Corn adenylate cyclase ZmSnRK1.2, and coding gene, expression vector and application thereof

Abstract

The invention discloses corn adenylate cyclase ZmSnRK1.2 as well as a coding gene, an expression vector and application thereof, and aims to solve the technical problem that high-temperature-resistant gene resources and germplasm resources of corn are deficient at present. The application verifies that the corn kinase ZmSnRK1.2 as a novel adenylate cyclase has high catalytic ability, and can quickly generate cAMP in the presence of ATP (adenosine triphosphate). The application also verifies the positive regulation effect of the ZmSnRK1.2 gene on the high temperature resistance of the corn. The invention provides a new thought and technical approach for solving high-temperature stress damage of corn and breeding high-temperature-resistant varieties.

Description

Technical Field

[0001] The present invention relates to the field of molecular breeding technology, and specifically to a corn adenylate cyclase ZmSnRK1.2, its encoding gene, expression vector and application. Background Art

[0002] Corn is an important food crop in my country and is crucial to ensuring food security. However, with global warming, extreme high temperature weather is becoming more frequent, which poses a serious threat to corn yields. High temperature stress will have a significant impact on all growth stages of corn, which in turn threatens the formation of the final yield. In the seedling stage, once subjected to high temperature stress, the conductivity of the seedlings will increase, resulting in weak plant growth, and the leaf area index and the total amount of dry matter accumulation per plant will decrease; this stunted development will directly affect subsequent growth and development, thereby reducing yields. Entering the flowering period, when the temperature exceeds 32°C, the pollination process of corn will be adversely affected. If the temperature further rises to above 38°C, the male spike will not even bloom normally, and the pollen will be seriously hindered. At the same time, high temperature will also interfere with the normal development of the female spike, resulting in uncoordinated development of the male and female spikes, and a significant decrease in the pollination and fruiting rate. In the filling period, high temperature weather will significantly shorten the filling time of corn and reduce the accumulation of dry matter, which will not only affect the thousand-grain weight of corn, but also directly lead to a decrease in yield.

[0003] cAMP (3',5'-cyclic adenosine monophosphate) is a key signaling molecule in plants, and it plays a vital role in the process of plant response to high temperature stress. This process begins with the catalysis of adenylate cyclase (AC), which can convert ATP into cAMP. As a second messenger, cAMP is widely involved in regulating a variety of biological processes, including the response to high temperature stress. Under high temperature conditions, the content of cAMP will increase significantly. This change may activate specific signal transduction pathways, leading to changes in the expression of heat tolerance-related genes such as heat shock proteins (HSPs). In addition, cAMP has a close interaction with the signaling pathway of the plant hormone abscisic acid (ABA), and ABA can further increase the cAMP content, thereby synergistically enhancing the heat tolerance of plants. In corn, cAMP affects the stability of the cell wall by regulating the expression of cellulose synthase genes, thereby enhancing the heat tolerance of plants.

[0004] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention

[0005] ZmSnRK1.2It is a gene of sucrose non-fermentation-1 (SNF1)-related protein kinase 1 (SnRK1) in corn (Zea mays L.), which is highly conserved in corn and closely related to plant development and stress response. The inventors found through research that ZmSnRK1.2 is a new type of adenylate cyclase with a biological function of responding to high temperature stress. Specifically, the present disclosure provides a corn adenylate cyclase ZmSnRK1.2, its encoding gene, expression vector and application, aiming to solve the current technical problem of the lack of corn heat-resistant gene resources and germplasm resources.

[0006] According to one aspect of the present disclosure, a maize adenylate cyclase ZmSnRK1.2 is provided, and its amino acid sequence is shown in SEQ ID NO.1.

[0007] According to a second aspect of the present disclosure, a gene encoding the above-mentioned maize adenylate cyclase ZmSnRK1.2 is provided. ZmSnRK1.2 , whose nucleotide sequence is shown in SEQ ID NO.2.

[0008] According to the third aspect of the present disclosure, there is provided a method comprising the coding gene ZmSnRK1.2 or an expression vector containing a fragment thereof.

[0009] According to the fourth aspect of the present disclosure, the corn adenylate cyclase ZmSnRK1.2, the coding gene ZmSnRK1.2 Or the expression vector is used in regulating the high temperature resistance trait of corn or in preparing a reagent for regulating the high temperature resistance trait of corn.

[0010] According to the fifth aspect of the present disclosure, the corn adenylate cyclase ZmSnRK1.2, the coding gene ZmSnRK1.2 Or the expression vector is used in regulating the cAMP content in plants or in preparing a reagent for regulating the cAMP content.

[0011] According to the sixth aspect of the present disclosure, the coding gene ZmSnRK1.2 Or the expression vector is used in breeding / identifying varieties / lines related to corn high temperature stress resistance traits.

[0012] According to the seventh aspect of the present disclosure, the coding gene ZmSnRK1.2 Or the expression vector is used in constructing / breeding transgenic plants with high temperature stress resistance.

[0013] One or more technical solutions provided in the embodiments of the present application have at least any of the following technical effects or advantages: 1. First identification of corn kinase ZSnRK1.2 is a new type of adenylate cyclase that contains three relatively conserved AC catalytic center motifs. It has high catalytic ability in vitro and can quickly produce cAMP in the presence of ATP.

[0014] 2. ZmSnRK1.2 The gene expression level was significantly reduced under high temperature stress; at the same time, by constructing ZmSnRK1.2 The mutant was knocked out and subjected to high temperature stress. It was found that under high temperature stress, the survival rate of the mutant strain was significantly lower than that of the wild type, showing an obvious heat-sensitive phenotype, indicating that ZmSnRK1.2 Positively regulating the high temperature resistance of corn.

[0015] 3. This application provides new ideas and technical approaches for solving the problem of high temperature stress damage to corn and breeding high temperature resistant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the prediction of the domain structure of the protein encoded by ZmSnRK1.2 in one embodiment of the present application and the comparison and analysis of the AC motif of the protein encoded by ZmSnRK1.2 with the AC motif protein sequences of known plant adenylate cyclases.

[0017] Figure 2 This is an analysis of the adenylate cyclase activity of ZmSnRK1.2 in one embodiment of the present application.

[0018] Figure 3 In one embodiment of this application ZmSnRK1.2 Analysis of gene expression under high temperature stress.

[0019] Figure 4 In one embodiment of this application ZmSnRK1.2 Schematic diagram of gene structure, CRISPR / Cas9 target sequence design site, ZmSnRK1.2 Analysis of the mutation sites of the knockout mutant materials and the cAMP content in vivo of the Cas9-ZmSnRK1.2 knockout mutant materials.

[0020] Figure 5 This is the phenotypic analysis of high temperature treatment and the statistical analysis of the survival rate of the wild-type corn B104 and Cas9-ZmSnRK1.2 knockout mutant in one embodiment of the present application. DETAILED DESCRIPTION

[0021] In order to better understand the technical solution of the present application, the above technical solution will be described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0022] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; the reagents involved are all commercially available conventional reagents unless otherwise specified; the detection methods involved are all conventional methods unless otherwise specified.

[0023] Example 1: Detection of AC catalytic center motif in corn kinase ZmSnRK1.2 To confirm whether ZmSnRK1.2 is a new adenylate cyclase (AC), the protein sequence of ZmSnRK1.2 was analyzed using an online website (https: / / prosite.expasy.org / scanprosite). It was found that ZmSnRK1.2 contains three relatively conserved AC catalytic center motifs [RKS]X[DE]X(9,11)[KR]X(1,3)[DE]( Figure 1 ). Therefore, it is preliminarily speculated that ZmSnRK1.2 is a new adenylate cyclase.

[0024] Example 2: Analysis of the enzyme activity of adenylate cyclase ZmSnRK1.2 To further verify whether ZmSnRK1.2 is a new adenylate cyclase, a complementation experiment was first performed on Escherichia coli cya strain SP850 (from the Escherichia coli Genetic Stock Center of Yale University, registration number: 7200). In this experiment, wild-type E. coli can decompose maltose in the presence of cAMP in the cell and form red colonies on maltose MacCon agar plates, while E. coli cYA The mutant forms white colonies due to the absence of cAMP in the cells. Figure 2 ) showed that wild-type Escherichia coli and cells containing induced ZmSnRK1.2 protein cYA The mutant showed red colonies, while cYA Mutants and those without induced ZmSnRK1.2 protein cYA The mutant formed white colonies, indicating that ZmSnRK1.2 could produce cAMP and was a new adenylate cyclase.

[0025] In this case, the recombinant protein GST-SnRK1.2 was purified by in vitro prokaryotic expression, and the in vitro catalytic ability of GST-SnRK1.2 was detected by LC / MS. Figure 2 ) showed that the recombinant protein GST-SnRK1.2 could rapidly produce cAMP in the presence of ATP.

[0026] In summary, ZmSnRK1.2 is a novel maize adenylate cyclase.

[0027] Example 3: Corn ZmSnRK1.2 Functional verification of genes To determine ZmSnRK1.2 To determine whether gene expression is affected by high temperature, the maize inbred line B73 was used to examine the effects of high temperature on seedlings at the three-leaf stage. The leaves were exposed to 42℃ high temperature stress for 0 h, 3 h, 6 h, 9 h and 12 h, and then the total RNA of the second leaf was extracted and its expression was analyzed by qRT-PCR. Figure 3 )show, ZmSnRK1.2 Gene expression was significantly reduced by high temperature stress.

[0028] Furthermore, the CRISPR / Cas9 system was used to ZmSnRK1.2 The CRISPR-Cas9 vector previously stored in the inventor's laboratory was used to construct ZmSnRK1.2 The CRISPR-Cas9-ZmSnRK1.2 vector with a specific mutation site in the gene was successfully transferred into the maize inbred line B104 for genetic transformation, thereby ZmSnRK1.2 The gene was edited, and then the resulting corn seedlings were sequenced and compared. ZmSnRK1.2 The mutation site of the gene.

[0029] The specific steps are as follows: (1) Target sequence design Use the NCBI website to search for the sequence of the target gene; in the CDS of the target gene, find two Target sequences near the ATG end (Target1: ACTCTCGGAATTGGCTCATTCGG; Target2: ATTCGGGAAGGTGAAAATTGCGG) ( Figure 4 ).

[0030] (2) Construction of intermediate vector sgRNA First, the intermediate vector was digested and recovered by gel. The sgRNA digestion system (50 μL) is shown in Table 1.

[0031] Table 1 sgRNA digestion system .

[0032] Secondly, the designed primers (F1: GGCAACTCTCGGAATTGGCTCATT; R1: AATGAGCCAATTCCGAGAGTCAAA) and (F2: GGCAATTCGGGAAGGTGAAAATTG; R2: CCGCAATTTTCACCTTCCCGAATCAAA) were diluted to 100 μM / L and connected using a PCR instrument to obtain the target fragment. The PCR reaction system is shown in Table 2, and the program setting is: 37℃ 5 min, 95℃ 5 min, rampdown to 25℃, 5℃ / min.

[0033] Table 2 PCR reaction system .

[0034] Finally, the target fragment was diluted 200 times and the intermediate vector sgRNA was connected at 25°C for 5 min. DH5α was transformed, and colony PCR was performed using U3-F (acactttatgcttccggctc) and R1 / R2 primers. The bacteria were shaken and sent for sequencing to obtain the correct intermediate vector. The target fragment and sgRNA connection system (10 μL) are shown in Table 3.

[0035] Table 3 Target fragment and sgRNA connection system .

[0036] (3) Construction of Cas9 terminal vector The correct intermediate vector and Cas9 final vector were constructed as shown in Table 4. The ligation solution was incubated at 4°C overnight and transformed into DB3.1. Colony PCR was performed using U3-F and R1 / R2 primers, and the bacteria were shaken and sent for sequencing to obtain the correct Cas9 vector, which was then transformed into corn using the Agrobacterium-mediated method (sent to the relevant company for completion).

[0037] Table 4 End load connection system .

[0038] (4) ZmSnRK1.2 Identification of knockout mutant material The T0 generation transgenic knockout plants were sampled and DNA was extracted. The Target1 sequence was used to design identification primers containing the Target1 sequence (F3: CGGTGGAGATGTTCGTTTTT; R3: GGGCAACACGAGTATCCA) of about 400 bp. PCR amplification, gel recovery, sequencing verification and other steps were performed to determine whether the T0 generation transgenic plants had mutated.

[0039] After the transgenic plants were constructed, the mutant plants were snrk1.2-1 , snrk1.2-2 The strains were cultured together with B104 until the three-leaf stage, and then subjected to high temperature stress at 42°C for 14 h during the day and 38°C for 10 h at night to observe their phenotypes. Figure 5 ) showed that under high temperature stress, the survival rate of the mutant strain was significantly lower than that of the wild type, showing an obvious heat-sensitive phenotype, indicating that ZmSnRK1.2 Positive regulation of high temperature tolerance traits in corn 。

[0040] Although some preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0041] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the inventive concept. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. A maize adenylate cyclase ZmSnRK1.2, the amino acid sequence of which is shown in SEQ ID NO.

1.

2. A gene encoding the maize adenylate cyclase ZmSnRK1.2 according to claim 1, whose nucleotide sequence is shown as SEQ ID NO.

2.

3. An expression vector containing the coding gene or a fragment thereof according to claim 2.

4. Use of the maize adenylate cyclase ZmSnRK1.2 according to claim 1, the coding gene according to claim 2 or the expression vector according to claim 3 in regulating the high temperature resistance trait of maize or preparing an agent for regulating the high temperature resistance trait of maize.

5. Use of the maize adenylate cyclase ZmSnRK1.2 according to claim 1, the encoding gene according to claim 2 or the expression vector according to claim 3 in regulating the cAMP content in plants or in preparing an agent for regulating the cAMP content.

6. Use of the coding gene according to claim 2 or the expression vector according to claim 3 in breeding / identifying varieties / lines related to the trait of high temperature stress resistance of corn.

7. Use of the coding gene according to claim 2 or the expression vector according to claim 3 in constructing / breeding transgenic plants with high temperature stress resistance.

8. The use according to any one of claims 4 to 7, characterized in that: The coding gene ZmSnRK1.2 Overexpression in maize plants.

Images