

[0157] ⑤ Add primary antibody: Gently shake off the blocking solution, add primary antibody prepared in PBS at a ratio of 1:200 on the slices, and place the slices flat in a humidified box and incubate at 4°C overnight.

[0158] ⑥Add secondary antibody: Place the slide in PBS (PH 7.4) and shake on a decolorizing shaker for 3 times, 5 minutes each time. After the slices are slightly dried, add the secondary antibody of the same species as the primary antibody in the circle, cover the tissue, and incubate at room temperature in the dark for 50 minutes.

[0159] ⑦ DAPI counterstaining of cell nuclei: Place the slide in PBS (PH 7.4) and shake on a decolorizing shaker for 3 times, 5 minutes each time. After the slices are slightly dried, add DAPI staining solution in the circle and incubate at room temperature for 10 minutes away from light.

[0160] ⑧ Sealing: Place the slide in PBS (PH 7.4) and wash on a decolorizing shaker for 3 times, 5 minutes each time. After the slices are slightly dried, seal them with anti-fluorescence quenching sealing medium.

[0161] ⑨ Microscopic examination and photography: The sections were observed under a fluorescence microscope and images were collected.

[0162] (3) Experimental results: Figure 8 This is the immunofluorescence staining of IL-6 in the skin tissue of mice in different drug administration groups. IL-6 can reflect the severity of inflammation in the skin tissue. If the IL-6 secretion clusters in the skin tissue are widely distributed, it means that the inflammation is severe; if there are no IL-6 secretion clusters in the skin tissue, it means that the inflammation is mild. The secretion of IL-6 in each group is low. Fig. 9 This is the immunofluorescence staining of CD31 in the skin tissue of mice in different drug administration groups. As shown in the figure, the secretion of CD31 in the MN@ADSC-WB group increased significantly. This phenomenon indicates that MN@ADSC-WB can promote angiogenesis and thus promote the healing of wounds.

[0163] Example 9: Using the laser speckle blood flow imaging system to measure the blood flow at the wound skin site of mice

[0164] (1) Experimental grouping: The specific grouping is the same as in Example 6.

[0165] (2) Experimental methods:

[0166] ① Anesthetize the mice to be tested and expose the skin wound area.

[0167] ② Connect the USB data interface on the scanning head to the computer, adjust the vertical angle between the scanning head and the measured surface to 15°, and ensure that the distance between the scanning window and the measured surface is between 10-38cm. Click the button on the button toolbar to enter the software setting interface. Click the "Auto Focus" button for automatic focus. Adjust the appropriate clear image, click the start button, and record the blood flow map. After the recording is completed, click the end button to save the data record. Use the "moorFLPI-2V4.0" program for data analysis.

[0168] (3) Experimental results: Fig.10 and Fig.11 The blood flow diagrams and corresponding quantitative data of the skin of mice in different drug administration groups. The angiogenesis process in the wounds of diabetic patients is very slow. However, the results show that the blood flow in the wound skin of mice in the MN@ADSC-WB group was significantly increased, and the formation of new blood vessels more effectively supported the closure of the wound.

[0169] Example 10: Long-term safety study of subcutaneous injection of cell hydrogel in healthy mice

[0170] (1) Experimental groups: Male BalB / c mice were randomly divided into three groups (3 mice in each group), including the Control group (subcutaneous injection of blank hydrogel), the ADSC group (subcutaneous injection of ADSC cell hydrogel), and the ADSC-WB group (subcutaneous injection of ADSC-WB cell hydrogel).

[0171] (2) Experimental methods

[0172] ① First, prepare a freezing medium: 2.5% DMSO + 100mM sucrose solution in PBS. Use the freezing medium to ultrasonically prepare a 7% (w / v) GelMA hydrogel solution as the base fluid, and use the base fluid to resuspend ADSC and ADSC-WB (ADSC-WB cell transfection method is the same as Example 4) to make the cell density 1×10 6 cells / mL, and ADSC cell hydrogel and ADSC-WB cell hydrogel were obtained respectively.

[0173] ② After the healthy mice were adapted to feeding, the groin hair was shaved with an electric hair clipper and depilatory cream was used for hair removal, and 0.1 mL of blank hydrogel, ADSC cell hydrogel and ADSC-WB cell hydrogel solution were subcutaneously injected. After 14 days, the skin tissue of the injection site of the mice was taken to evaluate the skin tissue pathology (HE, Masson staining, IL-6 and CD31 immunofluorescence staining) (the method is the same as that of Examples 6-8).

[0174] (3) Experimental results: Fig.12HE staining, Masson staining, IL-6 and CD31 immunofluorescence staining of mouse skin tissue were used to evaluate the long-term safety of different groups. The results showed that compared with the Control group, both the ADSC group and the ADSC-WB group had collagen deposition and regular arrangement of collagen fibers, without severe skin tissue structural damage. IL-6 can reflect the severity of inflammation in skin tissue. If the IL-6 secretion group in the skin tissue is widely distributed, it means that the inflammation is severe; if there is no IL-6 secretion group in the skin tissue, it means that the degree of inflammation is mild. There was no extensive secretion group in each group, indicating that each group did not cause an inflammatory response. The results of CD31 immunofluorescence staining showed that compared with the Control group, the ADSC group and the ADSC-WB group had more CD31 green fluorescence signals, indicating that the drug-treated group can promote angiogenesis. Fig.12 The results showed that subcutaneous injection of cell hydrogel did not cause skin damage or inflammatory response, had long-term safety, and could be used to promote wound healing in the future.

Claims

1. A cell hydrogel solution, characterized in that: The hydrogel solution comprises stem cells capable of expressing and / or secreting cytoplasmic-abundant heat-soluble (CAHS) secreted by tardigrades; Preferably, the stem cells are selected from adult stem cells, mesenchymal stem cells, umbilical cord blood stem cells, hematopoietic stem cells, neural stem cells, adipose stem cells, skin stem cells or muscle stem cells; more preferably, the stem cells are adipose stem cells; Preferably, the cell density of the stem cells in the hydrogel solution is 0.1 to 10×10 6 cells / mL; Preferably, the amino acid sequence of the cytoplasmic abundant thermosoluble protein is as shown in SEQ ID NO:1; preferably, the stem cells contain ribonucleic acid that can be converted into cytoplasmic abundant thermosoluble protein; further preferably, the ribonucleic acid is mRNA; more preferably, the sequence of the mRNA is as shown in SEQ ID NO:

2.

2. The cell hydrogel solution according to claim 1, characterized in that The main material of the hydrogel solution is methacrylated gelatin (GelMA); Preferably, the concentration of the methacryloyl gelatin is 1 to 20% (w / v); preferably, the concentration of the methacryloyl gelatin is 5 to 10% (w / v); more preferably, the concentration of the methacryloyl gelatin is 7% (w / v); Preferably, the hydrogel solution also contains a freezing medium, and the freezing medium contains one or more cryoprotectants; preferably, the cryoprotectant includes dimethyl sulfoxide (DMSO) and / or sucrose; preferably, the concentration of DMSO is 0.1-5% (v / v), and the concentration of sucrose is 10-200mM; more preferably, the freezing medium is a PBS solution containing 0.1-5% (v / v) DMSO and 10-200mM sucrose solution.

3. An injection or microneedle, characterized in that: The injection or microneedle comprises the cell hydrogel solution according to any one of claims 1-2.

4. A dissolvable microneedle, characterized in that: The dissolvable microneedle comprises the cell hydrogel solution according to any one of claims 1 to 2; The soluble microneedle further contains a matrix material, and the matrix material is selected from one or more of polyvinyl alcohol (PVA), polyvinyl pyrrolidone (PVP), polylactic acid (PLA), polylactic acid-glycolic acid copolymer (PLGA), sodium carboxymethyl cellulose (CMC-Na) and sodium hyaluronate (HA); preferably, the matrix material is selected from polyvinyl alcohol PVA; more preferably, the PVA is PVA 1788; Preferably, the concentration of the PVA is 1 to 30% (w / v); more preferably, the concentration of the PVA is 10 to 20% (w / v).

5. The soluble microneedle according to claim 4, characterized in that: The dissolvable microneedles are frozen microneedles; Preferably, the microneedle comprises a backing layer and needle tips arrayed on the backing layer; Preferably, the needle tip includes a needle tip solution, and the backing layer includes a backing base liquid; More preferably, the needle tip solution includes the methacrylated gelatin and the stem cells, and the backing base solution contains PVA.

6. The method for preparing the cell hydrogel solution according to any one of claims 1 to 2, characterized in that: The preparation method comprises the following steps: A. Prepare 5-10% (w / v) GelMA hydrogel solution using freezing medium as the base solution; B. Adding the stem cells capable of expressing and / or secreting CAHS into the base fluid to obtain the cell hydrogel solution.

7. The method for preparing the soluble microneedle according to any one of claims 4 to 5, characterized in that: The preparation method comprises the following steps: a. Prepare 5-10% (w / v) GelMA hydrogel solution using freezing medium as the base solution; b. adding the stem cells capable of expressing and / or secreting CAHS to the basal solution as the needle tip solution; c. Dissolve 10-20% (w / v) PVA in water as the microneedle backing substrate; d. preparing a soluble microneedle using the needle tip solution and the backing substrate solution; preferably, the microneedle is prepared by a freezing method, a mold method or a light curing method; more preferably, the mold method; More preferably, the step d of preparing microneedles by the mold method is specifically as follows: d-1. The needle tip solution is dripped into the mold and the mold is centrifuged; preferably, the speed and time of the centrifugation are 1500-4000g, 2-10min; d-2. After centrifugation, the excess solution in the mold is removed and the microneedle backing substrate liquid is added; d-3. After freezing and demolding, the soluble microneedles are obtained.

8. The method for preparing the cell hydrogel solution according to claim 6, the method for preparing the soluble microneedle according to claim 7, It is characterized by: The mRNA in the stem cells capable of expressing and / or secreting CAHS is introduced into the stem cells by viral transfection, liposome transfection, electrotransfer, gene editing or mRNA transfection; preferably, the mRNA is introduced into the stem cells by liposome transfection; Preferably, the method for preparing stem cells capable of expressing and / or secreting CAHS comprises the following steps: (1) preparing liposomes loaded with cytoplasmic abundant thermosoluble protein mRNA; (2) co-culturing the liposomes with stem cells to obtain the stem cells capable of expressing and / or secreting CAHS; More preferably, the method for preparing the liposome in step (1) comprises the following steps: (1-1) Weighing cationic lipids and negatively charged phospholipids, dissolving them in a certain amount of organic solvent, and mixing them in a molar ratio, and then rotary evaporating to obtain a uniform liposome film; (1-2) mixing the mRNA RNase-free aqueous solution system with the liposome film to obtain a mixture; (1-3) ultrasonically subjecting the mixture to form a liposome / mRNA complex, i.e., the liposome loaded with the cytoplasmic abundant thermosoluble protein mRNA; and / or In the co-culture of step (2), the concentration of the liposomes loaded with the cytoplasmic abundant thermosoluble protein mRNA is 0.096-0.48 mg / mL; preferably 0.096-0.24 mg / mL, and more preferably 0.192 mg / mL.

9. The preparation method according to claim 8, characterized in that: In step (1-1), the cationic lipid is selected from DOTAP and DOTMA, and more preferably DOTAP; Preferably, the negatively charged phospholipid is selected from phosphatidylserine (PS), more preferably 1-palmitoyl-2-oleoylphosphatidylserine (POPS); Preferably, the molar ratio of the cationic lipid to the negatively charged phospholipid is 10:0 to 0:10, preferably 9:1 to 6:4, and more preferably 7:3; and / or The mass ratio (g / g) of total liposome material to mRNA in the mixture in step (1-2) is 0.37-37 g / g, preferably 0.444-35.556 g / g, further preferably 0.889-26.667 g / g, and more preferably, the mass ratio (g / g) of total liposome material to nucleic acid is 7.111 g / g.

10. Use of the cell hydrogel solution according to any one of claims 1-2, the injection or microneedle according to claim 3, and the soluble microneedle according to any one of claims 4-5 in the preparation of a cell therapy agent for treating chronic wound healing in diabetic patients and other related dosage forms.

Images