Nitrilase mutants and uses thereof

Abstract

The present application provides a nitrilase mutant and its application. Compared with a wild-type nitrilase with an amino acid sequence shown in SEQ ID NO: 2, the nitrilase mutant comprises one or more of the following amino acid mutation sites: S201F, G239M, K242T, V243Q and G246Q. The present application constructs a nitrilase mutant with high enzyme activity, high salt tolerance and high substrate tolerance by mutating and modifying a nitrilase derived from Alcaligenes.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biotechnology, and in particular to a nitrilase mutant and application thereof. BACKGROUND

[0002] Nicotinic acid, also known as water-soluble vitamin B3, is one of the important components in the body, which can promote cell metabolism and maintain the health of the skin, nervous system and digestive system.

[0003] At present, the main methods for industrial production of nicotinic acid include potassium permanganate oxidation method, nitric acid oxidation method, nitric acid-sulfuric acid oxidation method, ammonia oxidation method, etc. The disadvantages of the above methods include high energy consumption, complex reaction process, serious environmental pollution, etc. Therefore, the use of microbial enzyme method to obtain nicotinic acid has attracted attention, and many researchers have continuously explored microorganisms with nitrilase activity and applied them to the preparation of nicotinic acid. However, the application of this method is restricted by many factors, and at present, Escherichia coli is mainly used as the host, which has a long cultivation period and is easy to be contaminated, which is not conducive to whole-cell catalysis, poor stability and poor substrate tolerance.

[0004] Therefore, it is of great significance to further explore nitrilases with high catalytic activity. SUMMARY

[0005] Based on this, one or more embodiments of the present application provide a nitrilase mutant with high catalytic activity and high substrate concentration tolerance and application thereof.

[0006] According to a first aspect of the present application, a nitrilase mutant is provided, which includes one or more of the following amino acid mutation sites: S201F, G239M, K242T, V243Q and G246Q, compared with a wild-type nitrilase with an amino acid sequence as shown in SEQ ID NO: 2.

[0007] In some embodiments, the amino acid mutation sites of the nitrilase mutant include one or more of the following combinations: (1) S201F / G239M, (2) S201F / V243Q, (3) K242T / G246Q, and (4) V243Q / G246Q.

[0008] Alternatively, the amino acid mutation sites of the nitrilase mutant include one or more of the following combinations: (5) S201F / G239M / V243Q, (6) S201F / V243Q / G246Q.

[0009] Alternatively, the amino acid mutation site of the nitrilase mutant comprises one or more of the following combinations: (7) S201F / G239M / V243Q / G246Q; (8) G239M / K242T / V243Q / G246Q.

[0010] According to a second aspect of the present application, a nucleic acid fragment is provided, which encodes the nitrilase mutant described above.

[0011] According to a third aspect of the present application, a recombinant vector is provided, which comprises the nucleic acid fragment described above.

[0012] According to a fourth aspect of the present application, a genetically engineered bacterium is provided, which comprises the nucleic acid fragment described above or the recombinant vector described above.

[0013] In some embodiments, the host cell of the genetically engineered bacterium comprises Vibrio natriegens.

[0014] Alternatively, the Vibrio natriegens comprises Vibrio natriegens ATCC14048.

[0015] According to a fifth aspect of the present application, a method for constructing a genetically engineered bacterium is provided, comprising the following steps:

[0016] introducing the recombinant vector expressing the nitrilase mutant described above into a genetically engineered bacterium to be modified, thereby constructing the genetically engineered bacterium.

[0017] According to a sixth aspect of the present application, an enzyme catalytic preparation is provided, comprising the nitrilase mutant described above and a supplementary material.

[0018] According to a seventh aspect of the present application, a method for preparing nicotinic acid is provided, comprising the following steps:

[0019] using the nitrilase mutant described above, the genetically engineered bacterium described above, or the enzyme catalytic preparation described above to catalyze the synthesis of nicotinic acid from a substrate.

[0020] In some embodiments, the method for preparing nicotinic acid satisfies at least one of the following features:

[0021] (1) the substrate comprises 3-cyanopyridine;

[0022] (2) the concentration of the substrate is 50mM-400mM;

[0023] (3) the pH condition for the catalysis is 5.0-10.0; and

[0024] (4) the reaction temperature for the catalysis is 25℃-55℃.

[0025] Compared with the conventional technology, the present application has the following beneficial effects:

[0026] The present application constructs a nitrilase mutant with high enzyme activity and high salt and substrate tolerance by mutating and reforming a nitrilase derived from Alcaligenes.

[0027] Further, the genetically engineered bacteria prepared by using Vibrio natriegens as a host cell has the advantages of fast growth, short fermentation period, high soluble expression level of protein, and high tolerance to substrate concentration. BRIEF DESCRIPTION OF DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the specific embodiments or prior art of the present application, the drawings needed in the description of the specific embodiments or prior art will be briefly introduced. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative effort.

[0029] Figure 1 Schematic diagram of the reaction of nitrilase NIT 338 catalyzing 3-cyanopyridine to generate nicotinic acid;

[0030] Figure 2 SDS-PAGE protein schematic diagram of the crude enzyme solution prepared by the genetically engineered bacteria expressing wild-type nitrilase NIT 338 in an embodiment of the present application;

[0031] Figure 3 High-performance liquid chromatography detection spectrum of the substrate and product in the reaction of nitrilase NIT 338 catalyzing 3-cyanopyridine to generate nicotinic acid in an embodiment of the present application. DETAILED DESCRIPTION

[0032] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific embodiments of the present application are described in detail. In the following description, a large number of specific details are set forth in order to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without departing from the spirit of the present application, therefore the present application is not limited by the specific embodiments disclosed below.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terms used in the specification of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or can be prepared by existing methods.

[0034] In the present application, "a plurality of", "a plurality of kinds", "a plurality of times", "a plurality of elements" and the like, if not otherwise specified, refer to more than two or equal to two in number. For example, "one or more" means one or more than two.

[0035] In the present application, "further", "still further", "in particular" and the like are used for the purpose of description, and should not be understood as limiting the scope of protection of the present application.

[0036] In the present application, in the technical features described in an open-ended manner, both the closed technical solution consisting of the listed features and the open technical solution containing the listed features are included.

[0037] In the present application, with respect to a numerical interval (i.e. a numerical range), if not otherwise specified, the optional numerical distribution within the numerical interval is considered to be continuous, and includes both numerical end points (i.e. the minimum value and the maximum value) of the numerical range, and every numerical value between the two numerical end points. If not otherwise specified, when a numerical interval refers only to integers within the numerical interval, including both end point integers of the numerical range, and every integer between the two end points, in the present application, it is equivalent to directly listing every integer, for example, t is an integer selected from 1-10, which means that t is any one integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe a feature or a characteristic, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all sub-ranges therein.

[0038] In the present application, the temperature parameter, if not otherwise specified, allows both constant temperature treatment and variation within a certain temperature interval. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuation is allowed within a range such as ±5°C, ±4°C, ±3°C, ±2°C, ±1°C.

[0039] In the present application, % (w / w) and wt% both mean weight percentage, % (v / v) means volume percentage, and % (w / v) means mass volume percentage.

[0040] In the present application, the terms "first", "second", "third", "fourth" and the like in "first aspect", "second aspect", "third aspect", "fourth aspect" and the like are only used for the purpose of description, and should not be understood as indicating or implying relative importance or quantity, nor should it be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth" and the like only serve the purpose of non-exhaustive enumeration description, and should be understood as not constituting a closed limitation on the quantity.

[0041] In a first aspect, the present application provides a nitrilase mutant, wherein the nitrilase mutant comprises one or more of the following amino acid mutation sites: S201F, G239M, K242T, V243Q and G246Q, compared with a wild-type nitrilase having an amino acid sequence as shown in SEQ ID NO: 2.

[0042] The nitrilase mutant obtained by the mutation and modification of the nitrilase derived from Alcaligenes (also known as NIT 338 enzyme) has the advantages of short culture time, high soluble protein expression level, high enzyme activity and high tolerance to substrate concentration; and the nitrilase mutant has high catalytic activity when used for catalyzing the synthesis of nicotinic acid from 3-cyanopyridine.

[0043] It can be understood that the NCBI gene accession number of the nitrilase derived from Alcaligenes is WP_250756555.1; the amino acid sequence thereof is as shown in SEQ ID NO: 2, and the coding gene sequence is as shown in SEQ ID NO: 1.

[0044] In the present application, “S201F” refers to a mutation in which the 201st serine (Serine, abbreviated as S) in the amino acid sequence of the protein is replaced by phenylalanine (Phenylalanine, abbreviated as F); other similar notations herein have similar meanings.

[0045] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises S201F.

[0046] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises G239M.

[0047] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises K242T.

[0048] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises V243Q.

[0049] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises G246Q.

[0050] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises S201F / G239M.

[0051] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises S201F / V243Q.

[0052] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises K242T / G246Q.

[0053] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises V243Q / G246Q.

[0054] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises S201F / G239M / V243Q.

[0055] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises S201F / V243Q / G246Q.

[0056] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises S201F / G239M / V243Q / G246Q.

[0057] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises G239M / K242T / V243Q / G246Q.

[0058] It should be noted that "S201F / G239M" in the present application means that S201F mutation and G239M mutation exist simultaneously, and other same expressions have similar meanings.

[0059] In a second aspect of the present application, a nucleic acid fragment encoding the nitrilase mutant described above is provided.

[0060] In a third aspect of the present application, a recombinant vector comprising the nucleic acid fragment described above is provided.

[0061] In some embodiments, the recombinant vector comprises pET28a plasmid, pET-15b plasmid, pET-21a plasmid, pET-22b plasmid or pET-26b plasmid.

[0062] In a fourth aspect of the present application, a genetically engineered bacterium comprising the nucleic acid fragment described above or the recombinant vector described above is provided.

[0063] In some embodiments, the host cell of the genetically engineered bacterium comprises Vibrio natriegens.

[0064] Vibrio natriegens has a generation time of less than 10 minutes, which is the shortest generation time of non-parasitic bacteria known. It has a fast growth rate, a short fermentation period for expressing foreign proteins as a host cell, and can inhibit the growth of other bacteria by increasing the salt concentration of the culture medium without using antibiotics.

[0065] Using Vibrio natriegens as a host cell to express the nitrilase mutant of the present application has the advantages of short culture time, high expression of soluble protein, strong salt tolerance, tolerance to high concentration of substrate, and higher enzyme activity of the nitrilase produced in the process of synthesizing nicotinic acid.

[0066] Further, the genetically engineered bacteria of the present application has high salt tolerance to both salt and substrate concentration, thus can increase the salt concentration in the culture medium, thereby inhibiting the growth of mixed bacteria without using antibiotics, reducing the risk of contamination and saving costs.

[0067] The genetically engineered bacteria constructed by the present application has extremely fast growth rate, and only needs 6 hours to grow on agar plate and only needs 3 hours to expand in liquid medium; the plasmid construction using the genetically engineered bacteria only needs 18 hours, which is at least 10 hours faster than E. coli.

[0068] In some embodiments, the Vibrio natriegens includes Vibrio natriegens ATCC14048.

[0069] It can be understood that the Vibrio natriegens ATCC 1404 described above can be obtained by commercial channels.

[0070] In some embodiments, the DNA site of the Vibrio natriegens genome is integrated with a T7 RNA polymerase expression cassette.

[0071] It can be understood that the T7 RNA polymerase can effectively improve the transcription regulation efficiency of the genetically engineered bacteria.

[0072] In a fifth aspect, the present application provides a method for constructing the genetically engineered bacteria described above, comprising the following steps: introducing a recombinant vector expressing the nitrile hydratase mutant into the genetically engineered bacteria to be modified to construct the genetically engineered bacteria.

[0073] In a sixth aspect, the present application provides an enzyme catalytic preparation comprising the nitrile hydratase mutant described above and an auxiliary material.

[0074] In some embodiments, the auxiliary material described above can include one or more of a precipitating agent, a surfactant, a cross-linking agent and a stabilizing agent.

[0075] In a seventh aspect, the present application provides a method for preparing nicotinic acid, comprising the following steps:

[0076] The nitrile hydratase mutant described above, the genetically engineered bacteria described above or the enzyme catalytic preparation described above is used to catalyze the substrate to synthesize nicotinic acid.

[0077] In some embodiments, the method for preparing nicotinic acid described above further comprises the following step: culturing the genetically engineered bacteria to prepare a crude enzyme solution.

[0078] In some embodiments, the method for preparing nicotinic acid described above, the step of culturing comprises:

[0079] The genetically engineered bacteria is induced and cultured to prepare a bacterial solution.

[0080] The bacterial liquid is subjected to cell disruption treatment to prepare a crude enzyme liquid.

[0081] In some embodiments, the substrate comprises 3-cyanopyridine.

[0082] It can be understood that the reaction formula for synthesizing nicotinic acid by using 3-cyanopyridine as the substrate and using a nitrile hydrolase as the catalyst is as shown in Figure 1 .

[0083] In some embodiments, the concentration of the substrate is 50 mM to 400 mM.

[0084] For example, the concentration of the substrate can be 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, 100 mM, 110 mM, 120 mM, 130 mM, 140 mM, 150 mM, 160 mM, 170 mM, 180 mM, 190 mM, 200 mM, 210 mM, 220 mM, 230 mM, 240 mM, 250 mM, 260 mM, 270 mM, 280 mM, 290 mM, 300 mM, 310 mM, 320 mM, 330 mM, 340 mM, 350 mM, 360 mM, 370 mM, 380 mM, 390 mM, 400 mM, or any value within a range defined by any two of the above values.

[0085] In some embodiments, the pH condition for catalysis is 5.0 to 10.0.

[0086] For example, the pH condition for catalysis can be 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, or any value within a range defined by any two of the above values.

[0087] In some embodiments, when a genetically engineered bacterium is used as the catalyst, the amount of the genetically engineered bacterium added to the reaction system is 1.0 g / L to 4.0 g / L, based on the dry weight of the genetically engineered bacterium.

[0088] For example, the amount of the genetically engineered bacterium added to the reaction system can be 1.0 g / L, 1.5 g / L, 2.0 g / L, 2.5 g / L, 3.0 g / L, 3.5 g / L, 4.0 g / L, or any value within a range defined by any two of the above values.

[0089] In some embodiments, the solvent for catalysis comprises water.

[0090] In some embodiments, the temperature for catalysis is 25°C to 55°C.

[0091] As an example, the temperature of the catalytic reaction can be 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, 55℃, or any value within the range formed by any two of the above-mentioned points.

[0092] In the preparation method of nicotinic acid, the enzyme activity of the catalyst can be 0.5 U / mL to 15 U / mL.

[0093] The preparation method of nicotinic acid provided by the present application has the advantages of simple product separation and purification, low cost, environmentally friendly production process, less pollution, and compliance with the concept of green chemistry.

[0094] The present application will be further described below in conjunction with specific examples and comparative examples, but should not be understood as limiting the scope of protection of the present application. The raw materials involved in the following specific examples, if not specifically stated, can be sourced from the market, the instruments used, if not specifically stated, can be sourced from the market, and the processes involved, if not specifically stated, are conventional choices for those skilled in the art.

[0095] The 3-cyanopyridine, nicotinic acid and phosphate used in the examples of the present application are all commercially available analytical pure.

[0096] Example 1

[0097] (1) Construction of genetically engineered bacteria

[0098] A nitrile hydratase derived from Alcaligenes was selected, the gene encoding the nitrile hydratase is NIT338, the gene accession number in NCBI is WP_250756555.1; the base sequence of NIT338 is shown in SEQ ID NO: 1, and the amino acid sequence encoded thereby is shown in SEQ ID NO: 2.

[0099] SEQ ID NO: 1

[0100]

[0101] SEQ ID NO: 2

[0102] MTQQKSQSRTVRVAAVQYAPDLETTEATLRRVLDAVAEAAAKGAQLVVFPETFIPHYPYFSAVLAPAAMGAEQNRLYENAVRIPGPVTEALSEAARRHRIVLAVGVTERDHGSLYNTQLIFDVDGSLIQKHRKISPAPHERLIWDEGDGTSIKVVESTVGRLGALTCWEHYNPLARFSLIAQHEEIHISTYIGSIFGPVFSKQTETQLMNHALESGCFVVNATAWLTDEQRARIVDDPGMQKVLTGGCMTAIIGPDGQHIVPPLTDGEGILIADLDFSAITNAKRIRDSVGHYSRPDLFSLAVHSKPTPHIRAIASSETVRRDADVVVDSAVNPEQEA.

[0103] Applicants found that, based on protein structure analysis, S201F, G239M, K242T, V243Q or G246Q mutations caused changes in the structure of the protein, which might affect the function of the nitrilase mutant compared to the wild type.

[0104] To further verify the effect of the above mutation sites on the function of nitrilase, the amino acid sequence was converted into a nucleotide sequence by codon optimization. The nucleotide sequence of NIT 338 was obtained by chemical synthesis (Qingke Biological) and integrated into the multiple cloning site (between the BamH I and Hind III enzyme cutting sites) of the expression vector pET-28a(+), obtaining the recombinant plasmid pET28a-NIT 338; finally, the constructed recombinant plasmid was introduced into Vibrio natriegens ATCC14048 host cells to construct genetically engineered bacteria VNDX-pET28a-NIT 338 (i.e., Vibrio natriegens expressing wild-type NIT 338). Vibrio natriegens ATCC14048 can be purchased from the China Industrial Microbial Strain Preservation and Management Center.

[0105] (2) Construction of nitrilase mutant

[0106] (a) Activation of engineered bacteria and plasmid extraction

[0107] The engineered strain VNDX-pET28a-NIT 338 was activated and cultured using TB medium. Specifically, the glycerol tube containing the engineered strain was inoculated into a test tube containing 10 mL of TB medium and cultured at 30°C and 200 rpm for 6 hours. After obtaining the cultured cells, plasmids were extracted according to the instructions of the Axygen Plasmid Extraction Kit. The resulting plasmids were used directly for point mutagenesis or stored at -20°C for long-term storage.

[0108] TB liquid medium: 12 g / L peptone, 24 g / L yeast extract, 15 g / L NaCl, 5% (v / v) glycerol, 2.31 g / L KH2PO4, and 16.43 g / L K2HPO4. Dissolve in deionized water, bring to volume, and sterilize at 121°C for 20 minutes. Compared to liquid medium, TB solid medium also contains 2% (w / v) agar powder.

[0109] (b) Site-directed mutagenesis

[0110] Using the plasmid extracted in step (a) above as a template, PCR amplification was performed using the primer pairs shown in Table 1 to obtain a plasmid containing the mutation site.

[0111] Table 1

[0112] Primer name Primer number Sequence (5'-3') S201F_F SEQ ID NO: 3 CCCGTATTTTTTAAGCAAACCGAGACGCAAC S201F_R SEQ ID NO: 4 GTTTGCTTAAAAAATACGGGACCAAAAATCGATC G239M_F SEQ ID NO: 5 GACCCTATGATGCAAAAAGTGCTGACCGG G239M_R SEQ ID NO: 6 TGCATCATAGGGTCATCTACGATGCG K242T_F SEQ ID NO: 7 GCATGCAAACCGTGCTGACCGGAGGATG K242T_R SEQ ID NO: 8 TCAGCACGGTTTGCATGCCAGGGTCATC V243Q_F SEQ ID NO: 9 TGCAAAAACAGCTGACCGGAGGATGTATG V243Q_R SEQ ID NO: 10 CGGTCAGCTGTTTTTGCATGCCAGGGTCATC G246Q_F SEQ ID NO: 11 CTGACCCAGGGATGTATGACTGCTATTATCGG G246Q_R SEQ ID NO: 12 CATCCCTGGGTCAGCACTTTTTGCATGC S201F_F SEQ ID NO: 13 CCCGTATTTTTTAAGCAAACCGAGACGCAAC S201F_R SEQ ID NO: 14 GTTTGCTTAAAAAATACGGGACCAAAAATCGATC G239M_F SEQ ID NO: 15 GACCCTATGATGCAAAAAGTGCTGACCGG G239M_R SEQ ID NO: 16 TGCATCATAGGGTCATCTACGATGCG

[0113] In the above table, S201F_F and S201F_R as a primer pair can be used for directed mutagenesis to obtain a gene fragment containing the S201F mutation site, and other expressions have similar meanings.

[0114] The PCR amplification system (50 μL) included: 25 μL of DNA polymerase (Primer STAR, purchased from TaKaRa), 1 μL of upstream primer (F), 1 μL of downstream primer (R), 0.5 μL of plasmid template, and 22.5 μL of ddH 2 O.

[0115] The PCR amplification program was as follows: pre-denaturation at 98°C for 5 min; 30 cycles of denaturation at 98°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 90 s; post-extension at 72°C for 10 min; and storage at 4°C.

[0116] After PCR amplification, the amplified product was detected by electrophoresis using 0.9% agarose gel. The results showed that the amplified product was a single band with a target band size of about 1500 bp. The amplified product was purified and recovered according to the instructions of the DNA recovery and purification kit (AxyPrep DNA gel recovery kit).

[0117] (c) Construction of mutant engineered bacteria

[0118] The purified gene fragment was digested with Dpnl to remove the template, and then recombined with a recombination enzyme (ClonExpress II One-Step Cloning Kit, purchased from Vazyme); the recombination product was transformed into Vibrio receptivity cells, plated, and single colonies were picked into TB liquid culture, and PCR was used to identify positive transformants constructed successfully, and the correctness of the mutation site was verified by sequencing. After verification, 20% sterile glycerol was added to a final concentration, labeled and stored at -80°C for future use.

[0119] Based on the above steps, 13 mutant or mutant combinations of Vibrio engineering bacteria containing the following were constructed: S201F, G239M, K242T, V243Q, G246Q, S201F / G239M, S201F / V243Q, K242T / G246Q, V243Q / G246Q, S201F / G239M / V243Q, S201F / V243Q / G246Q, S201F / G239M / V243Q / G246Q. It should be noted that "S201F / G239M" means that S201F and G239M mutations exist at the same time, and other expressions have similar meanings.

[0120] (3) Cultivation of bacterial cells and preparation of whole cells

[0121] (a) Cultivation of bacterial cells

[0122] The 13 mutant engineering bacteria prepared above and the engineering bacteria expressing NIT 338 wild type were respectively activated by plate streaking, and single colonies were inoculated into 5 mL TB liquid medium containing 200 μg / mL kanamycin, and cultured at 30°C with shaking until OD 600 When it reached about 0.6, it was transferred to 50 mL of fresh TB liquid medium containing 200 μg / mL Kan antibiotic at an inoculation amount of 1% (v / v), and cultured at 30°C with shaking until OD 600 When it reached about 0.6, IPTG was added to a final concentration of 0.3 mM, and induced at 18°C for 10 h. After the culture ended, the culture was centrifuged at 10000 rpm for 5 min, the supernatant was discarded, and the bacterial cells were collected and washed twice with phosphate buffer at a concentration of 10 mM and a pH of 7.4; stored in a ultra-low temperature freezer at -80°C for future use.

[0123] (b) Preparation of whole cells and crude enzyme solution

[0124] The bacteria collected after the end of the culture were resuspended in phosphate buffer at a concentration of 10 mM and pH 7.4, obtaining the whole cell of the Vibrio natriq engineering bacteria containing nitrilase. The resuspended bacteria were subjected to 400 W ultrasonic waves for 30 times, each time for 3 s, with an interval of 7 s. The broken bacteria were centrifuged at 12000 rpm at 4°C for 10 min to remove the precipitate, obtaining the supernatant as the crude enzyme solution containing nitrilase (10 g wet bacteria / L).

[0125] (4) Soluble expression of nitrilase expressed in different hosts

[0126] (a) Preparation of reagents

[0127] SDS-PAGE electrophoresis buffer: dissolve one packet of Tris-MOPS-SDS electrophoresis buffer powder (purchased from Jinshui Biotechnology Co., Ltd.) in 1 L of deionized water and mix well for use;

[0128] Protein gel staining solution: weigh 2.5 g of Coomassie Brilliant Blue R-250, add 454 mL of absolute ethanol and 46 mL of glacial acetic acid, and finally dilute to 1 L with deionized water. After mixing well, perform suction filtration, and then store the staining solution in the dark at room temperature;

[0129] Protein gel decolorizing solution: 380 mL of deionized water, 70 mL of absolute ethanol and 50 mL of glacial acetic acid, mix well and store at room temperature.

[0130] (b) SDS-PAGE protein electrophoresis

[0131] Prepare the crude enzyme solution A of the Vibrio natriq engineering bacteria expressing wild-type NIT 338 according to the method described in step (3)(a), and prepare the crude enzyme solution B of the engineering bacteria expressing wild-type NIT 338 constructed using E. coli BL21 (DE3) as the host for comparison.

[0132] Take 60 μL of protein samples of the crude enzyme solutions A and B respectively, add 20 μL of 4xProtein SDS PAGE Loading Buffer, mix well and denature at 100°C for 10 min. After removing the bottom sealing film of the precast protein gel, load it into the electrophoresis tank, pour in enough electrophoresis buffer (about 1 L), and carefully pull out the comb to avoid damaging the gel holes. Add 10 μL of protein sample or protein Marker to the sample well. Connect the power supply and perform protein electrophoresis at 120 V. Stop the electrophoresis when the bromophenol blue indicator just leaves the bottom of the gel. Take out the electrophoresis gel, remove the plastic shell, and place it in a staining tank containing the staining solution. Heat in a microwave oven for 60 s, and then stain on a reciprocating decolorizing shaker for 30 min. Then transfer the electrophoresis gel into the decolorizing solution and decolorize multiple times until the background color is completely removed. Use the gel imaging system to observe the electrophoresis bands.

[0133] The results are as follows:Figure 2 As shown in the figure, when using Vibrio nautilus as the host bacteria, the soluble expression of nitrilase accounts for 95%, which is much higher than the soluble expression proportion (40%) when using Escherichia coli as the host, indicating that using Vibrio nautilus as the host is more conducive to whole-cell catalysis. Figure 2 Here, “Vn” indicates the sample prepared with Vibrio natriuresis as the host bacteria, “BL21” indicates the sample prepared with Escherichia coli BL21 as the host bacteria, “supernatant” refers to the supernatant (i.e., crude enzyme solution) collected after the whole-cell culture fluid is disrupted, and “precipitate” refers to the precipitate discarded after the whole-cell culture fluid is disrupted.

[0134] (5) Enzyme activity of nitrilase expressed in different hosts

[0135] According to the method described in step (3), Escherichia coli engineered bacteria expressing the wild type of NIT 338 were cultured to obtain whole cells and crude enzyme solution, and nicotinic acid was synthesized using Escherichia coli engineered bacteria expressing the wild type of NIT 338 and Vibrio natriuresis engineered bacteria expressing the wild type of NIT 338, respectively.

[0136] The 1mL synthesis system contained 3-cyanopyridine at a final concentration of 50mM and 250μL of crude enzyme solution. The reaction temperature, pH value, and rotation speed were controlled at 700rpm using a metal bath for 5min. Product concentrations were determined by high-performance liquid chromatography (HPLC). The enzyme activities of different engineered bacteria at different substrate concentrations were calculated based on the product concentrations. The results are shown in Table 2. The nitrilase produced by the Naval Vibrio nematophilus host cell showed 1.6 times the activity of that produced by the Escherichia coli host cell, indicating that using Naval Vibrio nematophilus as a host cell can produce a nitrilase with higher activity.

[0137] The HPLC conditions included: a Shimadzu SIL-20A high-performance liquid chromatograph, a QS-C18Plus column (Part No. 05BM046250, 5 μm, 4.6 x 250 mm), a column temperature of 30°C, a flow rate of 1 mL / min, a UV detection wavelength of 260 nm, and a mobile phase of acetonitrile / 0.25% phosphoric acid (9:1). The liquid chromatogram is shown in FIG. Figure 3 As shown, the peak at 3.424 min is 3-cyanopyridine, and the peak at 12.482 min is nicotinic acid.

[0138] The enzyme activity in this application is calculated as follows: crude enzyme activity (U / mL) = (C*V*n) / (T*v);

[0139] Where C is the product concentration, mmol / L; V is the reaction volume; n is the dilution factor; T is the reaction time; and v is the volume of enzyme solution added.

[0140] Table 2

[0141] Host species Escherichia coli Vibrio natriqum Enzyme activity 3.59 U / mL 5.80 U / mL

[0142] (6) Residual enzyme activity of nitrile hydratase expressed in different hosts under different substrate concentrations

[0143] According to the method described in step (3), the E. coli engineering bacteria expressing NIT 338 wild type were cultured and whole cells and crude enzyme solution were obtained, and the E. coli engineering bacteria expressing NIT 338 wild type and the Vibrio natrigens engineering bacteria expressing NIT 338 wild type were used to synthesize nicotinic acid under different substrate concentrations.

[0144] After the above two kinds of whole cells were soaked in 3-cyanopyridine with substrate concentrations of 100 mM, 200 mM, 300 mM and 400 mM for 1 h, the bacteria were centrifuged at 4000 rpm, 4°C for 15 min. Specifically, 1 mL of the synthesis system contained 3-cyanopyridine with a final concentration of 100 mM / 200 mM / 300 mM / 400 mM and 250 μL of crude enzyme solution; the reaction temperature was controlled by a metal bath at 30°C, the pH value was 7.4, the rotation speed was 700 rpm, the reaction was carried out for 5 min, the product concentration was determined by liquid chromatography, and the enzyme activity of different host engineering bacteria under different substrate concentrations was calculated according to the product concentration. The results are shown in Table 3.

[0145] Table 3

[0146] Substrate concentration Escherichia coli-produced enzyme activity Vibrio natriqum-produced enzyme activity 100 mM 3.5 U / mL 5.5 U / mL 200 mM 1.2 U / mL 2.9 U / mL 300 mM 1.0 U / mL 1.7 U / mL 400 mM 0.8 U / mL 1.3 U / mL

[0147] As can be seen from the above table, as the substrate concentration increases from 50 mM to 400 mM, the enzyme activity of nitrile hydratase gradually decreases, but compared with E. coli, the nitrile hydratase produced by Vibrio natrigens has higher tolerance to substrate concentration.

[0148] (7) Conversion rate of different mutants under different substrate concentrations for 8 h

[0149] According to the method described in step (3) above, E. coli engineering bacteria expressing NIT 338 wild type or its mutants and Vibrio natrigens engineering bacteria were cultured, and the above engineering bacteria were used to catalyze 50 mM and 400 mM substrates to generate nicotinic acid, respectively.

[0150] 40 mL of the synthesis system contained 3-cyanopyridine with a final concentration of 50 mM (or 400 mM) and 10 mL of crude enzyme solution. The reaction temperature was controlled by a water bath at 30°C, the pH value was 7.4, the rotation speed was 300 rpm, the reaction was carried out for 8 h, the product concentration was determined by liquid chromatography, and the conversion rate of different engineering bacteria under different substrate concentrations for 8 h was calculated according to the product concentration. The results are shown in Tables 4 and 5.

[0151] Table 4

[0152]

[0153] Table 5

[0154]

[0155]

[0156] From Table 4 and Table 5, it can be seen that, compared with the wild type, the nitrile hydrolase mutant provided by the present application not only has higher enzyme activity in the reaction of catalyzing 3-cyanopyridine into nicotinic acid, but also can achieve higher conversion rate in a shorter reaction time.

[0157] In the test of different substrate concentrations, the enzyme activity of the nitrile hydrolase mutant is significantly improved, and when the concentration of 3-cyanopyridine increases from 200 mM to 400 mM, the enzyme activity of the mutant decreases very little, while also maintaining a high conversion rate, indicating that the nitrile hydrolase mutant of the present application has higher tolerance to substrates than the wild type nitrile hydrolase.

[0158] The technical features of the above-described embodiments can be combined arbitrarily. In order to make the description simple, all possible combinations of the technical features in the above-described embodiments are not described, however, as long as the combinations of the technical features do not exist contradictory, it should be considered that they are within the scope of the present disclosure.

[0159] The above-described embodiments only express several implementation manners of the present application, and the description is more specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be pointed out that, for ordinary skilled in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are all within the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the appended claims.

Claims

1. A nitrilase mutant, characterized in that: Compared with the wild-type nitrilase whose amino acid sequence is shown in SEQ ID NO: 2, the nitrilase mutant undergoes mutations at any of the following amino acid positions: (1) S201F / G239M, (2) S201F / V243Q, (3) S201F / G239M / V243Q, (4) S201F / V243Q / G246Q; (5) S201F / G239M / V243Q / G246Q.

2. A nucleic acid fragment, characterized in that The nucleic acid fragment encodes the nitrilase mutant according to claim 1.

3. A recombinant vector, characterized in that The recombinant vector comprises the nucleic acid fragment according to claim 2.

4. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria comprises the nucleic acid fragment according to claim 2 or the recombinant vector according to claim 3.

5. The genetically engineered bacterium according to claim 4, characterized in that The host cell of the genetically engineered bacteria includes Vibrio natriuresis.

6. The genetically engineered bacterium according to claim 5, characterized in that The natriuretic vibrio includes natriuretic vibrio ( Vibrio natriegens )ATCC14048.

7. A method for constructing a genetically engineered bacterium, characterized in that: The steps include: The recombinant vector expressing the nitrilase mutant according to claim 1 is introduced into the genetically engineered bacteria to be transformed to construct the genetically engineered bacteria.

8. An enzyme catalytic preparation, characterized in that The invention comprises the nitrilase mutant according to claim 1 and auxiliary materials.

9. A method for preparing nicotinic acid, characterized in that: The steps include: The nitrilase mutant according to claim 1, the genetically engineered bacteria according to any one of claims 4 to 6, or the enzyme catalytic preparation according to claim 8 is used to catalyze the synthesis of nicotinic acid from 3-cyanopyridine.

10. The method for preparing nicotinic acid according to claim 9, characterized in that: The preparation method satisfies at least one of the following characteristics: (1) The concentration of the substrate is 50 mM to 400 mM; (2) The catalytic pH condition is 5.0-10.0; and (3) The catalytic reaction temperature is 25°C to 55°C.

Images