Application of PDIA1 as drug screening target in preparation of drugs for treating ulcerative colitis

Abstract

The invention belongs to PDIA1, and particularly relates to application of PDIA1 as a drug screening target in preparation of drugs for treating ulcerative colitis. The technical problem to be solved by the invention is to provide a new molecular target for recovery of intestinal epithelial barriers in ulcerative colitis. The expression level of PDIA1 in epithelial cells of patients with ulcerative colitis is higher than that of healthy people, and symptoms of ulcerative colitis can be effectively improved by inhibiting PDIA1. The invention provides a new thought for further researching the intestinal epithelial barrier recovery mechanism and the medical application of the PDIA1.

Description

Technical Field

[0001] The present invention relates to PDIA1, and in particular to the application of PDIA1 as a drug screening target in the preparation of drugs for treating ulcerative colitis. Background Art

[0002] Dilemma in clinical treatment of ulcerative colitis: There is a serious lack of therapeutic targets for epithelial barrier restoration; ulcerative colitis (UC) is a chronic inflammatory disease occurring in the rectal and colonic mucosa, characterized by complex etiology, frequent relapses and difficulty in radical cure. It is reported that UC patients are present in all age groups, and there is no gender difference in the incidence of UC. UC symptoms are diarrhea, abdominal pain and rectal bleeding, characterized by recurrence and remission of mucosal inflammation. UC is progressive and destructive, and therefore can lead to various complications: including stenosis, ulcers, fistulas, extraintestinal manifestations, and inflammation-related polyps and cancers. The intestinal barrier is composed of an immune barrier formed by intestinal immune cells, an epithelial mechanical barrier composed of intestinal epithelial cells, a chemical barrier mainly composed of mucin in the mucus layer, and a biological barrier composed of normal intestinal microbiota. The tight junction function, ultrastructure and protein composition of UC patients are significantly changed. In clinical practice, intestinal permeability is a sensitive prognostic indicator for relapse in patients in the quiescent period. Therefore, restoring intestinal barrier function is a powerful potential therapeutic target for UC, but no clinical treatment has been developed to effectively protect the intestinal epithelial barrier. Therefore, therapeutic targets targeting epithelial barrier restoration are crucial for the treatment of ulcerative colitis. Summary of the invention

[0003] Purpose of the invention: The technical problem to be solved by the present invention is to provide a new molecular target for epithelial barrier restoration in ulcerative colitis. The expression level of PDIA1 in intestinal epithelial cells of patients with ulcerative colitis is higher than that of healthy people, and inhibition of PDIA1 can effectively improve the symptoms of ulcerative colitis. The present invention provides a new idea for further studying the mechanism of intestinal epithelial barrier restoration and the medical use of PDIA1.

[0004] The present invention is intended to provide an application of PDIA1 in the diagnosis and drug screening of ulcerative colitis, so as to solve the problem of the lack of therapeutic drugs for intestinal epithelial barrier restoration in the drugs for treating ulcerative colitis in the prior art.

[0005] Technical Solution The use of PDIA1 as a drug screening target or PDIA1 itself in the preparation of drugs for the treatment of ulcerative colitis.

[0006] Application of PDIA1 in the preparation of diagnostic reagents for ulcerative colitis The application is characterized in that the drug is CCF642, an inhibitor of PDIA1.

[0007]

[0008] CCF642 The application is characterized in that the drug is AAV2-PDIA1.

[0009] Furthermore, the use of PDIA1 in the preparation of diagnosis of ulcerative colitis disease is characterized in that the transcription level and protein expression level of PDIA1 are both increased in the disease state of ulcerative colitis.

[0010] Furthermore, the use of PDIA1 in the preparation of a drug for treating ulcerative colitis is characterized in that the drug is the PDIA1 inhibitor CCF642 and adeno-associated virus: the nucleic acid molecule is AAV2-PDIA1.

[0011] Furthermore, the use of PDIA1 in the preparation of a drug for treating ulcerative colitis is characterized in that the PDIA1 protein is used as a biomarker for intestinal epithelial barrier destruction. Beneficial Effects

[0012] PDIA1 is a member of the Protein Disulfide-Isomerase Family A Member 1, an enzyme in the endoplasmic reticulum (ER) that is primarily involved in the folding process of proteins. Its structure contains multiple domains that can recognize and catalyze the formation, rearrangement, and breakage of disulfide bonds between cysteine ​​residues in proteins. As a chaperone protein, PDIA1 can also prevent proteins from misfolding and aggregation during the folding process. It binds to unfolded or partially folded proteins and guides proteins to the correct folding pathway by adjusting the state of disulfide bonds. Studies have found that PDIA1 is associated with the occurrence and development of a variety of diseases. In neurodegenerative diseases such as Alzheimer's disease, protein misfolding and aggregation are one of the main pathological features. Dysfunction of PDIA1 may aggravate protein misfolding, thereby promoting the progression of the disease.

[0013] Through public database analysis, the present invention found and verified that the expression abundance of PDIA1 was significantly increased under the pathological conditions of ulcerative colitis. Mice with specific knockout of PDIA1 in intestinal epithelial cells could improve DSS-induced colitis in mice. Overexpression of PDIA1 in the intestinal epithelium using adeno-associated virus AAV2-PDIA1 aggravated DSS-induced enteritis, with large-area ulceration of colon mucosal tissue, widespread disappearance of crypt structures, and destruction of tight junctions between intestinal epithelial cells. We used PDIA1 inhibitors to improve DSS-induced colitis in mice, which can be used to treat ulcerative colitis.

[0014] Specifically, compared with the existing technology, the innovation lies in: The present invention discovered for the first time that PDIA1 is highly expressed in intestinal epithelial cells under the pathological state of ulcerative colitis. Knockout of PDIA1 can improve ulcerative colitis and restore the intestinal epithelial barrier in mice, indicating that PDIA1 is a powerful potential therapeutic target for restoring intestinal barrier function. There is currently no clear target drug for the treatment of ulcerative colitis in clinical practice. Most of the anti-inflammatory therapies use 5-ASA to control inflammation, which fails to restore the intestinal epithelial barrier. The inhibitor provided by the present invention can significantly improve the symptoms of ulcerative colitis, providing a new idea for further studying the pathogenesis of ulcerative colitis and the function of PDIA1 protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The identification of Example 1 shows that PDIA1 protein significantly increases during the progression of ulcerative colitis, where AH is the data analysis of scRNA-seq data (SCP259); I is the immunohistochemical result, and the pathological sections were subjected to immunohistochemical experiments, and the results showed that PDIA1 protein was highly expressed in the intestinal epithelial cells of ulcerative colitis. J is the DAB average area statistical chart of the immunohistochemical results.

[0016] Figure 2 Example 2 PDIA1 is highly expressed in the DSS-induced colitis model in mice, and the expression increases with the aggravation of inflammation. A is a flowchart of the experimental design. B is a photo of the intestinal tissue of the acute colitis model mice; C is the intestinal length statistics of the acute colitis model mice; D is HE staining of acute colitis mice at different time periods; E is immunofluorescence staining of PDIA1 protein and ZO-1 protein; F is the immunofluorescence intensity statistics of PDIA1 protein; G is Western blot analysis of the endoplasmic reticulum stress pathway.

[0017] Figure 3This is Example 3, intestinal epithelial knockdown of PDIA1 improves DSS-induced colitis in mice, wherein A is a flowchart of the experimental design; B is the change in body weight of mice in each group; C is the level of FD4 in serum; D is the statistics of intestinal tissue length of acute colitis model mice; E is a photo of intestinal tissue of acute colitis model mice; F is HE staining of acute colitis mice in different groups; G is Alcian blue staining; H is Western blot analysis of intestinal epithelial tight junction proteins; I is qRT-PCR detection of mRNA levels of endoplasmic reticulum stress pathways Xbp1 and Atf6.

[0018] Figure 4 Example 4 Enema of AAV2 containing PDIA1 significantly exacerbated DSS-induced colitis in mice. A is the experimental design flow chart; B is the change in body weight of mice in each group; C is the level of FD4 in serum; D is the level of PDIA1 in the serum of mice in each experimental group; E is a photo of intestinal tissue of mice with acute colitis model; F is length statistics.

[0019] Figure 5 Example 5: CCF642, an inhibitor of PDIA1, can significantly improve DSS-induced colitis in mice. A is a flowchart of the experimental design; B is the change in the weight of mice in each group; C is the disease activity index score of mice in each group; D is the level of FD4 in the serum of mice in each experimental group; E is a photo of the intestinal tissue of mice with acute colitis model; F is the length statistics; G is HE staining of mice with acute colitis in different groups; H is the result of immunohistochemical staining of PDIA1 protein; I is Western blot analysis of intestinal epithelial tight junction proteins and endoplasmic reticulum stress pathway-related proteins. DETAILED DESCRIPTION

[0020] The present invention is further described in detail below in conjunction with examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the technical means used in the following examples and experimental examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used can be obtained from commercial sources.

[0021] Example 1: Identification of a significant increase in PDIA1 protein during disease progression in ulcerative colitis

[0022] 1. Experimental Methods 1.1 scRNA-seq data of intestinal tissues from ulcerative colitis patients and healthy patients (SCP259) To investigate whether PDIA1 is altered in the UC disease state, we performed GO pathway enrichment analysis on the genes upregulated in UC patients relative to HC healthy subjects by using scRNA-seq data of intestinal tissues from UC patients and normal donor HC (SCP259).

[0023] 1.2 Immunohistochemistry of pathological sections of UC patients Intestinal tissue was fixed in 4% paraformaldehyde solution, dehydrated, and finally embedded in paraffin. Serial sections (6 μm) were cut, antigen retrieval was performed with sodium citrate, membranes were broken with 0.2% Triton X-100, endogenous peroxidase inhibitors were blocked with 5% BSA for 1 hour, and then incubated with primary antibodies at 4°C overnight. After overnight incubation with primary antibodies and washing, the corresponding secondary antibodies were incubated, and finally DAB was used for color development and hematoxylin was used for nuclear staining.

[0024] 2. Experimental Results like Figure 1 As shown in AD, we analyzed the scRNA-seq data set and found that the genes of the endoplasmic reticulum stress (ER stress) pathway were highly expressed in UC patients compared with the normal control group. We further found that the P4HB gene (encoding PDIA1 protein) involved in regulating the endoplasmic reticulum stress pathway was highly expressed by intersecting with the mouse data ( Figure 1 E), and the P4HB gene is expressed more in intestinal epithelial cells in the inflammatory sites of UC patients ( Figure 1 FH), we further showed through immunohistochemical staining that PDIA1 was highly expressed in the intestinal epithelial cells of UC patients compared with healthy controls, and the specific difference was significant ( Figure 1 IJ).

[0025] Example 2: PDIA1 is highly expressed in the DSS-induced colitis model in mice, and its expression increases with the aggravation of inflammation

[0026] 1. Experimental Methods 1.1 Construction of DSS-induced colitis model in mice The DSS (Dextran Sulfate Sodium)-induced colitis model in mice is a commonly used animal model of ulcerative colitis (UC). We used an acute model and selected healthy adult male mice C57BL / 6J. We dissolved DSS powder in drinking water to prepare 2.5% DSS to ensure that the mice could drink freely. After drinking 2.5% DSS for 7 days, the mice were switched to water for two days. We collected samples at different time points of DSS drinking (Day 0, Day 3, Day 5, Day 7 and Day 9) and weighed the mice regularly. Weight loss is one of the typical symptoms of colitis.

[0027] 1.2 HE staining experiment After the paraffin sections of tissue samples were dewaxed and hydrated, they were first stained with hematoxylin, and then the sections were placed in 1% hydrochloric acid alcohol for differentiation until the cell nuclei were clearly visible, then stained with eosin, and finally dehydrated and sealed with neutral resin.

[0028] 1.3 Immunofluorescence experiments Dewaxing and hydration of tissue paraffin sections: put the sections into xylene for 30 minutes, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, 95% ethanol for 5 minutes, 85% ethanol for 5 minutes, and 75% ethanol for 5 minutes, and then wash with distilled water. Antigen repair was performed with citric acid repair buffer, endogenous peroxidase was blocked with 3% hydrogen peroxide solution, and 3% goat serum was blocked at room temperature for 30 minutes. Incubate the primary antibody, add the primary antibody diluted with antibody diluent to the sections, incubate overnight at 4°C, and incubate the poly-HRP secondary antibody the next day. The poly-HRP goat anti-mouse / rabbit universal secondary antibody is ready-to-use (AFIHC001), and the concentrated fluorescent dye is mixed with TSA buffer at a ratio of 1:50-1:200. The prepared TSA fluorescent dye reaction solution is added to the sections to evenly cover the tissue and react at room temperature for 1-15 minutes. DAPI counterstains the cell nucleus, and the anti-fluorescence quencher is used to seal the sections, and nail polish is added around.

[0029] Experimental Results As the number of days of DSS drinking increased, the colon damage of mice worsened, manifested as diarrhea, severe blood in the stool, and shortened colon ( Figure 2 AC). According to the analysis of HE staining results, it was found that on the 5th day, the colon mucosal tissue had large-area ulcers, the crypt structure generally disappeared, and a large number of inflammatory cells infiltrated ( Figure 2 D). We found through tissue immunofluorescence staining that as inflammation intensifies, the expression of ZO-1 protein, the main molecule of cell membrane tight junctions, gradually decreases, indicating that the tight junctions between intestinal epithelial cells are destroyed. In contrast, the expression of PDIA1 protein in intestinal epithelial tissue increases with the intensification of inflammation ( Figure 2 EF). We further extracted proteins from mouse colon tissues for western blot analysis and found that as inflammation intensified, the expression of p-PEKR and IRE1 proteins in the endoplasmic reticulum stress pathway also increased, suggesting that high expression of PDIA1 is related to endoplasmic reticulum stress ( Figure 2 G). The above results indicate that the expression of PDIA1 is positively correlated with the occurrence of colitis.

[0030] Example 3: Knockdown of PDIA1 in intestinal epithelium improves DSS-induced colitis in mice

[0031] 1. Experimental Methods 1.1 Construction of PDIA1 intestinal epithelial cell conditional knockout mice We sought to determine the effects of selective knockdown of PDIA1 in intestinal epithelial cells in mice. To investigate whether PDIA1 is essential for intestinal epithelial cell barrier function in the pathogenesis of UC, we used Vilin-Cre transgenic mice to knock down PDIA1 in intestinal epithelial cells and obtain PDIA1 fl / fl Knockdown of PDIA1 by Vilin-Cre fl / fl (Knockdown of PDIA1 chon- / - ) mice. We selected adult male mice for DSS-induced acute colitis model, weighed the mice every day and performed disease activity index (DAI) scoring.

[0032] 1.2 Alcian blue staining experiment Alcian Blue staining is a staining method for detecting acidic mucopolysaccharides and acidic glycoproteins. We use it to detect the degree of mucosal damage in intestinal tissue. After the paraffin sections of intestinal tissue are dewaxed and hydrated, the sections are immersed in Alcian Blue staining solution, which is usually a 1% Alcian Blue solution prepared in acetate buffer at pH 2.5. The staining time depends on the concentration of the staining solution and the type of sample, usually 30 minutes to several hours. Gently rinse the sections with distilled water to remove unbound dye. Dehydrate the sections through a series of different concentrations of ethanol (from 70% to 100%). Treat the dehydrated sections with xylene to make them transparent. Use a suitable mounting medium (such as neutral gum) to mount the sections.

[0033] 2. Experimental Results To verify the role of PDIA1 in the progression of enteritis, we constructed mice with conditional knockout of PDIA1 in intestinal epithelial cells. In the DSS-induced acute enteritis model, data such as mouse body weight (Figure 3A-B), colon length (Figure 3D-E), and intestinal permeability (Figure 3C) showed that conditional knockout of PDIA1 in the intestinal epithelium could significantly improve the enteritis symptoms of mice. Further pathological analysis showed that knockout of PDIA1 could significantly inhibit the deterioration of enteritis (Figure 3F) and effectively restore the mucus barrier of mice (Figure 3G-H). QPCR results of mouse colon tissues also showed that wild-type mice had severe epithelial damage after DSS induction, and the expression of endoplasmic reticulum stress pathway proteins Xbp1 and Atf6 increased, while knockout of PDIA1 could effectively inhibit these injuries.

[0034] Example 4: Enema of PDIA1-expressing AAV2 significantly exacerbated DSS-induced colitis in mice

[0035] 1. Experimental Methods Rectal enema of adeno-associated virus AAV2 overexpressing PDIA1 in mice To determine whether overexpression of PDIA1 can aggravate the DSS-induced colitis model in mice, we selected rectal enema recombinant AAV2-PDIA1 (pcAAV-CMV-P4hb-HA-P2A-GdGreen-WPRE, P4hb is the gene name of PDIA1) for in vivo overexpression of PDIA1. AAV2-PDIA1 was purchased from Obio Technology (Shanghai) Corp., Ltd (China).

[0036] The preparation method of AAV2-PDIA1 is as follows: During the preparation process, the PDIA1 gene is first (atgctg cgccgcgctc tgctgtgcct ggccgtggcc gccctggtgc gcgccgacgccccgaggag gaggaccacg tcctggtgct gcggaaaagc aacttcgcgg aggcgctggc ggcccacaagtacctgctggt tgccccttgg tgtggccact gcaaggctct ggcccctgag tatgccaaagccgctgggaa gctgaaggca gaaggttccg agatcaggtt ggccaaggtg gacgccacgg aggagtctgacctggcccag cagtagcggc tgcgcggcta tcccaccatc aagttcttca ggaatggaga cacggctcccccaaggaat atacagctgg cagagaggct gatgacatcg tgaactggct gagaagcgc acgggcccggctgccaccac cctgcctgac ggcgcagctg cagagtcctt ggtggagtcc agcgaggtgg ctgtcatcggctcttcaag gacgtggagt cggactctgc caagcagttt ttgcaggcag cagaggccat cgatgacataccatttggga tcacttccaa cagtgacgtg ttctccaaat accagctcga caaagatggg gttgtcctctttaagaagtt tgatgaaggc cggaacaact ttgaagggga ggtcaccaag gagaacctgc tggactttatcaaacacaac caccccgctg ttgtcatcga gttcaccgag cagacagccc cgaagattt tggaggtgaaatcaagactc acatcctgct gttcttgccc aagagtgtgt ctgactatga cggcaaactg agcaacttcaaaacagcagc cgagagcttc aagggcaaga tcctgttcat cttcatcgac agcgaccaca ccgacaaccagcgcatcctc gagttctttggcctgaagaa ggaagagtgc ccggccgtgc gcctcatcac cctggaggaggagatgacca agtacaagcc cgaatcggag gagctgacgg cagagaggat cacagagttc tgccaccgcttcctggaggg caaaatcaag ccccacctga tgagccagga gctgccggag gactgggaca agcagcctgtcaaggtgctt gttgggaaga actttgaaga cgtggctttt gatgagaaaa aaaacgtctt tgtggagttctatgccccat ggtgtggtca ctgcaaacag ttggctccca tttgggataa actgggagag acgtacaaggaccatgagaa catcgtcatc gccaagatgg actcgactgc caacgaggtg gaggccgtca The recombinant plasmid aagtgcacagcttccccaca ctcaagttct ttcctgccag tgccgacagg acggtcattg attacaacgg ggaacgcacgctggatggtt ttaagaaatt cctggagagc ggtggccagg atggggcagg ggatgatgac gatctcgaggacctggaaga agcagaggag ccagacatgg aggaagacga tgatcagaaa gctgtgaaag atgaactgtaa, see SEQ ID NO.1) was cloned into the vector H36160 pcAAV-CMV-P4hb-HA-P2A-GdGreen-WPRE, and the recombinant expression plasmid and pHelper (carrying adenovirus-derived genes) and pAAV-RC (carrying AAV replication and capsid genes) were co-transfected into AAV-293 cells (providing the trans-acting factors required for AAV replication and packaging). 2-3 days after transfection, recombinant AAV was assembled in packaging cells. After collecting cells, AAV particles were released and recovered in the supernatant. The viral supernatant was then concentrated and purified by density gradient centrifugation and ultrafiltration, and the viral titer was determined by quantitative PCR. We injected 100μL (1.0E+12v.g. / ml AAV) into the intestinal cavity by enema injection into C57BL / 6 wild-type mice (WT). Adeno-associated virus 2 (AAV2-2) expressing PDIA1 in intestinal epithelial cellsPDIA1) or control AAV2 (AAV2-NC).

[0037] 2. Experimental Results In the DSS-induced acute enteritis model, the weight of mice (Figure 4A-B), colon length (Figure 4D-E), and intestinal permeability (Figure 4C) showed that overexpression of PDIA1 in the intestinal epithelium could aggravate the enteritis symptoms of mice. The serum ELISA experiment of mice proved the success of our overexpression of PDIA1 (Figure 4F).

[0038] Example 5: PDIA1 inhibitor CCF642 can significantly improve DSS-induced colitis in mice

[0039] 1. Experimental Methods Mouse intestinal permeability assay Intestinal permeability detection Before the end of the DSS model experiment, mice were fasted and deprived of water for 4 h, and then gavaged with 200 μL 60 mg / mL FITC-dextran (600 mg / kg). Blood was collected from the orbital vein 4 h later, and the FITC-dextran content in the serum was measured using a fluorescent microplate reader (Ex: 485 nm, Em: 535 nm).

[0040] 2. Experimental results We used pharmacological inhibition to explore the role of PDIA1 in the DSS-induced colitis model by intraperitoneal injection of the PDIA1 inhibitor CCF642 (purchased from Selleck) (Figure 5A). Through the weight and disease index score (DAI) of mice, we found that the weight loss of mice in the PDIA1 inhibitor CCF642-treated group was smaller, the DAI was lower, and it was dose-dependent ( Figure 5 BC). Intestinal barrier permeability experiments showed that inhibition of PDIA1 could reduce DSS-induced colon permeability in mice ( Figure 5 D). Compared with the model group, the colon length of mice in the drug-treated group was smaller and longer ( Figure 5 EF). Furthermore, H&E staining of pathological sections showed that the degree of tissue damage in the drug-treated group was low, and the morphology of colon epithelial cells remained intact and clear ( Figure 5 G). Immunohistochemical staining results showed that PDIA1 was highly expressed in the DSS model group and decreased after drug treatment ( Figure 5 H). Colon tissues of mice were taken and proteins were extracted for western blot detection. The results showed that the expression of ZO-1 and E-cadherin proteins in the colon of mice in the DSS group was reduced, and recovered after administration. At the same time, the endoplasmic reticulum stress pathway p-PEKR and IRE1 proteins were detected, and it was found that the expression increased in the model group, and the protein decreased after administration ( Figure 5I). The above results indicate that PDIA1 has the function of destroying the intestinal barrier in DSS-induced enteritis, and inhibition of PDIA1 can effectively alleviate the destruction of the intestinal barrier.

Claims

1. Application of PDIA1 protein as a drug screening target in the preparation of drugs for the treatment of ulcerative colitis.

2. Use of PDIA1 protein itself, PDIA1 protein inhibitor CCF642 or PDIA1 overexpression recombinant plasmid in the preparation of a drug for treating ulcerative colitis, wherein: CCF642。 3. The use according to claim 2, characterized in that: The PDIA1 overexpression recombinant plasmid is pcAAV-CMV-P4hb-HA-P2A-GdGreen-WPRE.

4. Application of PDIA1 protein in the preparation of biomarkers for intestinal epithelial barrier disruption.

5. Application of PDIA1 protein in the preparation of diagnostic reagents for ulcerative colitis.

Images