MSTN gene editing pig molecular feature recognition method and application

Abstract

The invention discloses an MSTN (myostatin) gene editing pig molecular feature recognition method and application. The invention provides crRNA for identifying the molecular characteristics of MSTN (myostatin) gene edited pigs. The nucleotide sequence of the crRNA 1 is SEQ ID NO.16. The crRNA is used for identifying the molecular characteristics of MSTN gene edited pigs. The invention provides a CRISPR / Cas12a system-based identification method for MSTN gene editing pig molecular characteristics, the method is high in sensitivity and strong in specificity, a reaction result can be directly read through a test strip, on-site rapid detection is facilitated, and a foundation is laid for commercialized and large-scale production of MSTN gene editing pigs.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a method for identifying the molecular characteristics of gene-edited pig genes and an application thereof. Background Art

[0002] Gene editing breeding technology is regarded as one of the key development trends in animal breeding technology. Countries such as the United States and Japan have successively approved a variety of gene-edited animals and their products, including GalSafe gene-edited pigs, Madai red snapper, tiger pufferfish, and PRLR-SLICK gene-edited cattle, to enter the market. Myostatin (MSTN), as a member of the transforming growth factor-β (TGF-β) family, is a factor that inhibits muscle growth. Removing the growth inhibitory effect of MSTN is an effective way to increase the muscle production of livestock and poultry. The Beijing Institute of Animal Husbandry and Veterinary Medicine of the Chinese Academy of Agricultural Sciences has bred MSTN gene-edited pigs using TALEN gene editing technology. After the MSTN gene of the pig was genetically modified, a 2bp base deletion occurred in the third exon, which inhibited the translation of the MSTN gene and significantly increased the lean meat rate of the pig.

[0003] In the large-scale production of gene-edited animals and their products, accurate identification of their molecular characteristics, such as nucleic acid sequences and genotypes, is an essential key prerequisite. In addition, accurate identification of these characteristics is also crucial for the breeding, detection, and supervision of gene-edited animals. In view of this, the development of a highly sensitive and easy-to-operate MSTN gene-edited pig molecular feature identification technology is of immeasurable importance in promoting the rapid development of the industrialization of gene-edited animal biological breeding. Summary of the invention

[0004] The technical problem solved by the present invention is how to quickly and accurately identify the molecular characteristics of MSTN gene-edited pigs.

[0005] In order to solve the above technical problems, the present invention provides a crRNA in a first aspect, which includes crRNA1,

[0006] The nucleotide sequence of the crRNA1 recognition target is SEQ ID NO.1.

[0007] The above crRNA targets the MSTN gene.

[0008] In the crRNA described above, the crRNA1 is obtained by in vitro transcription from transcription template 1;

[0009] The transcription template 1 is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.6 and the single-stranded DNA molecule shown in SEQ ID NO.11.

[0010] In the crRNA described above, the nucleotide sequence of crRNA1 is SEQ ID NO.16.

[0011] In the crRNA described above, the crRNA also includes crRNA2,

[0012] The nucleotide sequence of the crRNA2 recognition target is SEQ ID NO.2.

[0013] In the crRNA described above, the crRNA2 is obtained by in vitro transcription from transcription template 2;

[0014] The transcription template 2 is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.7 and the single-stranded DNA molecule shown in SEQ ID NO.12.

[0015] In the crRNA described above, the nucleotide sequence of crRNA2 is SEQ ID NO.17.

[0016] In a second aspect, the present invention provides a product, comprising the crRNA1, Cas12a protein, a primer pair for specifically amplifying the target, and a single-stranded DNA probe described in the first aspect;

[0017] Or, the product includes the crRNA1, crRNA2, Cas12a protein, a primer pair for specific amplification of the target and a single-stranded DNA probe described in the first aspect;

[0018] And / or, the two ends of the single-stranded DNA probe are respectively labeled with different groups;

[0019] And / or, the group is a fluorescent group, a quenching group and / or biotin.

[0020] In the product described above, the primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO.21 and a single-stranded DNA molecule shown in SEQ ID NO.22;

[0021] The products described above are test kits, test strips or fluorescence detection systems.

[0022] The single-stranded DNA probe is a single-stranded DNA rich in AT bases with a length of 10-50 nt.

[0023] The above-mentioned single-stranded DNA probe can be specifically as follows:

[0024] The two ends of the single-stranded DNA probe used for fluorescence detection are labeled with a fluorescent group and a quenching group respectively;

[0025] The single-stranded DNA probe used for test strip detection is labeled with a fluorescent group and biotin at both ends.

[0026] The products mentioned above have any of the following functions:

[0027] B1) Identify or assist in identifying MSTN gene-edited pigs;

[0028] B2) identifying or assisting in identifying whether the sample to be tested contains the MSTN gene editing sequence;

[0029] B3) Identify or assist in identifying the genotype of MSTN gene-edited pigs.

[0030] In a third aspect, the present invention provides any of the following substances:

[0031] A1) the Cas12a protein and the crRNA described in the second aspect, or a complex formed by the two;

[0032] A2) the Cas12a protein, the crRNA1 and the crRNA2 described in the second aspect, or a complex formed by each crRNA and the Cas12a protein;

[0033] A3) The primer pair described in the second aspect.

[0034] In a fourth aspect, the present invention provides the use of the crRNA described in the first aspect and the product described in the second aspect in any of the following:

[0035] B1) Identify or assist in identifying MSTN gene-edited pigs;

[0036] B2) identifying or assisting in identifying whether the sample to be tested contains the MSTN gene editing sequence;

[0037] B3) Identify or assist in identifying the genotype of MSTN gene-edited pigs;

[0038] B4) Prepare products for identification or assisting in the identification of MSTN gene-edited pigs;

[0039] B5) preparing a product for identifying or assisting in identifying whether the sample to be tested contains the MSTN gene editing sequence;

[0040] B6) Prepare products for identifying or assisting in identifying the genotype of MSTN gene-edited pigs.

[0041] In a fifth aspect, the present invention provides a method for identifying or assisting in identifying MSTN gene-edited pigs, comprising the following steps:

[0042] C1) using the nucleic acid of the sample to be tested as a template, and performing RPA amplification with the primer pair described in the second aspect to obtain an RPA product;

[0043] C2) preparing a CRISPR-Cas12a detection system containing the following components: the RPA product, the Cas12a protein described in the second aspect, the crRNA1 in the crRNA described in the second aspect, and the single-stranded DNA probe in the second aspect;

[0044] C3) reacting the CRISPR-Cas12a detection system and detecting the reaction product, thereby identifying or assisting in identifying the MSTN gene-edited pig;

[0045] The above detection reaction products are used to identify or assist in identifying the MSTN gene-edited pigs as E or F as follows:

[0046] E. Detect the fluorescence intensity of each reaction product using a fluorescence detection instrument such as an enzyme-labeled instrument or a fluorescence quantitative PCR instrument:

[0047] If the fluorescence intensity of the reaction product of the detection system is extremely significantly (P<0.01) higher than that of the reaction product of the negative control system, the sample to be tested is derived from or may be derived from the MSTN gene-edited pig; if the fluorescence intensity of the reaction product of the detection system is not significantly (P>0.05) higher than that of the reaction product of the negative control system, the sample to be tested is not derived from or may not be derived from the MSTN gene-edited pig; the negative control system is different from the detection system only in that crRNA1 is not added;

[0048] F. Each reaction product is tested with colloidal gold test strips (Cas12 / 13 special nucleic acid colloidal gold test strips (JY0301) Beijing Libo Taiye Technology Co., Ltd.):

[0049] If both the T and C lines detected by the reaction product of the detection system are colored or only the T line is colored (positive), the sample to be tested is derived from or may be derived from the MSTN gene-edited pig; if the C line detected by the reaction product of the detection system is colored and the T line is not colored (negative), the sample to be tested is not derived from or may not be derived from the MSTN gene-edited pig.

[0050] In a sixth aspect, the present invention provides a method for identifying or assisting in identifying the genotype of an MSTN gene-edited pig, comprising the following steps:

[0051] D1) using the nucleic acid of the sample to be tested as a template, and performing RPA amplification with the primer pair described in the second aspect to obtain an RPA product;

[0052] D2) preparing CRISPR-Cas12a detection system 1 and CRISPR-Cas12a detection system 2 containing the following components;

[0053] The CRISPR-Cas12a detection system 1 includes the RPA product, the Cas12a protein described in the second aspect, the crRNA1 in the crRNA described in the second aspect, and the single-stranded DNA probe described in the second aspect;

[0054] The CRISPR-Cas12a detection system 2 includes the RPA product, the Cas12a protein described in the second aspect, the crRNA2 in the crRNA described in the second aspect, and the single-stranded DNA probe described in the second aspect;

[0055] D3) reacting the CRISPR-Cas12a detection system 1 and the CRISPR-Cas12a detection system 2 separately, detecting the reaction products of the two systems, thereby identifying or assisting in identifying the MSTN gene-edited pig genotype.

[0056] In the above, the reaction products of the two systems are detected to identify or assist in identifying the genotype of the MSTN gene-edited pigs. Specifically, colloidal gold test strips (Cas12 / 13 special nucleic acid colloidal gold test strips (JY0301) Beijing Libo Taiye Technology Co., Ltd.) can be used for detection, as follows:

[0057] If the reaction product of the detection system 1 detects that both the T and C lines are colored or only the T line is colored (positive), and the reaction product of the detection system 2 detects that the C line is colored and the T line is not colored (negative), then the sample to be tested is derived from or is a candidate for being derived from a homozygous MSTN gene-edited pig;

[0058] If the reaction product of the detection system 1 detects that both the T and C lines are colored or only the T line is colored (positive), and the reaction product of the detection system 2 detects that both the T and C lines are colored or only the T line is colored (positive), then the sample to be tested originates from or is a candidate to originate from a MSTN gene-edited pig heterozygote.

[0059] If the reaction product of the detection system 1 detects that the C line is colored and the T line is not displayed (negative), and the reaction product of the detection system 2 detects that both the T and C lines are colored or only the T line is colored (positive), then the sample to be tested is derived from or may be derived from a wild-type pig with the MSTN gene.

[0060] In the above, the sample to be tested is the ear or other tissue of the pig to be tested.

[0061] The method is for non-disease diagnosis and treatment purposes.

[0062] The nucleotide sequence of the MSTN gene editing sequence above is SEQ ID NO.24.

[0063] The experiments of the present invention have proved that the present invention provides a molecular feature identification method for MSTN gene-edited pigs based on the CRISPR / Cas12a system, which has high sensitivity, strong specificity, simplicity and ease, is convenient for rapid on-site detection, and is economical, simple, efficient and fast, laying the foundation for the commercial production of MSTN gene-edited pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 Standard plasmid sequencing results for MSTN gene-edited pigs (A) and MSTN gene wild-type pigs (B).

[0065] Figure 2 The results of RPA primer amplification are shown in Figure 2.

[0066] Figure 3 The results of crRNA activity detection targeting the MSTN gene editing sequence. ** indicates a very significant difference compared with the negative control group (NC) (P<0.01), and ns indicates no significant difference compared with the negative control group (NC) (P>0.05).

[0067] Figure 4 The results of crRNA activity detection targeting the wild-type sequence of the MSTN gene. ** indicates a very significant difference compared with the negative control group (NC) (P<0.01), and ns indicates no significant difference compared with the negative control group (NC) (P>0.05).

[0068] Figure 5 The sensitivity results of RPA amplification targeting the MSTN gene editing sequence.

[0069] Figure 6 The sensitivity results of RPA amplification targeting the wild-type sequence of the MSTN gene.

[0070] Figure 7 The fluorescence detection sensitivity results of the targeted MSTN gene editing sequence. ** indicates a very significant difference compared with the negative control group (P<0.01), and ns indicates no significant difference compared with the negative control group (P>0.05).

[0071] Figure 8 The results of fluorescence detection sensitivity targeting the wild-type sequence of the MSTN gene. ** indicates a very significant difference compared with the negative control group (P<0.01), and ns indicates no significant difference compared with the negative control group (P>0.05).

[0072] Fig. 9 The results of detecting pig nucleic acid samples using the GEcrRNA system (GEcrRNA-1).

[0073] Fig.10This is the result of detecting pig nucleic acid samples using the WTcrRNA system (WTcrRNA-1).

[0074] Fig.11 These are the results of combined detection of pig nucleic acid samples using the GEcrRNA system (GEcrRNA-1) and the WTcrRNA system (WTcrRNA-1). DETAILED DESCRIPTION

[0075] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0076] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0077] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0078] The present invention is described below in conjunction with specific examples, which are merely exemplary and are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions.

[0079] The main reagents used in the following examples are:

[0080] LbCas12a protein (EDE0005) was purchased from Guangzhou Aidi Gene Technology Co., Ltd.; 10×LbCas12aCleavage Buffer (EDE0005) was purchased from Guangzhou Aidi Gene Technology Co., Ltd.; tissue DNA extraction kit (DP304-03) was purchased from Tiangen Biochemical Technology Co., Ltd.; EX Taq enzyme (RR001Q) was purchased from Takara; CloneSmarter TOPO cloning vector kit (C5865-50) was purchased from Sino-US Taihe Biotechnology (Beijing) Co., Ltd.; Escherichia coli DH5α competent cells (B528413-0100) were purchased from Sangon Biotech (Shanghai) Co., Ltd.; primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.; T7 in vitro transcription kit (AM1354) was produced by Invitrogen; RNA purification kit RNA purification recovery kit (T2040ST) was produced by NEB; single-stranded DNA fluorescent probe was synthesized by Sangon Biotech (Shanghai) Co., Ltd.; single-stranded DNA colloidal gold test paper probe (EDN-THD02) was purchased from Guangzhou Aidi Gene Technology Co., Ltd.; Cas12 / 13 special nucleic acid detection test strip (JY0301) was purchased from Beijing Libo Taiye Technology Co., Ltd.; TwistAmp Basic kit (TABS03KIT) was purchased from Beijing Libo Taiye Technology Co., Ltd.

[0081] The main instruments are as follows: PCR instrument (C1000 Touch TM , BIO-RAD); desktop high-speed refrigerated centrifuge (Heraeus Multifuge X1R, Thermo); bacterial incubator (MIR-254, SANYO); vortex shaker (SA8, Stuart-equipment); electronic weighing balance (Sartorius SQP, Sartorius Scientific Instrument Co., Ltd.); gel imaging system (BIO-RAD, Universal Hood II); constant temperature water bath (HHS-21-4, Changzhou Noki Instrument Co., Ltd.); fluorescence quantitative PCR instrument (QuantStudio TM 5, Thermo Scientific).

[0082] The MSTN gene-edited pigs in the following examples were prepared according to the following method:

[0083] The MSTN gene-edited pigs were bred by the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences. The third exon of the MSTN gene of the pigs had a 2bp base deletion, which caused the MSTN gene to terminate translation prematurely and could not produce functional MSTN protein, thereby increasing the lean meat rate.

[0084] The MSTN gene-edited pig is described in the following literature, and its name in the literature is “MSTN - / - MS pigs", the literature is Fan, Z., Z. Liu, K. Xu, T. Wu, J. Ruan, X. Zheng, S. Bao, Y. Mu, T. Sonstegard, & K. Li. Long-term, multidomain analyzes to identify the breed and allelic effects in MSTN-edited pigs to overcome lameness and sustainably improve nutritional meatproduction. Sci China Life Sci,2022,65(2):362-375.

[0085] The MSTN gene-edited pigs in the following examples were prepared according to the following method:

[0086] “MSTN - / - The "MS pigs" were mated with wild-type Meishan pigs (from the Meishan pig breeding farm in Jiading District, Shanghai, hereinafter referred to as MSTN gene wild-type pigs (wild type, WT)) to produce offspring pigs. The offspring pigs were genotyped, and the offspring pigs with a 2bp base deletion in the third exon of the MSTN gene were the MSTN gene-edited pigs in the following embodiments.

[0087] The method of the above genotype detection is as follows:

[0088] The genomic DNA of the pig ear skin tissue or tail skin tissue was extracted, and PCR amplification was performed with primers MSTN-PCR-F (5`-TTGCTACTATTAACTCTTCTTTCA-3`) and MSTN-PCR-R (5`-TATATTATTTGTTCTTTGCCATTA-3`) and gel electrophoresis was performed. The electrophoresis detection showed that the sample with a single band of about 370 bp in length was a successfully amplified sample. The PCR amplification product was sent to Shanghai Biotech Co., Ltd. for sequencing.

[0089] The Sanger sequencing results of the PCR products were compared with the MSTN genome reference sequence (genbank number: NM_214435, submitted on 2024-4-3) in the SnapGene software. The sequencing results showed a genotype with MSTN single gene editing on two homologous chromosomes and a deletion of bases 126-127 in the third exon (748-1128 of the NM_214435 sequence), which was named MSTN gene-edited pig homozygote.

[0090] The sequencing results showed that one homologous chromosome had the MSTN single gene edited genotype and the base 126-127 of the third exon was deleted, and the other homologous chromosome had the wild-type MSTN genotype, named MSTN gene-edited pig heterozygote.

[0091] The sequencing results showed that both homologous chromosomes had wild-type MSTN genotypes, and the pigs were named MSTN gene wild-type pigs or wild-type pigs.

[0092] The homozygous MSTN gene-edited pig has only a base deletion at positions 126-127 of the third exon of the MSTN gene (genbank number: NM_214435, submitted on 2024-4-3) in the two homologous chromosomes compared to the MSTN gene in the wild-type pig (genbank number: NM_214435, submitted on 2024-4-3), and the other nucleotide residues remain unchanged.

[0093] The MSTN gene-edited pig heterozygote is a pig with only a base deletion (i.e., a 2 bp base deletion) at positions 126-127 of the third exon of the MSTN gene (genbank number: NM_214435, submitted on 2024-4-3) in one homologous chromosome compared to the wild-type pig with the MSTN gene (genbank number: NM_214435, submitted on 2024-4-3), and the other nucleotide residues remain unchanged; the other homologous chromosome is the same as the MSTN gene in the wild-type pig with the MSTN gene.

[0094] Example 1. RPA-CRISPR / Cas12a nucleic acid detection system for detecting MSTN gene-edited pigs 1. Acquisition of crRNA

[0095] 1. Standard plasmid construction

[0096] A tissue DNA extraction kit was used to extract ear tissue DNA from homozygous MSTN gene-edited pigs and wild-type MSTN pigs (WT), and the primers shown in Table 1 were used to amplify the upstream and downstream sequences of the target site of the third exon of the MSTN gene to obtain PCR products.

[0097] Table 1 Primers for amplifying MSTN gene

[0098] name Sequence (5′-3′) length MSTN-PCR-F TTGCTACTATTAACTCTTCTTTCA 24bp MSTN-PCR-R TATATTATTTGTTCTTTGCCATTA 24bp

[0099] The PCR reaction system is as shown in Table 2:

[0100] Table 2 PCR reaction system

[0101]

[0102]

[0103] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 57.6°C for 30 s, extension at 72°C for 30 s, 34 cycles; 72°C for 5 min.

[0104] The PCR products were gel-recovered and purified, and the purified products were connected to the pClone-EZ-TOPO vector (China-US Taihe Biotechnology (Beijing) Co., Ltd., C5865-50). After sequencing verification, the gene-edited pig MSTN gene standard plasmid pClone-EZ-TOPO-GE and the wild-type pig MSTN gene standard plasmid pClone-EZ-TOPO-WT were obtained.

[0105] pClone-EZ-TOPO-GE is a vector obtained by replacing the TOPOI site of the pClone-EZ-TOPO vector with the MSTN gene editing sequence (SEQ ID NO.24).

[0106] pClone-EZ-TOPO-WT is a vector obtained by replacing the TOPOI site of the pClone-EZ-TOPO vector with a wild-type sequence (SEQ ID NO. 25).

[0107] Compared with the wild-type sequence, the above-mentioned MSTN gene editing sequence is a sequence obtained by deleting bases 161-162 of the wild-type sequence.

[0108] The sequencing results of the two plasmids are as follows Figure 1 As shown, Figure 1 A is the sequencing result of the standard plasmid of gene-edited pig MSTN gene. Figure 1 B is the sequencing result of the standard plasmid of wild-type porcine MSTN gene.

[0109] 2. crRNA target design

[0110] According to the DNA sequence within 40bp upstream and downstream of the 2bp deletion site in the third exon of the MSTN gene of the MSTN gene-edited pig and the MSTN gene wild-type pig, the sequence that meets the recognition requirements of LbCas12a is found, and then 5 candidate target sites are screened out according to the rules such as sequence GC content and sequence complementarity, among which GEcrRNA-T1 is the candidate target site screened for the gene-edited pig MSTN, and WTcrRNA-T1 to WTcrRNA-T4 are the candidate target sites screened for the wild-type pig (wild type, WT, wild type) of the MSTN gene, as shown in Table 3.

[0111] Table 3 Candidate target sites

[0112]

[0113]

[0114] 3. Preparation of specific crRNA in vitro transcription template

[0115] According to the candidate target site sequence, the T7 promoter sequence (TAATACGACTCACTATAGGG)) (Chen J Set al. Science, 2018, 360(6387): 436-439.) and the crRNA repeat region template sequence (TAATTTCTACTAAGTGTAGAT) were added to form the specific crRNA in vitro transcription template positive-strand DNA sequence (SEQ ID NO.6-10) shown in Table 4, and the negative-strand DNA sequence (SEQ ID NO.11-15) was formed according to the complementary pairing of the positive-strand DNA sequence.

[0116] Table 4 Specific crRNA in vitro transcription template positive and negative strands

[0117]

[0118]

[0119] The positive-strand DNA and the negative-strand DNA were synthesized, and the specific crRNA in vitro transcription template was prepared by annealing. The annealing reaction system as shown in Table 5 was prepared in the PCR tube:

[0120] Table 5 Annealing reaction system

[0121] Components volume Positive-strand DNA (100 μM) 2.0μL Negative strand DNA (100 μM) 2.0μL <![CDATA[ddH2O]]> 16.0μL Total volume 20.0μL

[0122] Place the PCR tube in a PCR instrument and incubate at 95°C for 10 minutes, then immediately turn off the PCR instrument to allow the double-stranded strand to slowly cool down at room temperature, and incubate on ice for 5 minutes after 90 minutes. The annealed product is the crRNA in vitro transcription template and can be used for crRNA in vitro transcription.

[0123] 4. Specific crRNA in vitro transcription

[0124] The T7 in vitro transcription kit produced by Invitrogen was used to prepare the transcription system in a PCR tube as shown in Table 6:

[0125] Table 6 Specific crRNA in vitro transcription system

[0126] Components volume Nuclease-free water 16.0μL NTP buffer Mix 10.0μL crRNA in vitro transcription template 2.0μL T7 RNA Polymerase Mix 2.0μL Total volume 30.0μL

[0127] The transcription system was placed in a 37°C incubator for overnight incubation. The crRNA was recovered using an RNA purification and recovery kit produced by NEB.

[0128] The recovered crRNA sequences are shown in Table 7:

[0129] Table 7 crRNA sequences

[0130]

[0131] 2. Design and Screen RPA Primers

[0132] According to the upstream and downstream sequences of the target site of the third exon of the porcine MSTN gene, RPA amplification primers were designed. The candidate RPA primer sequences are shown in Table 8 below:

[0133] Table 8 RPA amplification primers

[0134]

[0135] The RPA reaction system is as shown in Table 9:

[0136] Table 9 RPA reaction system

[0137] Components volume Buffer 29.5μL Upstream primer F 2.4μL Downstream primer R 2.4μL DNA template 2.0μL <![CDATA[ddH2O]]> 11.2μL MgOAc 2.5μL Total volume 50.0μL

[0138] The RPA reaction conditions are as follows:

[0139] Incubate at 39°C for 30 min.

[0140] At 4.1×10 10 The standard plasmid pClone-EZ-TOPO-GE of MSTN gene-edited pig MSTN gene with 10 copies / μL was used as a template, and RPA amplification was performed using the primer pairs (F and R) shown in Table 8, the system and RPA reaction conditions shown in Table 9 to obtain RPA amplification products.

[0141] The RPA amplification products of each primer pair were subjected to agarose gel electrophoresis. Figure 2 As shown in the figure, MSTN-PRA-1 represents MSTN-RPA-1F / MSTN-RPA-1R, and so on. It can be seen that the amplification product of MSTN-RPA-1F / R is more single and brighter than the amplification products of the other two pairs of primers.

[0142] Primers MSTN-RPA-1F (SEQ ID NO.21) and MSTN-RPA-1R (SEQ ID NO.22) with better amplification effects were selected as RPA amplification primers.

[0143] 3. Screening of crRNA

[0144] The DNA probe in Table 10 is a single-stranded DNA fluorescent probe double-labeled with a 6-FAM group and a BHQ1 group, and the sequence is 6-FAM-TTATT-BHQ1. The CRISPR / Cas12a fluorescence detection system is prepared according to the components shown in Table 10 below:

[0145] Table 10 CRISPR / Cas12a fluorescence detection system

[0146]

[0147]

[0148] Among them, the RPA products were 4.1×10 10 The standard plasmids pClone-EZ-TOPO-GE and pClone-EZ-TOPO-WT with 100 copies / μL were used as DNA templates for RPA amplification (MSTN-RPA-1F (SEQ ID NO.21) and MSTN-RPA-1R (SEQ ID NO.22)). The crRNAs were GEcrRNA-1, WTcrRNA-1, WTcrRNA-2, WTcrRNA-3 and WTcrRNA-4, respectively.

[0149] According to the above system, GEcrRNA-1, WTcrRNA-1, WTcrRNA-2, WTcrRNA-3 and WTcrRNA-4 detection systems were prepared respectively, and 3 technical replicates were set up for each detection system, and a negative control (NC) without crRNA was set up). The prepared detection system was reacted at 37°C in a Q5 quantitative PCR instrument for 60 minutes, and the fluorescence intensity was set to be detected every 30 seconds.

[0150] The results are as follows Figure 3 As shown, GEcrRNA-1 only specifically targets and cuts the MSTN gene editing (GE) sequence, producing fluorescence with a very significant difference (P<0.01) compared with the NC group, and does not cut the wild-type (WT) sequence of the MSTN gene. Therefore, GEcrRNA-1 can specifically recognize the GE sequence and can be used to distinguish GE and WT samples.

[0151] Figure 4 The results showed that WTcrRNA-1 only specifically targeted and cleaved the WT sequence, producing fluorescence with a significant difference (P<0.01) compared with the NC group, and did not cleave the GE sequence. Therefore, WTcrRNA-1 can specifically recognize the WT sequence and can be used to distinguish WT and GE samples.

[0152] WTcrRNA-2 and WTcrRNA-3 have cutting effects on both WT and GE sequences, and both produce fluorescence that is significantly different from that of the NC group (P<0.01). They cannot specifically identify the WT sequence, so WTcrRNA-2 and WTcrRNA-3 cannot be used to distinguish between WT and GE samples.

[0153] WTcrRNA-4 had no cleavage effect on either WT or GE sequences. The fluorescence values ​​of the WT and GE groups were not significantly different from those of the NC group (P>0.05), and could not be used to distinguish WT samples from GE samples.

[0154] IV. Establishment of RPA-CRISPR / Cas12a nucleic acid detection system

[0155] 1. RPA amplification

[0156] The DNA of the sample to be tested was extracted as a template, and RPA amplification was performed using MSTN-RPA-1F / MSTN-RPA-1R primers according to the system and RPA reaction conditions shown in Table 9 to obtain an RPA amplification product.

[0157] 2. CRISPR / Cas12a detection of MSTN gene-edited pigs

[0158] 1))CRISPR / Cas12a fluorescence detection

[0159] The above RPA amplification product and GEcrRNA-1 were prepared into a CRISPR / Cas12a fluorescence detection system according to the system shown in Table 10 to obtain a GEcrRNA-1 fluorescence detection system;

[0160] Three technical replicates were set up for each of the above detection systems, and a negative control (NC) without crRNA was set up.

[0161] The prepared detection system was reacted in a Q5 quantitative PCR instrument at 37°C for 60 minutes.

[0162] The reaction products of each of the above fluorescence detection systems were used to detect the fluorescence intensity in real time using a Q5 quantitative PCR instrument.

[0163] If the fluorescence intensity of the reaction product of the GEcrRNA-1 detection system is extremely significantly (P<0.01) higher than that of the reaction product of the negative control system, the sample to be tested contains or is a candidate for containing the MSTN gene editing sequence (SEQ ID NO.24), or the sample to be tested is derived from or is a candidate for being derived from an MSTN gene-edited pig; if the fluorescence intensity of the reaction product of the GEcrRNA-1 detection system is not extremely significantly (P>0.01) higher than that of the reaction product of the negative control system, the sample to be tested does not contain or is a candidate for not containing the MSTN gene editing sequence (SEQ ID NO.24), or the sample to be tested does not originate from or is a candidate for not being derived from an MSTN gene-edited pig.

[0164] The above negative control system differs from the GEcrRNA-1 detection system only in that no crRNA is added.

[0165] The above-mentioned MSTN gene-edited pigs are MSTN gene-edited pigs homozygous or MSTN gene-edited pigs heterozygous.

[0166] 2)) CRISPR / Cas12a test strips

[0167] The above RPA amplification product and GEcrRNA-1 were prepared into a CRISPR / Cas12a test strip detection system according to the system shown in Table 11 to obtain a GEcrRNA-1 test strip detection system;

[0168] The DNA probe in Table 11 is a single-stranded DNA test strip probe doubly labeled with a Biotin group and a 6-FAM group, and the sequence is 6-FAM-TTTTTTTATTTTTTT (SEQ ID NO. 23)-C6Biotin.

[0169] Table 11 CRISPR / Cas12a test strip detection system

[0170]

[0171] The GEcrRNA-1 test strip detection system was prepared according to the above system, and a negative control (NC) without crRNA was set up.

[0172] Each of the above detection systems was set up with 3 technical replicates, and a negative control (NC) without crRNA was set up).

[0173] The prepared detection system was reacted in a PCR instrument at 37° C. for 30 minutes to obtain a reaction product (reaction solution).

[0174] The reaction products of each of the above-mentioned test strip detection systems are detected using Cas12 / 13 dedicated nucleic acid detection test strips.

[0175] Open the tube cap and insert the pad end of the test strip into the reaction solution. The liquid level should not exceed the upper end of the pad. Wait until the reading area is completely soaked (it takes about 1 to 2 minutes. When the external ambient temperature is low, such as in winter, the water absorption speed will be reduced and the soaking time of the reading area will be extended). Read the test results directly according to the color development of the test strip.

[0176] If the reaction product detection result of the GEcrRNA-1 detection system is that only the T line is colored or both the C line and the T line are colored (positive), then the sample to be tested contains or is a candidate for containing the MSTN gene editing sequence (SEQ ID NO.24), or the sample to be tested is derived from or is a candidate for being derived from an MSTN gene-edited pig; if the reaction product detection result of the GEcrRNA-1 detection system is that only the C line is colored and the T line is not colored (negative), then the sample to be tested does not contain or is a candidate for not containing the MSTN gene editing sequence (SEQ ID NO.24), or the sample to be tested does not originate from or is a candidate for not being derived from an MSTN gene-edited pig.

[0177] 3. CRISPR / Cas12a detection of MSTN gene-edited pig genotype

[0178] The above RPA amplification product and GEcrRNA-1 were prepared into a CRISPR / Cas12a test strip detection system according to the system shown in Table 11 to obtain a GEcrRNA-1 test strip detection system;

[0179] The above RPA amplification product and WTcrRNA-1 were prepared into a CRISPR / Cas12a fluorescence detection system according to the system shown in Table 11 to obtain a WTcrRNA-1 test strip detection system.

[0180] Read the test results directly according to the color development of the test strip.

[0181] If the reaction product of the GEcrRNA-1 detection system is detected as positive (the T line of the product of the GEcrRNA-1 reaction system is colored or the C line and T line are colored at the same time), and the reaction product of the WTcrRNA-1 detection system is detected as negative (the C line of the product of the WTcrRNA-1 reaction system is colored and the T line is not colored), then the sample to be tested is derived from or is a candidate for being derived from the MSTN gene-edited pig homozygote;

[0182] If the reaction product of the GEcrRNA-1 detection system is detected as positive (the product of the GEcrRNA-1 reaction system shows T line color or the C line and T line show color at the same time), and the reaction product of the WTcrRNA-1 detection system is also detected as positive (the product of the WTcrRNA-1 reaction system shows T line color or the C line and T line show color at the same time), then the sample to be tested is derived from or can be derived from the MSTN gene-edited pig heterozygote.

[0183] If the reaction product of the GEcrRNA-1 detection system is detected as negative (the C line of the product of the GEcrRNA-1 reaction system is colored and the T line is not colored), and the reaction product of the WTcrRNA-1 detection system is detected as positive (the T line of the product of the WTcrRNA-1 reaction system is colored or the C line and the T line are colored at the same time), the sample to be tested is derived from or is a candidate to be derived from a wild-type pig with the MSTN gene.

[0184] The above-mentioned MSTN gene-edited pig RPA-CRISPR / Cas12 detection system includes: GEcrRNA-1 and / or WTcrRNA-1, MSTN-RPA-1F primer, MSTN-RPA-1R primer, LbCas12a protein, and single-stranded DNA probe.

[0185] Example 2: Sensitivity analysis of the MSTN gene-edited pig CRISPR / Cas12a nucleic acid detection system

[0186] Dilute the MSTN gene-edited pig standard plasmid pClone-EZ-TOPO-GE and the MSTN gene wild-type pig standard plasmid pClone-EZ-TOPO-WT to 4.1×10 10 4.1×10 9 4.1×10 8 4.1×10 7 4.1×10 6 4.1×10 5 4.1×10 4 4.1×10 3 4.1×10 2 4.1×10 1 4.1×10 0 copies / μL concentration.

[0187] Using gradient concentrations of pClone-EZ-TOPO-GE plasmid and pClone-EZ-TOPO-WT plasmid as templates, RPA amplification was performed using the aforementioned RPA primers (MSTN-RPA-1F / R) and conditions, and the RPA products were detected by electrophoresis.

[0188] The results of RPA amplification of the standard plasmid pClone-EZ-TOPO-GE are shown in Figure 5 At a plasmid concentration of 4.1×10 2 When the concentration of plasmid is 200 copies / μL, the brightness of the electrophoresis band is already quite weak. When the concentration of plasmid is even lower, the result is not visible.

[0189] The results of RPA amplification of the standard plasmid pClone-EZ-TOPO-WT are shown in Figure 6At a plasmid concentration of 4.1×10 2 When the concentration of plasmid is lower, the brightness of the electrophoresis band is very weak. When the concentration of plasmid is lower, the result is not visible.

[0190] The above RPA product was used as the detection template, and CRISPR / Cas12a fluorescence detection was performed using the GEcrRNA-1 fluorescence detection system and the WTcrRNA-1 fluorescence detection system.

[0191] The detection system and reaction conditions are shown in Example 1.

[0192] The fluorescence intensity detection results of GEcrRNA-1 fluorescence detection system and WTcrRNA-1 fluorescence detection system are shown in Figure 7 and Figure 8 When the standard plasmid concentration is 4.1×10 1 When the detection results were 1000 copies / μL, the results were still orders of magnitude different from those of the negative control, and the difference in fluorescence intensity was extremely significant (P<0.01). This showed that the detection sensitivity of the GEcrRNA-1 system and the WTcrRNA-1 system was 4.1×10 1 copies / μL, with higher sensitivity.

[0193] Example 3: Detection of pig nucleic acid samples using the MSTN gene-edited pig RPA-Cas12a nucleic acid detection system

[0194] The MSTN gene-edited pig nucleic acid detection system provided by the present invention is used to analyze MSTN gene-edited pigs (homozygous samples: 77, 78, 80, 82, 1407; heterozygous samples: 1394, 1396, 1398, 1399, 1401), MSTN gene wild-type pigs (sample numbers: 3082, 3086, 3090, 3097, 3106), and other gene-edited pigs (sample numbers: 191, 193, 1347, 1350, 1356) samples to detect whether the system can accurately identify MSTN gene-edited pig samples.

[0195] The above nucleic acid samples are all extracted from the genomic DNA of each pig.

[0196] The RPA amplification system was prepared according to the composition in Table 9, and the prepared amplification system was reacted in a thermostat at 39° C. for 30 minutes.

[0197] A single-stranded DNA test strip probe double-labeled with a Biotin group and a 6-FAM group was synthesized, and the sequence was 6-FAM-TTTTTTTATTTTTTT-C6Biotin. A CRISPR / Cas12a detection system was prepared according to the components in Table 11 to obtain a GEcrRNA-1 test strip detection system and a WTcrRNA-1 test strip detection system, and a negative control (NC) without crRNA was set up.

[0198] The prepared test strip detection system was reacted in a thermostat at 37° C. for 30 minutes to obtain a reaction product (reaction solution).

[0199] The reaction solution is tested with a Cas12 / 13 dedicated nucleic acid test strip, and the test result is directly read according to the color development of the test strip.

[0200] The results are as follows Fig. 9 and Fig.10 As shown, Fig. 9 In the figure, the number above each test strip indicates the sample number. When the RPA-Cas12a detection system with GEcrRNA-1 as crRNA detects nucleic acid samples of MSTN gene-edited pig homozygotes, MSTN gene-edited pig heterozygotes, MSTN gene wild-type pigs (wild pigs), and other gene-edited pigs, the nucleic acid samples containing MSTN gene-edited sequences (MSTN gene-edited homozygotes, MSTN gene-edited heterozygotes) have T-line color development or both C-line and T-line color development, which is a positive result. The test results of nucleic acid samples without MSTN gene-edited sequences (wild pigs, other gene-edited pig nucleic acid samples) are consistent with the negative control results, with C-line color development and T-line no color development reaction, showing a negative result. This shows that the GEcrRNA-1 system combined with colloidal gold test paper can accurately detect nucleic acid samples containing MSTN gene-edited sequences.

[0201] Fig.10 In the RPA-Cas12a detection system with WTcrRNA-1 as crRNA, when the nucleic acid samples of MSTN gene-edited homozygous pigs, MSTN gene-edited heterozygous pigs, wild pigs, and other gene-edited pigs were tested, the samples without wild-type sequence of MSTN gene (MSTN gene-edited homozygous pigs) were consistent with the negative control results, with C line coloring and T line no coloring reaction, showing a negative result. The test results of samples containing wild-type sequence of MSTN gene (MSTN gene-edited heterozygous pigs, wild pigs, and other gene-edited pigs) were T line coloring or both C line and T line coloring, showing a positive result. This shows that the WTcrRNA-F1 system combined with colloidal gold test paper can accurately detect nucleic acid samples containing wild-type sequence of MSTN gene.

[0202] The combined use of GEcrRNA-1 and WTcrRNA-1 detection systems can accurately determine the genotype of pig nucleic acid samples. Fig.11 As shown, when the detection result of the GEcrRNA-1 system is positive and the detection result of the WTcrRNA-1 system is negative, it indicates that the nucleic acid sample is a sample of the MSTN gene-edited pig homozygote; when the detection result of the GEcrRNA-1 system is positive and the detection result of the WTcrRNA-1 system is also positive, it indicates that the nucleic acid sample is a sample of the MSTN gene-edited pig heterozygote; when the detection result of the GEcrRNA-1 system is negative and the detection result of the WTcrRNA-1 system is positive, it indicates that the nucleic acid sample is a wild-type sample of the MSTN gene.

[0203] Therefore, by using the crRNAs such as GEcrRNA-1 and WTcrRNA-1 and the detection method provided by the present invention, the genotype of MSTN gene-edited pigs can be determined quickly, with high sensitivity and high specificity, and can be applied to the detection, breeding, production, and supervision of MSTN gene-edited pigs.

[0204] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. crRNA, comprising crRNA1, The nucleotide sequence of the crRNA1 recognition target is SEQ ID NO.

1.

2. The crRNA according to claim 1, characterized in that: The crRNA1 is obtained by in vitro transcription from the transcription template 1; The transcription template 1 is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.6 and the single-stranded DNA molecule shown in SEQ ID NO.

11.

3. The crRNA according to claim 1 or 2, characterized in that: The nucleotide sequence of the crRNA1 is SEQ ID NO.

16.

4. According to any one of claims 1-3, the crRNA is characterized in that: The crRNA also includes crRNA2, The nucleotide sequence of the crRNA2 recognition target is SEQ ID NO.

2.

5. The crRNA according to claim 4, characterized in that: The crRNA2 is obtained by in vitro transcription from the transcription template 2; The transcription template 2 is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.7 and the single-stranded DNA molecule shown in SEQ ID NO.

12.

6. The crRNA according to claim 4 or 5, characterized in that: The nucleotide sequence of the crRNA2 is SEQ ID NO.

17.

7. A product comprising the crRNA1, Cas12a protein, a primer pair for specific target amplification and a single-stranded DNA probe described in any one of claims 1 to 6; Or, the product comprises crRNA1, crRNA2, Cas12a protein, a primer pair for specific amplification of the target and a single-stranded DNA probe as described in any one of claims 4-6; And / or, the two ends of the single-stranded DNA probe are respectively labeled with different groups; And / or, the group is a fluorescent group, a quenching group and / or biotin.

8. The product according to claim 7, characterized in that: The primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO.21 and a single-stranded DNA molecule shown in SEQ ID NO.22; Alternatively, the product is a test kit, a test strip or a fluorescence detection system.

9. Any of the following substances: A1) the Cas12a protein described in claim 7 and the crRNA1, or a complex formed by the two; A2) the Cas12a protein, the crRNA1 and the crRNA2 described in claim 7, or a complex formed by each crRNA and the Cas12a protein; A3) The primer pair according to claim 7 or 8.

10. Use of the crRNA according to any one of claims 1 to 6 or the product according to any one of claims 7 to 8 in any of the following: B1) Identify or assist in identifying MSTN gene-edited pigs; B2) identifying or assisting in identifying whether the sample to be tested contains the MSTN gene editing sequence; B3) Identify or assist in identifying the genotype of MSTN gene-edited pigs; B4) Prepare products for identification or assisting in the identification of MSTN gene-edited pigs; B5) preparing a product for identifying or assisting in identifying whether the sample to be tested contains the MSTN gene editing sequence; B6) preparing products for identifying or assisting in identifying the genotype of MSTN gene-edited pigs; Or, a method for identifying or assisting in identifying MSTN gene-edited pigs, comprising the following steps: C1) using the nucleic acid of the sample to be tested as a template, performing RPA amplification with the primer pair described in claim 7 or 8 to obtain an RPA product; C2) preparing a CRISPR-Cas12a detection system containing the following components: the RPA product, the Cas12a protein described in claim 7 or 8, the crRNA1 in the crRNA described in claim 7 or 8, and the single-stranded DNA probe described in claim 7 or 8; C3) reacting the CRISPR-Cas12a detection system and detecting the reaction product, thereby identifying or assisting in identifying the MSTN gene-edited pig; Or, a method for identifying or assisting in identifying the genotype of MSTN gene-edited pigs, comprising the following steps: D1) using the nucleic acid of the sample to be tested as a template, performing RPA amplification with the primer pair described in claim 7 or 8 to obtain an RPA product; D2) preparing CRISPR-Cas12a detection system 1 and CRISPR-Cas12a detection system 2 containing the following components; The CRISPR-Cas12a detection system 1 comprises the RPA product, the Cas12a protein described in claim 7 or 8, the crRNA1 in the crRNA described in claim 7 or 8, and the single-stranded DNA probe described in claim 7 or 8; The CRISPR-Cas12a detection system 2 comprises the RPA product, the Cas12a protein described in claim 7 or 8, the crRNA2 in the crRNA described in claim 7 or 8, and the single-stranded DNA probe described in claim 7 or 8; D3) reacting the CRISPR-Cas12a detection system 1 and the CRISPR-Cas12a detection system 2 separately, detecting the reaction products of the two systems, thereby identifying or assisting in identifying the MSTN gene-edited pig genotype.

Images