Bacillus thuringiensis fur gene knockout strain, construction method and application thereof
By constructing a Bacillus thuringiensis fur gene knockout strain, the shortcomings of Bacillus thuringiensis in melanin production and siderophore production were solved, achieving efficient production of catechol-type siderophores and melanin, enhancing the cell's radiation resistance and metal chelation ability, and expanding its application in agriculture, bioremediation and medicine.
Patent Information
- Application Number
- CN202411975820.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2025-12-16
- Estimated Expiration
- 2044-12-31
AI Technical Summary
In the existing technology, the application of Bacillus thuringiensis in melanin production and siderophore production has not been fully developed, especially the knockout method through genetic engineering has not been reported.
A Bacillus thuringiensis fur gene knockout strain was constructed. The homologous arm of the fur gene was amplified by overlap extension PCR, and gene knockout was performed using bacterial homologous recombination technology. Combined with multiple crossover and plasmid elimination steps, a strain capable of efficiently producing melanin and siderophores was obtained.
This study enabled Bacillus thuringiensis to efficiently produce catechol-type siderophores and melanin, enhancing the cells' radiation resistance and metal chelating ability, and expanding its application potential in agriculture, bioremediation, and medicine.
Smart Images

Figure CN119823927B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of bacterial genetic engineering, and particularly relates to a Bacillus thuringiensis fur gene knockout strain, a construction method thereof and application thereof in melanin production and siderophore production. BACKGROUND
[0002] Bacillus thuringiensis, abbreviated as Bt, was first discovered by Ishiwata in 1902, who reported a microorganism that infected the domestic silkworm and caused damage to the Japanese silk industry. As a microbial insecticide, Bt has been widely used in the prevention and control of pests in agriculture and forestry due to its strong insecticidal effect, non-toxicity to human health, no environmental pollution by byproducts, and no harm to beneficial organisms.
[0003] Melanin is a brown-black pigment, and some bacteria, fungi, plants and animals in nature have the ability to form melanin. It is a complex biological macromolecule composed of various phenolic and indole monomers. Its composition is complex and diverse, and may contain protein molecules or doped carbohydrate molecules, which have not been fully studied. Melanin has the ability to absorb most visible light and plays a role in photoprotection in cells. The production of melanin can effectively absorb ultraviolet light and ionizing radiation, thereby effectively protecting cells from these harmful external stresses and improving the radiation resistance of cells. In addition, melanin can also chelate metal ions, resist oxidation, transfer electrons, convert energy, and resist viruses. Therefore, melanin plays a very important role in bacterial metabolism and physiological functions.
[0004] According to the chemical structure and iron chelating groups of siderophores, siderophores can be divided into three categories: hydroxamate, catecholate and carboxylate, among which hydroxamate is the most common in nature. Most hydroxamate groups are composed of C(=O)N-(OH)R, wherein R is an amino acid or its derivative, such as Desferrioxamine (DFO). The two oxygen atoms of each hydroxamate group form a bidentate ligand, so each siderophore can form a hexadentate octahedral complex with Fe 3+ . Catechol-type siderophores are commonly found in intestinal bacteria and are composed of catechol and hydroxyl groups, Fe 3+ . Carboxylate-type siderophores are commonly found in Gram-positive bacteria and are composed of carboxyl groups, Fe 3+It can bind to adjacent catechol or hydroxyl group, chelate with iron through two oxygen atoms to form a six-tooth octahedral complex. The siderophores produced by bacteria have significant diversity in chemical structure. Siderophores can chelate a variety of metals, including biological metals and toxic, radioactive metals, although the affinity for some metals is low. This makes it attractive in the fields of agriculture, bioremediation, medicine, etc. In agriculture, siderophores can be used as fertilizers, pesticides and pathogen control agents; in bioremediation, help purify the environment; in medicine, have therapeutic, drug delivery, imaging and anticancer potential. Therefore, the siderophores produced by bacteria have broad prospects and high research value.
[0005] Based on this, the application first proposes a construction method of a Bacillus thuringiensis fur gene knockout strain and application of the modified strain in melanin and siderophore production. SUMMARY
[0006] The purpose of the present application is to provide a Bacillus thuringiensis fur gene knockout strain, and also to provide a construction method thereof and application thereof in melanin and siderophore production.
[0007] To solve the above technical problems, the present application adopts the following technical solutions:
[0008] The Bacillus thuringiensis fur gene knockout strain is obtained by knocking out the fur gene of the genome of Bacillus thuringiensis 97-27.
[0009] The present application also provides a construction method of the Bacillus thuringiensis fur gene knockout strain, comprising the following steps:
[0010] A. Constructing a gene knockout donor strain;
[0011] a1. Taking the Bt 97-27 genome as a template, amplifying the upstream homologous arm and the downstream homologous arm of the fur gene;
[0012] a2. Amplifying the UD sequence of the fur gene by overlap extension PCR, and simultaneously performing enzyme digestion on the upstream homologous arm, the downstream homologous arm and the vector pRP1028 by using a restriction endonuclease, and then connecting by using a ligase to obtain a ligation product;
[0013] a3. Transforming the ligation product into E. coli competence, picking the transformants, and culturing in a liquid medium containing spectinomycin resistance to obtain a successfully constructed knockout donor strain;
[0014] B. First single exchange;
[0015] The donor strain pRP1028-furUD / DH5α, the helper strain pSS1827 / DH5α and the recipient strain Bt 97-27 were respectively cultured in culture medium, wherein the donor strain pRP1028-furUD / DH5α was inoculated in liquid culture medium containing spectinomycin for culture, and the helper strain pSS1827 / DH5α was inoculated in liquid culture medium containing ampicillin for culture;
[0016] After being cultured to the same OD value, resuspension was performed, and then the three were mixed in equal proportions and inoculated on an antibiotic-free plate for culture. After a period of culture, the bacterial lawn was transferred to an antibiotic-free liquid culture medium, mixed, and then inoculated on a plate containing spectinomycin and polymyxin resistance for culture. After culture, red colonies growing on the plate were picked and inoculated in a liquid culture medium containing spectinomycin and polymyxin resistance for culture, to obtain a bacterial solution;
[0017] C. Elimination of plasmid;
[0018] The bacterial solution obtained in step B was inoculated in a liquid culture medium containing spectinomycin and polymyxin resistance for culture. Inoculation was performed once every 6-8 hours, and the bacterial solution was inoculated for three times, to obtain a plasmid-eliminated bacterial solution;
[0019] D. Positive transformant detection;
[0020] The plasmid-eliminated bacterial solution was inoculated on a plate containing spectinomycin and polymyxin resistance for culture. After culture, single colonies were picked and inoculated in a liquid culture medium containing spectinomycin and polymyxin resistance for culture, to screen and detect the Bt 97-27 strain with successful first single exchange for preservation;
[0021] E. Second single exchange;
[0022] The donor strain pSS4332 / DH5α, the Bt 97-27 strain with successful first single exchange, and the helper strain pSS1827 / DH5α were respectively cultured, wherein the donor strain pSS4332 / DH5α and the helper strain pSS1827 / DH5α were inoculated in liquid culture medium containing kanamycin for culture, and the Bt 97-27 strain with successful first single exchange was inoculated in culture medium containing spectinomycin and polymyxin for culture. After culture, the three strains were washed with antibiotic-free LB, and then mixed in equal proportions and inoculated on an antibiotic-free plate for culture. After a period of culture, the bacterial lawn was transferred to an antibiotic-free liquid culture medium, mixed, and then inoculated on a plate containing kanamycin and polymyxin resistance for culture. After culture, the transformants were inoculated in a culture bottle, and after overnight culture, streak isolation was performed on a solid plate containing kanamycin and polymyxin resistance;
[0023] F. Positive clone screening;
[0024] The single colonies separated by streaking are inoculated on solid plates containing kanamycin and polymyxin-resistant solid plates and solid plates containing spectinomycin and polymyxin, respectively, and colonies resistant to kanamycin but not spectinomycin are picked and cultured in liquid medium containing kanamycin and polymyxin, and then genomic DNA is extracted and verified by PCR;
[0025] G. Plasmid elimination;
[0026] The verified positive clones are inoculated into antibiotic-free medium in proportion and cultured, and then subcultured for more than 10 times, and single colonies are separated by streaking on antibiotic-free plates and inoculated on antibiotic-free medium and plates containing kanamycin, respectively, and colonies without kanamycin resistance are selected as colonies successfully eliminating plasmids, i.e., fur-knockout strains.
[0027] Further, in step a1, the upstream homologous arm of the fur gene is obtained by amplification using the forward primer furUF and the reverse primer furUR upstream of the fur gene; the nucleotide sequence of furUF is shown in SEQ ID NO. 1, and the nucleotide sequence of furUR is shown in SEQ ID NO. 2.
[0028] In step a2, the downstream homologous arm of the fur gene is obtained by amplification using the forward primer furDF and the reverse primer furDR downstream of the fur gene; the nucleotide sequence of furDF is shown in SEQ ID NO. 3, and the nucleotide sequence of furDR is shown in SEQ ID NO. 4.
[0029] Further, in step a3, the liquid medium containing spectinomycin is LB liquid medium containing spectinomycin, and the final concentration of spectinomycin is 300 μg / mL.
[0030] Further, step B is specifically:
[0031] The final concentration of spectinomycin in the culture medium of the donor strain pRP1028-fur UD / DH5α is 300 μg / mL, and the final concentration of ampicillin in the culture medium of the helper strain pSS1827 / DH5α is 100 μg / mL.
[0032] The donor strain pRP1028-fur UD / DH5α, the helper strain pSS1827 / DH5α and the recipient strain Bt 97-27 are cultured to the same OD 600=0.8, resuspended in LB without antibiotics, mixed in equal proportion, and then inoculated on LB plates without antibiotics. After that, the whole bacterial lawn was transferred into LB liquid medium without antibiotics, mixed, and then evenly spread on LB plates containing 300 μg / mL spectinomycin and 60 units of polymyxin. After culture, red colonies were picked and transferred into LB liquid medium containing 300 μg / mL spectinomycin and 60 units of polymyxin, and cultured at 200 rpm and 28°C to obtain a bacterial solution.
[0033] Further, step C is specifically as follows:
[0034] The bacterial solution obtained in step B was inoculated into LB liquid medium containing 300 μg / mL spectinomycin and 60 units of polymyxin at a ratio of 1:100, and cultured at 37°C. The inoculation was performed once every 6-8 hours, and the bacterial solution without plasmid was obtained after three times of inoculation.
[0035] Step D is specifically as follows:
[0036] The bacterial solution without plasmid was streaked on LB plates containing 300 μg / mL spectinomycin and 60 units of polymyxin to separate single colonies. After overnight culture, single colonies were picked and inoculated into LB liquid medium containing 300 μg / mL spectinomycin and 60 units of polymyxin, and cultured. The genome was extracted, and PCR detection was performed to determine whether the first single exchange was successfully integrated into the genome. The Bt 97-27 strain successfully subjected to the first single exchange was preserved.
[0037] Further, step E is specifically as follows:
[0038] The donor bacteria pSS4332 / DH5α and the helper strain pSS1827 / DH5α were inoculated in culture medium containing 50 μg / mL kanamycin, and the recipient bacteria were the Bt 97-27 strain successfully subjected to the first single exchange. After culture, the three strains were washed with LB without antibiotics, mixed in a ratio of 1:1:1, and then inoculated on LB plates without antibiotics. After that, the bacterial lawn was transferred into LB liquid medium without antibiotics, mixed, and then evenly spread on plates containing 50 μg / mL kanamycin and 60 units of polymyxin resistance. After 3 days of culture, 8-10 transformants were picked and inoculated into PA bottles, and then cultured at 200 rpm and 28°C overnight. The culture was streaked on LB solid plates containing 50 μg / mL kanamycin and 60 units of polymyxin resistance.
[0039] Further, step F is specifically as follows:
[0040] The single colonies separated by the streak line are respectively inoculated on LB solid plates containing a final concentration of 50 μg / mL kanamycin and polymyxin 60 units and a final concentration of 300 μg / mL spectinomycin and polymyxin 60 units, and cultured at 28°C, colonies with kanamycin resistance but without spectinomycin resistance are picked and cultured in liquid LB medium containing a final concentration of 50 μg / mL kanamycin and polymyxin 60 units at 200 rpm and 28°C, genomic DNA is extracted, and PCR verification is performed;
[0041] Step G is specifically:
[0042] The positive clones verified by PCR are inoculated into LB medium without antibiotics at a ratio of 1:100, and cultured, and inoculated into LB medium without antibiotics and LB plates with a final concentration of 50 μg / mL kanamycin resistance for 10 times or more, and single colonies are picked and inoculated into LB plates without antibiotics and with a final concentration of 50 μg / mL kanamycin resistance, and colonies without a final concentration of 50 μg / mL kanamycin resistance are colonies in which the plasmid is successfully eliminated, that is, the Bacillus thuringiensis fur gene knockout strain is obtained.
[0043] In addition, the application also provides the use of the above-mentioned Bacillus thuringiensis fur gene knockout strain in the production of siderophores.
[0044] The use of the Bacillus thuringiensis fur gene knockout strain in the production of melanin is also provided.
[0045] The above technical solution provides a method for producing melanin and siderophores in the Bacillus thuringiensis fur gene knockout strain; and a method for obtaining a knockout strain of Bacillus thuringiensis by knocking out the iron uptake regulatory protein (fur) gene, so that the knockout strain can produce melanin and siderophores.
[0046] The Bacillus thuringiensis fur gene knockout strain provided in the above technical solution can produce catechol siderophores, and the highest concentration of siderophores within 48 h is 0.50 mM; for melanin, the OD 400 It continuously increases from 24 h to 168 h, and reaches 3.10. BRIEF DESCRIPTION OF DRAWINGS
[0047] Figure 1 It is a schematic diagram of the I-SceI enzyme-mediated gene knockout method in Bacillus thuringiensis;
[0048] Figure 2 It is the production of siderophores by Bt 97-27 and Δfur strains on CAS plates;
[0049] Figure 3 It is a siderophore type identification result graph;
[0050] Figure 4 2,3-dihydroxybenzoic acid standard curve;
[0051] Figure 5 Δfur siderophore production curve;
[0052] Figure 6 Color of bacterial solution over time;
[0053] Figure 7 Infrared absorption spectra of Δfur melanin and standard melanin;
[0054] Figure 8 Melanin standard curve;
[0055] Figure 9 Melanin production curve of Δfur strain;
[0056] Figure 10 ROS results plot of Bt 97-27 and Δfur strains at 1, 3, and 7;
[0057] Figure 11 Results plot of Bt 97-27 and Δfur strains under scanning electron microscope. DETAILED DESCRIPTION
[0058] In order to make the objects and advantages of the present application clearer, the following will specifically describe the present application with reference to examples. It should be understood that the following text is only used to describe one or several specific embodiments of the present application, and does not strictly limit the specific protection scope of the present application.
[0059] Example 1
[0060] Obtaining of Bacillus thuringiensis 97-27 Δfur
[0061] (1) Construction of gene knockout donor strain: the upstream homologous arm of the fur gene was amplified using the fur gene upstream forward primer furUF (GGGGTACCCAAGACCGTGTAATGTCTCA) and the fur gene upstream reverse primer furUR (GGAAAAGGTCGGTACTACTCCCTCCTCGCCAC) as templates; the downstream homologous arm of the fur gene was amplified using the fur gene downstream forward primer furDF (AGTACCGACCTTTTCCTATTTAACTAGGAAGA) and the fur gene downstream reverse primer furDR (CGGGATCCCTCGTCATTTTTGGTGTCTG).
[0062] Then the UD sequence of the gene is amplified by overlap extension PCR using furUF and furDR primers and the upstream and downstream sequences of the gene, the upstream homologous arm is cut with restriction endonuclease Kpn I and BamH I, the downstream homologous arm is cut with restriction endonuclease Kpn I and BamH I, the vector pRP1028 is cut with restriction endonuclease Kpn I and BamH I at both ends, and then the upstream and downstream homologous arms and the vector fragment are ligated with T4 ligase. The obtained ligation product is transformed into E. coli competent cells, the transformants are picked and inoculated in LB liquid medium (containing a final concentration of 300 μg / mL) resistant to spectinomycin (Spc) for 12 h, and the plasmid is extracted for sequencing. The sequencing results are compared and aligned, and the correct sequencing results are obtained, and finally the knockout vector strain is constructed successfully.
[0063] (2) First single exchange: the donor strain pRP1028-furUD / DH5α (containing a final concentration of 300 μg / mL Spc), the helper strain pSS1827 / DH5α (containing a final concentration of 100 μg / mL Amp), and the recipient strain Bt 97-27 are cultured to the same OD 600 = 0.8, resuspended with fresh antibiotic-free LB, mixed at a ratio of 1:1:1, and then directly added to antibiotic-free LB plates. After 24 h of culture, the entire bacterial lawn is scraped with a gun head and transferred to antibiotic-free liquid LB, mixed uniformly, and then plated on LB plates containing a final concentration of 300 μg / mL spectinomycin and polymyxin 60 units (Spc+Pmx). After 4-6 days of culture, red colonies growing on the plate are picked and transferred to liquid LB containing a final concentration of 300 μg / mL spectinomycin and polymyxin 60 units (Spc+Pmx) (6-8 colonies are picked per PA bottle) and cultured at 200 rpm and 28°C.
[0064] (3) Eliminate plasmid: the bacterial solution obtained by culturing at 28°C in the previous step is transferred to liquid LB medium containing a final concentration of 300 μg / mL spectinomycin and polymyxin 60 units (Spc+Pmx) at a ratio of 1:100 and cultured at 37°C. Transfer once every 6-8 h, and transfer three times (pRP1028 plasmid is a temperature-sensitive plasmid in Bt 97-27, which is easily lost at 37°C. After the plasmid is lost, the original strain Bt 97-27 cannot grow in the culture medium resistant to Spc+Pmx).
[0065] (4) Positive transformant detection: streak the plasmid-cured bacteria on LB plates containing a final concentration of 300 pg / mL spectinomycin and polymyxin 60 units (Spc+Pmx), and after overnight incubation, pick single colonies into liquid LB medium containing a final concentration of 300 pg / mL spectinomycin and polymyxin 60 units (Spc+Pmx) and incubate for 12 h. Extract the genome and perform PCR to detect whether the first single crossover has been successfully integrated into the genome. Save the first single crossover successful Bt 97-27 (containing a final concentration of 300 pg / mL spectinomycin and polymyxin 60 units Spc+Pmx) strain.
[0066] (5) Second single crossover: inoculate the donor bacteria pSS4332 / DH5a (the donor bacteria pSS4332 / DH5a is realized by the published operating method of Zheng Cao.Functional analysis of the sporulation-specific diadenylate cyclase CdaS in Bacillus thuringiensis.Frontiers in Microbiology, refer to pages p2-p3 for details) into liquid LB medium containing a final concentration of 50 pg / mL kanamycin (Kan), the recipient bacteria first single crossover successful Bt 97-27 (containing a final concentration of 300 pg / mL spectinomycin and polymyxin 60 units Spc+Pmx), and the helper strain pSS1827 / DH5a (Kan). After incubation, wash with antibiotic-free LB, then mix in a ratio of 1:1:1 and directly add to antibiotic-free LB plates. After 24 h, scrape the bacterial lawn and transfer to antibiotic-free liquid LB, then mix and evenly spread on plates resistant to a final concentration of 50 pg / mL kanamycin and polymyxin 60 units (Kan+Pmx). After 3 d of incubation, pick 8-10 transformants and inoculate into PA bottles, incubate at 200 rpm and 28°C overnight, then streak on LB solid plates resistant to a final concentration of 50 pg / mL kanamycin and polymyxin 60 units (Kan+Pmx).
[0067] (6) Positive clone screening: inoculate the single colonies corresponding to the streaked separation on LB solid plates containing a final concentration of 50 pg / mL kanamycin and polymyxin 60 units (Kan+Pmx) and a final concentration of 300 pg / mL spectinomycin and polymyxin 60 units (Spc+Pmx) at 28°C. Pick colonies resistant to Kan but not SPC on liquid LB medium containing a final concentration of 50 pg / mL kanamycin and polymyxin 60 units (Kan+Pmx) and incubate at 200 rpm and 28°C. Extract the genome and perform PCR verification.
[0068] (7) Plasmid elimination: The correct positive clones were verified and inoculated into LB medium without antibiotics for 8 h, and then inoculated into LB medium without antibiotics for 10 times or more, and then streaked on LB plates without antibiotics. Single colonies were picked and inoculated into LB plates without antibiotics and with a final concentration of 50 μg / mL kanamycin (Kan) resistance. Colonies without a final concentration of 50 μg / mL kanamycin (Kan) resistance were colonies successfully eliminated of plasmids (remember to keep the bacteria before plasmid elimination, because the number of transfer times is large, to prevent contamination during the transfer process). The fur knockout strain (Δfur) was obtained. The whole gene knockout process is shown in Figure 1 .
[0069] Example 2
[0070] Solid plate of siderophore and qualitative experiment of siderophore type
[0071] Chromazurol S agar plate method is usually used to qualitatively detect whether bacteria can produce siderophores. Bt 97-27 and Δfur strains were inoculated overnight. CAS-LB double-layer plates were prepared and sterilized at 115°C for 20 min. The lower layer was poured with CAS plates, and the upper layer was poured with LB plates. Sterilized 6 mm filter paper pieces were placed on the poured plates, and 10 μL of bacterial solution was inoculated on each filter paper piece for each Bt strain. The plates were incubated in a 28°C incubator for 2-5 days, and the color change of the lower CAS plate was observed. If an orange-yellow circle appeared around the filter paper piece, it indicated the production of siderophores.
[0072] The results of the chromazurol S agar plate method showed that only the Δfur knockout strain could form an orange-yellow light circle at the bottom of the CAS plate as shown in Figure 2 , indicating that the Δfur knockout strain could form siderophores.
[0073] The type of siderophore can be determined by the coloration after reaction with different chemical reagents. Generally, the type of siderophore can be determined by the following three experiments:
[0074] 1) FeCl3 experiment: 1 mL of cell-free supernatant was mixed with 200 μL of 100 mM FeCl3. If the solution color changed to orange, it indicated the presence of trihydroxy hydroxamic acid type siderophore. If the color appeared pink, it indicated the presence of dihydroxy hydroxamic acid type siderophore. If there was no color change, it was considered to be other types of siderophore;
[0075] 2) Ferric perchlorate experiment: 2.5 mL of ferric perchlorate solution was added to 0.5 mL of cell-free supernatant, and then mixed well by vigorous shaking and left at room temperature. The color change was observed. If the solution color changed to red or orange, it indicated the presence of hydroxamic acid type siderophore. If there was no color change, it was considered to be other types of siderophore;
[0076] 3) Arnow experiment: 1 mL of 0.5M HCl and 1 mL of molybdate solution were added to 1 mL of cell-free supernatant. If there was catechol structure in the supernatant, the color would turn yellow. After standing at room temperature for 2-3 min, 1 mL of 1M NaOH solution was added and the color change was observed. If the color turned red and did not fade for a long time, it proved to be catechol siderophore.
[0077] The identification steps of siderophore type were as follows: after Bt 97-27 and Δfur strains were cultured in LB medium for 8 h, the bacterial supernatant was subjected to FeCl3, ferric perchlorate and Arnow experiments. Except for the Δfur knockout strain, the supernatant of the other four Bt strains did not change in color after the reagents were added in the Arnow experiment, indicating that catechol siderophores could not be produced. In the other two experiments, the color of the supernatant of Bt 97-27 and Δfur strains changed compared with the negative control, but it could not be determined whether oxygen oxime acid type siderophore or hydroxamic acid type siderophore was generated. Only the Δfur knockout strain changed the color of the cell-free supernatant to red and did not fade for a long time as shown in Figure 3 , which was consistent with the characteristics of catechol siderophore, indicating that the Δfur knockout strain could indeed produce siderophore, and the type of siderophore was catechol siderophore.
[0078] The Arnow experiment can quantitatively determine catechol siderophores. First, the standard curve of the Arnow experiment was prepared: 0.0154 g of 2,3-dihydroxybenzoic acid (DHBA) was dissolved in 100 mL to obtain a 1 mM stock solution, which was diluted to 0.1, 0.2, 0.3, 0.4, 0.5, 0.6 and 0.7 mM, respectively. 1 mL of 2,3-dihydroxybenzoic acid solution with different concentration gradients was subjected to Arnow experiment, and the absorbance value at 510 nm was detected and recorded. The standard curve is shown in Figure 4 After activation, the bacteria were transferred to 50 mL of LB medium at an initial OD 600 = 0.01, and sampled every 4 h for quantitative determination of OD 510 by Arnow experiment, and the production of siderophores by bacteria at different time periods was monitored. The siderophore production curve was plotted according to the siderophore production of bacteria at different time periods.
[0079] Figure 4 The standard curve of 2,3-dihydroxybenzoic acid in the Arnow experiment is shown in the figure. The OD 510 of the solution in the curve is linearly related to the concentration of 2,3-dihydroxybenzoic acid (DHBA), and the slope and intercept are shown in the figure, R 2 reached 0.9991. The content of catechol siderophore in the Δfur knockout strain calculated according to the standard curve is shown in Figure 5The siderophore content of the Δfur knockout strain increased continuously from 12 to 48 hours, with a significant increase in siderophore production from 12 to 24 hours (P<0.05), followed by a slower increase from 24 to 48 hours. The highest siderophore concentration was 0.50 mM at 48 hours. The siderophore content gradually decreased from 48 to 96 hours. This indicates that siderophore production does not increase indefinitely with prolonged culture time.
[0080] Example 3
[0081] Melanin color development, extraction, characterization and yield determination
[0082] The color development of the knockout strains was achieved by overnight activation culture of Bt 97-27 and Δfur knockout strains, followed by the preparation of several portions of liquid LB medium, which were then sterilized at high temperature. The activated bacterial solutions were then cultured according to their initial OD values. 600 =0.01 was added to 50 mL of LB medium and cultured in a constant temperature shaker at 28 °C and 200 rpm.
[0083] Based on the results of liquid LB culture for 1 and 3 days, such as Figure 6 It can be seen that, when cultured in normal LB medium, the Δfur knockout strain has a darker cell color compared to the Bt97-27 strain.
[0084] Since only the Δfur knockout strain can produce melanin, only its characteristics were analyzed. 50 mL of bacterial culture from the Δfur strain was collected in a centrifuge tube, centrifuged at 8000 rpm for 15 min at 4°C, the bacterial cells were removed, and the supernatant was retained. NaOH was added to adjust the pH to 13, and then 1 M HCl was added to adjust the pH to 2. The mixture was left to stand at room temperature for 4 h to allow the melanin to precipitate naturally. After centrifugation at 10000 rpm for 30 min, the supernatant was removed, and the precipitate was retained. After drying at room temperature, the precipitate was ground to obtain a solid melanin powder. The bacterial melanin sample and purchased melanin standards were sent to the company. The melanin powder was treated with KBr, pressed into pellets, and then analyzed by Fourier transform infrared spectroscopy (FTIR). The FTIR spectral range was 400-4000 cm⁻¹. -1 .
[0085] like Figure 7 The horizontal axis represents the wavelength range, and the vertical axis "T (%)" represents "transmittance". In infrared spectroscopy, transmittance refers to the proportion of light that passes through the sample to the proportion of light that does not. Higher transmittance indicates less light absorption by the sample. The comparison shows that the melanin produced by the Δfur strain is most effective at wavelengths of 3281.545, 1658.608, and 648.172 cm⁻¹. -1 Absorption peaks were observed at these locations, which corresponded to those of melanin standards at 3218.395, 1620.131, and 647.145 cm⁻¹, respectively. -1The characteristic absorption peak of the melanin has high similarity to that of the synthetic melanin, indicating that the melanin has the same basic framework and main groups as the synthetic melanin.
[0086] The melanin has an absorption peak at 400 nm. First, a melanin standard curve was prepared. 25 mg of melanin (molecular weight 318.28) was added to deionized water to make up to 7.854 mL, at which time the melanin concentration was 10 mM. The 10 mM melanin was diluted to 9, 8, 7, 6, 5, 4, 3, 2, and 1 mM, respectively, and 200 μL of each concentration gradient of melanin was taken and its absorbance at 400 nm was measured by an enzyme marker. The melanin concentration was taken as the x-axis and the OD 400 was taken as the y-axis to prepare a melanin standard curve.
[0087] After OD 400 determination, 8 points were finally retained from the 10 points to obtain a standard curve with R 2 reaching 0.9996. The OD 400 of the solution in the curve was linearly related to the concentration of melanin, and the slope and intercept were as shown in Figure 8 .
[0088] The melanin has an absorption peak at 400 nm, so the absorbance of the bacterial culture at 400 nm can be measured by an enzyme marker to determine whether melanin is formed. Bt 97-27 and Δfur strains were activated overnight for 12 h, and the activated bacterial solution was inoculated into 50 mL of LB medium at an initial OD 600 = 0.01, and cultured at 28°C, 200 rpm on a constant temperature shaker. Every 24 h, 200 μL of bacterial supernatant was taken and its OD 400 was measured. The measured OD 400 was brought into the melanin standard curve to calculate the concentration of melanin.
[0089] As shown in Figure 9 , in the liquid LB culture, the OD 400 of the Δfur knockout strain increased continuously from 24 h, reaching 3.10 mM at 168 h.
[0090] Example 4
[0091] Strain ROS level detection method
[0092] Determination of intracellular ROS of Bt 97-27 and Δfur strains at 1, 3, 7 days, in triplicate. Nanjing Jiancheng Reactive Oxygen Species (ROS) Assay Kit (Chemical Fluorescence Method) (Cat. No. E004-1-1) was used. Light-protected centrifuge tubes and light-protected enzyme-labeled plates were used throughout the experiment. Prepare 200 μL of sample, 100 μM of DCFH-DA, and 0.01 M PBS with pH 7.2 in advance. Centrifuge the sample to obtain bacterial cells, then add 900 μL of PBS and 100 μL of 100 μM DCFH-DA probe, mix well, so that the final concentration of the probe is 10 μM. Incubate at 37°C for 45 min, and turn up and down every 3-5 min to ensure that the probe and bacteria are fully combined. Centrifuge at 1000 rpm for 5 min, wash 1-2 times with PBS, and finally mix with PBS for measurement. The instrument used is SPARK multifunctional full-wavelength enzyme-labeled plate reader. The optimal excitation wavelength is 488 nm, and the optimal emission wavelength is 525 nm.
[0093] As shown in Figure 10 , at 1 and 3 days, the Δfur strain produced more ROS than the Bt 97-27 strain, which may be due to the knockout of the gene, which may change the metabolic pathway of the strain, leading to the accumulation of intermediate products of siderophores. At 7 days, the ROS of the Δfur strain decreased, and at this time the siderophores also completely disappeared and were completely chelated by melanin.
[0094] Example 5
[0095] Strain sample preparation method for scanning electron microscopy
[0096] 4 mL of Bt 97-27 and Δfur bacterial liquid after 7 days of culture were collected, centrifuged at 6000 rpm for 3 min, washed 3-4 times with pH 7.2 phosphate buffer, then the sample was fixed at 4°C with 2.5% glutaraldehyde for 12 h, washed again with pH 7.2 phosphate buffer, and finally dehydrated with 30%, 50%, 70%, 80%, 90% and 100% alcohol, 2 times for each dehydration step, 10-15 min for each dehydration. Then the sample was freeze-dried in a vacuum freeze-dryer for 12 h. After gold plating of the sample powder, it was observed under a microscope and the image was collected. The magnification of the electron microscope photos in the experiment was 5000 and 10000 times.
[0097] As shown in Figure 11 , SEM results analysis showed that the Δfur strain was shorter and wider than the Bt 97-27 strain, which may be due to the knockout of the gene affecting the genes or regulatory factors related to the size of the strain, leading to changes in the growth and reproduction process or morphological structure of the strain.
[0098] The embodiments of the present application are described above in detail with reference to the accompanying drawings, but the present application is not limited to the above-described embodiments, and for those skilled in the art, after learning the contents described in the present application, several equivalent transformations and substitutions can be made without departing from the principles of the present application, and these equivalent transformations and substitutions should also be considered as belonging to the protection scope of the present application.
[0099]
[0100]
Claims
1. A type of Bacillus thuringiensis fur Application of gene knockout strains in melanin production; the Bacillus thuringiensis strain. fur The gene knockout strain is Bacillus thuringiensis (Bt). Bacillus thuringiensis )97-27 Genome Knockout Iron Uptake Regulatory Protein fur Obtained through genes.