Gene related to disease resistance of pepper cucumber mosaic virus and application thereof

Abstract

The invention belongs to the field of plant genetic engineering, and discloses a pepper cucumber mosaic virus disease resistance related gene and application thereof. According to the invention, an overexpression plant of the capsicum gene Capana00g000026 and a silent plant of the capsicum gene Capana00g000026 are constructed, after the capsicum gene Capana00g000026 is inoculated with the cucumber mosaic virus, the characteristics of the capsicum gene Capana00g000026 and the silent plant are identified, and the effect of the capsicum gene Capana00g000026 in the prevention of the capsicum infected with the cucumber mosaic virus is analyzed; screening genes related to defense; it is proved that the accumulation amount of viruses in pepper leaves can be remarkably reduced by increasing the content of the gene, the plant susceptible phenotype is weakened, and therefore the gene can be applied to pepper antiviral engineering. The gene provided by the invention can be used for capsicum, and a breeding material with CMV resistance can be cultivated by transforming a capsicum material.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and more specifically relates to application of a pepper E3 ubiquitin ligase BAH1-like gene Capana00g000026 in improving pepper's resistance to cucumber mosaic virus. Background Art

[0002] Cucumber mosaic virus (CMV) is one of the top ten RNA viruses that seriously harm plants. It has a wide range of hosts and can infect more than 1,200 plant species (Mochizuki and Ohki, 2012). It has a wide range of transmission and a high incidence rate (Palukaitis et al., 1992). Pepper (Capsicum annuum L.) is the vegetable with the largest cultivated area in my country (Ahn et al., 2018). CMV is one of the most important constraints in pepper production and is found in almost all pepper-growing areas around the world. Peppers infected with CMV can cause yellowing of leaves, severe mosaic, distortion (Chaim et al., 2001), shrinkage and dwarfing of plants, and systemic necrosis. The quality and yield of fruits are greatly affected (Zitter and Murphy, 2009). Severe infection can lead to a yield reduction of more than 80%. So far, there are no safe and effective prevention and control measures. Breeding pepper varieties resistant to CMV is still one of the economical and effective ways to effectively defend against CMV damage.

[0003] In traditional breeding, dominant resistance genes (R genes) related to CMV resistance are generally used to breed resistant varieties. However, the dominant resistance genes for CMV resistance that have been identified are mostly quantitative trait loci (QTLs), which makes it difficult to clone and analyze the function of a single gene. Introducing multiple genes at the same time is also difficult in breeding. In existing studies, it was found that a single gene Capana00g000026 in pepper can significantly enhance the resistance of pepper plants to CMV virus, reduce the accumulation of the virus in the plant, and weaken the susceptible phenotype of the plant. At present, the disease resistance function of this gene has not been reported, and it is a new disease resistance functional gene that can be applied to crop breeding. Summary of the invention

[0004] The present invention mainly provides the application of pepper E3 ubiquitin ligase BAH1-like gene Capana00g000026 in regulating pepper resistance to CMV virus. The pepper Capana00g000026 gene of the present invention has three variable splices, and the specific nucleotide sequence is shown in SEQ ID NO.05-07, and the amino acid sequence encoded by the Capana00g000026 gene is shown in SEQ ID NO.16-18. The gene of the present invention can be used for pepper, and breeding materials with CMV resistance can be cultivated by transforming pepper materials.

[0005] In order to achieve the above object, the present invention adopts the following technical measures to study the function of Capana00g000026 gene in pepper, especially its effect on anti-virus (cucumber mosaic virus CMV).

[0006] First, three alternative splicing forms of the gene were cloned; at the same time, a vector for silencing the gene and a vector for overexpressing the three alternative splicing forms of the gene were constructed.

[0007] Then, these four vectors were transformed into Agrobacterium GV3101 for subsequent gene silencing and overexpression experiments.

[0008] Furthermore, VIGS transient silencing and gene disease resistance identification were performed on the corresponding pepper leaves mediated by Agrobacterium, and transient overexpression and disease resistance identification were performed on the corresponding pepper leaves mediated by Agrobacterium.

[0009] Finally, the expression of Capana00g000026 gene in pepper and the accumulation of cucumber mosaic virus (CMV) were detected by real-time fluorescence quantitative PCR to evaluate the role of this gene in antiviral resistance.

[0010] The experimental results confirmed that increasing the content of this gene can significantly reduce the accumulation of viruses in pepper leaves and weaken the disease phenotype of the plants.

[0011] Compared with the prior art, the present invention has the following advantages:

[0012] The present invention discloses for the first time the application of the Capana00g000026 gene of pepper in regulating the resistance of pepper to CMV virus. Using pepper as a receptor, the results of gene silencing and overexpression prove that the expression level of the Capana00g000026 gene of pepper is related to the resistance level of the plant to CMV virus, and increasing the expression level of the gene in pepper plants can significantly improve the resistance to the virus. Therefore, by overexpressing the Capana00g000026 gene of pepper, the resistance of the plant to CMV can be improved. Therefore, the gene can be applied to pepper antiviral engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The results of PCR detection of three variable splicing full-length clones of Capana00g000026 gene in Example 1;

[0014] Figure 2 The results of PCR detection of Agrobacterium positive clones in Example 4;

[0015] Figure 3 This is a schematic diagram of detecting the expression level of the Capana00g000026 gene in pepper leaves after silencing the Capana00g000026 gene in Example 7;

[0016] Figure 4 This is a schematic diagram of detecting the CMV accumulation in pepper leaves with Capana00g000026 gene silenced in Example 8;

[0017] Figure 5 This is a schematic diagram of detecting the CMV accumulation in pepper leaves transiently transformed with the Capana00g000026 gene overexpression vector in Example 8;

[0018] Figure 6 The disease-susceptible phenotype of pepper plants after inoculation with CMV after overexpression of the Capana00g000026 gene in Example 8;

[0019] The data in the figure are the mean ± SD of at least 3 biological replicates, ** indicates a significant difference at the P < 0.01 level, and **** indicates a significant difference at the P < 0.0001 level. DETAILED DESCRIPTION

[0020] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all from commercial channels.

[0021] Example 1: Full-length cloning of pepper E3 ubiquitin ligase BAH1-like gene

[0022] Using the genomic cDNA of pepper (Capsicum annuum L.) as a template, the CDS region of the Capana00g000026 gene was PCR amplified. Due to the presence of the 5' variable splicing region, three fragments of different lengths can be cloned. The forward primers of the three variable splicing regions are F1:ATGAAGTTTGGAGAAATATTTTTGGA, as shown in SEQ ID NO.01; F2:ATGAGTTGGTGGATAATTTTAGGA, as shown in SEQ ID NO.02; F3:ATGGACAACGACACGATGATCATCA, as shown in SEQ ID NO.03, and the reverse primer is the same as R1:TCATTCAGAAGCATGTCTTTCCTT, as shown in SEQ ID NO.04, and finally the nucleotide sequences are obtained, as shown in SEQ ID NO.05, SEQ ID NO.06, and SEQ ID NO.07.

[0023] The specific steps are as follows:

[0024] (1) Total RNA was extracted from fresh or frozen pepper (Capsicum annuum L.) tissues and reverse transcribed into cDNA using reverse transcriptase, which was used as a template for PCR amplification.

[0025] (2) Based on the sequence information of the Capana00g000026 gene (the NCBI gene library number of variable splicing X1 is XM_047399045.1, the NCBI gene library number of variable splicing X2 is XM_049525128.1, and the NCBI gene library number of variable splicing X2 is XM_047399047.1), three forward primers (F1, F2, F3) were designed to target the 5' variable splicing region, and a reverse primer (R1) was designed to amplify the 3' end of the CDS region. Due to the different transcription start points or splicing modes at the 5' end of the gene, mRNA transcripts of different lengths will be generated. Therefore, different forward primers (F1, F2, F3) were used to perform PCR amplification on these different transcripts to obtain three DNA fragments of different lengths.

[0026] The primer sequences are as follows:

[0027] Forward primer F1: ATGAAGTTTGGAGAAATATTTTTGGA (SEQ ID NO.01);

[0028] Forward primer F2: ATGAGTTGGTGGATAATTTTAGGA (SEQ ID NO. 02);

[0029] Forward primer F3: ATGGACAACGACACGATGATCATCA (SEQ ID NO. 03);

[0030] Reverse primer R1: TCATTCAGAAGCATGTCTTTCCTT (SEQ ID NO.04).

[0031] (2) PCR amplification: PCR reaction system: total volume 50 μL, PrimeSTAR Max Premix (2X) 25 μL, primers F1 / F2 / F3 and R1 1 μL each (10 mM), and template cDNA 1 μL (100-200 ng / μL), and the volume was made up to 50 μL with sterile water.

[0032] The PCR reaction conditions were set as follows: pre-denaturation at 98°C for 3 min, denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 15 s, 35 cycles, extension at 72°C for 5 min, and storage at 4°C for 10 min.

[0033] (3) PCR product detection: The PCR product in the previous step was subjected to agarose gel electrophoresis. Figure 1 As shown, it can be seen that the expected DNA fragment was amplified. According to the electrophoresis results, a clear and single band was selected for subsequent operations. According to the sequencing results, the full-length sequence of the three variable splicing regions of the pepper E3 ubiquitin ligase gene was obtained, as shown in SEQ ID NO.05, SEQ ID NO.06, and SEQ ID NO.07.

[0034] Example 2: Construction of gene silencing vector

[0035] The target gene was silenced using a virus-induced gene silencing system.

[0036] Select the identical and specific fragments (about 300 bp) in the three variable splicing regions obtained in Example 1, design forward and reverse primers, perform PCR on the three variable splicing regions, use the kit to purify and recover according to the steps in the instruction manual, and connect the recovered fragments into the enzyme-cut TRV2 vector through homologous recombination.

[0037] The TRV2 backbone enzyme cutting system is: EcoRI: 2μL, SmaI: 2μL, 10*cut smart buffer: 5μL, DNA: 25μL, sterile water: 16μL; total 50μL.

[0038] The forward primer is F4: GTGAGTAAGGTTACCGAATTCGCCATGATGAATGTTATTGCT (SEQ ID NO. 08),

[0039] The reverse primer is R2: TCGGGACATGCCCGGGATGTCCACAGCCTAAAGCGTAT (SEQ ID NO. 09).

[0040] In order to achieve homologous recombination with the vector TRV2, a homologous fragment was added to the 5' end of the forward primer F4 (F: 5'-GTGAGTAAGGTTACCGAATTC-3'); and a homologous fragment was added to the 5' end of the reverse primer R2 (R: 5'-TCGGGACATGCCCGGG-3').

[0041] The specific steps of recombination and transformation of the target gene and the silencing vector TRV2 are as follows:

[0042] (1) Prepare the recombination reaction system (10 μL), including 5×CE II Buffer: 2 μL; Exanse II: 1 μL; DNA fragment (the molar amount of the DNA fragment is controlled to be 3-10 times that of the vector DNA); ddHO 2 0 to 10 μL. Incubate in a 37°C metal bath for 30 min to allow the target fragment to connect to the TRV2 vector via homologous recombination;

[0043] (2) All the above ligation products were added to 100 μL DH5α competent cells and placed on ice for 30 min. After heat shock at 42°C for 45 s, the cells were placed in an ice water bath for 2 min.

[0044] (3) Add 200 μL LB liquid medium and culture at 37°C with shaking at 150 rpm / min for 60 min; then + , 100 mg / L) on LB solid medium overnight;

[0045] (4) Spread the transformed cells on LB solid medium containing kanamycin and culture overnight. Pick a single colony and place it on LB liquid medium (kanamycin). + , 100 mg / L) and cultured for about 4 hours. At the same time, PCR colony detection was performed for positive clones, and Sanger sequencing was performed to confirm that the target fragment had been successfully inserted into the TRV2 vector, thus obtaining the recombinant plasmid vector TRV2-Capana00g000026.

[0046] Example 3: Construction of gene overexpression vector

[0047] The three CDS coding regions of the Capsicum annuum L. Capana00g000026 gene cloned in Example 1 were connected into the overexpression vector p19, cloned by homologous recombination, and then screened and identified.

[0048] 1. Obtaining the target gene: The three variable splices of the pepper E3 ubiquitin ligase BAH1-like gene (as shown in SEQ ID NO.05, SEQ ID NO.06, and SEQ ID NO.07) obtained in Example 1 were respectively used as the target genes, and then specific primers were designed. The 5' end of the primer had the same homologous fragments as the two ends of the backbone vector p19 (F: 5'-AGTCTCTCTCTACAAGAT-3'; R: 5'-TCTAGATCCGGTGGAT-3'), and the target gene was amplified by PCR. The specific primers are as follows:

[0049] The forward primer is F5: AGTCTCTCTCTACAAGATATGAAGTTTGGAGAAATATTTTTGGA (SEQ ID NO. 19);

[0050] The forward primer is F6: AGTCTCTCTCTACAAGATATGAGTTGGTGGATAATTTTAGGA (SEQ ID NO. 19);

[0051] The forward primer is F7: AGTCTCTCTCTACAAGATATGGACAACGACACGATGATCATCA (SEQ ID NO. 21);

[0052] The reverse primer is R3: TCTAGATCCGGTGGATTCATTCAGAAGCATGTCTTTCCTT (SEQ ID NO. 22).

[0053] 2. Enzyme digestion: xhoI and SmaI were used to perform double digestion on the backbone vector p19. The enzyme digestion system was the same as in Example 2.

[0054] 3. Recovery and purification: The backbone vector p19 after enzyme digestion and the target gene amplified by PCR need to be recovered and purified using a kit to remove impurities and unreacted reagents.

[0055] 4. Recombination and transformation: the target gene recovered and purified by the kit is homologously recombined with the backbone vector p19, and the recombinant product is transformed into Escherichia coli for amplification and screening. The specific steps are the same as those in Example 2.

[0056] 5. Screening and identification: The transformed E. coli need to be screened to select clones containing recombinant plasmids. The clones screened were identified and compared by Sanger sequencing to obtain three overexpression vectors, p19-X1, p19-X2, and p19-X3.

[0057] Example 4: Plasmid transformation of Agrobacterium GV3101

[0058] For plasmid extraction, the E. coli cells containing the target plasmids (TRV2-Capana00g000026 and p19-X1, p19-X2, p19-X3) in Example 2 and Example 3 were operated according to the plasmid extraction kit, with specific reference to the instructions. Further, the accuracy of the target fragment sequence recombined into the vector was confirmed by sequencing. The recombinant plasmid extracted and purified above was then transformed into Agrobacterium GV3101, and the method steps were as follows:

[0059] (1) Add 1 μg of the above four purified plasmids to 100 μL competent Agrobacterium GV3101, gently shake and mix; place on ice for 5 min, immediately place in liquid nitrogen for 5 min; incubate in a 37°C water bath for 5 min; add 500 μL of YEB liquid culture medium, shake and culture at 200 rpm / min on a shaker at 28°C for 2-4 h;

[0060] (2) Centrifuge to remove most of the supernatant, precipitate, mix gently by pipetting, take 100 μL of the bacterial solution, apply it on an LB plate containing 50 mg / L kanamycin and 12.5 mg / L rifampicin, and incubate at 28°C for 48 h;

[0061] (3) When resistant colonies are visible, pick a single colony and inoculate it into 2 mL of YEB medium (containing kanamycin and rifampicin) and culture it at 28°C overnight with shaking. Finally, perform PCR to identify positive colonies. Figure 2 Ensure that the target plasmids TRV2-Capana00g000026 and p19-X1, p19-X2, and p19-X3 are successfully transformed into Agrobacterium GV3101, so as to utilize the infection ability of Agrobacterium to introduce the target gene into plant cells for subsequent gene silencing and overexpression experiments.

[0062] Example 5: Agrobacterium-mediated transient VIGS silencing and identification of disease resistance genes in pepper leaves

[0063] This experiment uses the tobacco rattle virus-mediated gene silencing system (VIGS) technology to silence the target gene Capana00g000026. This technology uses tobacco rattle virus (TRV2) as a vector, inserts the target gene (i.e., the fragment of Capana00g000026 in Example 1) into the TRV2 virus vector, and then introduces the virus vector into plant cells through the Agrobacterium-mediated method, thereby achieving silencing of the target gene. The detailed experimental steps of this part have been completed with reference to Example 2.

[0064] A positive control plant was set up, which was obtained by injection infection with a TRV2 vector containing a specific fragment of the PDS (phytoene desaturase) gene, that is, injection infection with a TRV2:PDS vector, as a visual representation. The PDS gene is an important enzyme gene in plants, which is involved in the synthesis of chlorophyll. When the PDS gene is silenced, the plant body cannot synthesize chlorophyll normally, resulting in albinism of the leaves. Therefore, by observing whether the positive control plant shows albinism, it can be preliminarily judged whether the VIGS system has successfully achieved silencing of the target gene in pepper. Similarly, the preparation steps of TRV2-PDS can be completed with reference to Example 2.

[0065] The specific implementation is as follows:

[0066] (1) Pick positive Agrobacterium monoclones (pTRV1, pTRV2, pTRV2:PDS, pTRV2:Capana00g000026) and place them in liquid LB medium containing 50 mg / mL kanamycin (Kanamycin, Kan) and 10 mg / mL rifampin (Rif). Culture on a 28°C constant temperature shaker with a speed set to 220 rpm / min until the bacterial liquid is saturated.

[0067] In this step, the multiple positive Agrobacterium monoclones picked are Agrobacterium strains containing vectors such as pTRV1, pTRV2, pTRV2-PDS and pTRV2:Capana00g000026, and these strains carry different gene fragments respectively. These clones are obtained by the following steps: pTRV1 is transformed from the tobacco rotaviral genome 1 and then transferred into Agrobacterium. It is an essential component of the tobacco rotaviral virus-mediated gene silencing system (VIGS) and is generally stored in the laboratory for a long time; pTRV2 is transformed from the tobacco rotaviral genome 2, and is an empty vector without additional exogenous fragments, and is also transferred into Agrobacterium for long-term storage. TRV2-PDS is a PDS-specific fragment inserted into the TRV2 vector, and the recombinant plasmid is successfully transferred into Agrobacterium. The specific steps are the same as those in Examples 2 and 4.

[0068] (2) The saturated bacterial solution was diluted and added to a new culture medium. The saturated bacterial solution was added to a liquid LB culture medium (50 ml LB culture medium) containing 50 mg / mL Kan, 10 mg / mL Rif, 10 μM pH 5.6 morpholineethanesulfonic acid (MES) and 40 μM acetosyringone (AS) at a ratio of 1:40, and cultured on a 28°C constant temperature shaker with a speed set to 220 rpm / min for 16 h.

[0069] (3) Agrobacterium was collected at a speed of 5000 rpm / min, the supernatant was discarded, and the culture medium was washed with 200 mM magnesium chloride (MgCl 2 ) and 150 μM AS resuspension solution to resuspend Agrobacterium. Each bacterial solution was adjusted to an appropriate concentration (OD 600 =0.6), then wrapped with tin foil and left at room temperature for 2-3 hours. Finally, Agrobacterium strain suspensions corresponding to the vectors pTRV1, pTRV2, pTRV2:PDS and pTRV2:Capana00g000026 were obtained for injection.

[0070] (4) Before injection, the strain suspensions obtained in step (3) were mixed in groups. pTRV1 was mixed with pTRV2, pTRV2:PDS, and pTRV2:Capana00g000026 in equal amounts, and diluted with the heavy suspension. The injection concentration of the two bacterial suspensions in each group was OD 600 = 0.3. When injecting, the bacterial solution was injected into the leaf through a 1 mL syringe on the back of the cotyledon or true leaf.

[0071] (5) Pepper seedlings were injected at the 3-leaf stage (two cotyledons and one true leaf). The injected pepper plants were placed in a dark culture at 16°C for 56 h and then transferred to normal growth conditions (temperature 20°C, 16h / 8h light / dark cycle).

[0072] (6) After the positive control (injected with TRV2:PDS vector) turns white, select the system leaves of the plants injected with the combination of pTRV1 and pTRV2, and pTRV1 and pTRV2:Capana00g000026 to detect the degree of gene downregulation. After confirming that the target gene is successfully downregulated, cucumber mosaic virus (CMV) is inoculated on the plants that have successfully silenced the Capana00g000026 gene and the control plants. CMV inoculation uses the friction inoculation method: take the plant leaves that preserve the virus, weigh them, and grind them in a mortar, and add a certain proportion of buffer (1.0g of leaf homogenate is added with 10mL, 0.03M KH 2 PO 4 solution, pH 8.0) and an appropriate amount of carbon powder, quickly grind into a homogenate to prepare the virus inoculation solution, and then rub and inoculate on the true leaves of the plants.

[0073] (7) On the 4th and 7th days after inoculation with cucumber mosaic virus (CMV), the leaves of each plant were subsequently sampled to extract total RNA and the accumulation of the virus was detected using fluorescent quantitative PCR to identify its disease resistance.

[0074] Example 6: Agrobacterium-mediated transient overexpression in pepper leaves and identification of disease resistance

[0075] In this example, the overexpression vector prepared in Example 3 was used to obtain an Agrobacterium suspension containing the overexpression vector through Example 4.

[0076] (1) Pick positive Agrobacterium monoclones (p19-X1, p19-X2, p19-X3) and place them in liquid LB medium containing 50 mg / mL kanamycin (Kanamycin, Kan) and 10 mg / mL rifampin (Rif). Cultivate on a 28°C constant temperature shaker with a speed set to 220 rpm / min until the bacterial solution is saturated. At the same time, use Agrobacterium bacterial solution expressing only GFP protein as a control (stored in the laboratory), and shake the culture until the bacterial solution is saturated.

[0077] (2) The saturated bacterial suspension was added to liquid YEB medium containing 50 mg / mL Kan, 10 mg / mL Rif, 10 μM MES (pH 5.6), and 40 μM acetosyringone (AS) at a ratio of 1:40 and cultured with shaking for 16 h.

[0078] (3) Collect Agrobacterium, discard the supernatant, and use a 200 mM magnesium chloride (MgCl 2 ) and 150 μM AS resuspension solution to resuspend Agrobacterium. Each bacterial solution was adjusted to the same concentration (OD 600 =0.8-1.0), then wrap it with tin foil and let it stand at room temperature for 2-3h before injection.

[0079] (4) Pepper seedlings were injected at the 6-leaf stage (two cotyledons and four true leaves). During the injection, the bacterial solution was injected into the leaf through a 1 mL syringe on the back of the cotyledon or true leaf, and then cultured under normal culture conditions after injection.

[0080] (5) One day after the injection, the injected leaves were observed to be normal, and CMV was inoculated on the injected leaves in the same manner as described above. Similarly, on the 4th and 7th days after the inoculation, the systemic leaves of each plant were sampled to detect the accumulation of the virus, so as to further identify its disease resistance.

[0081] Example 7: Real-time fluorescence quantitative PCR detection of the expression of the target gene Capana00g000026

[0082] When the positive control group (injected with a mixed bacterial solution of pTRV1 and pTRV2:PDS vectors) showed albinism symptoms, leaves of individual pepper plants from the experimental group inoculated with CMV in Example 5 (injected with a mixed bacterial solution of pTRV1 and pTRV2:Capana00g000026 vectors) were selected, and leaves of individual pepper plants from the control group inoculated with CMV (i.e., injected with a mixed bacterial solution of pTRV1 and pTRV2 vectors) were selected, RNA was extracted from each plant, and reverse transcription and real-time fluorescence quantitative PCR were performed to detect the expression of the gene.

[0083] The gene CaUbi3 of pepper was used as the internal reference gene, and the primer sequences were as follows: CaUbi3-F: 5'-CCCTGGAATTGCTGACCGTA-3' (SEQ ID NO. 10), CaUbi3-R: 5'-TGGAAAGTGCTGAGGGATGC-3' (SEQ ID NO. 11) as the internal reference gene.

[0084] The forward primer F5 of Capana00g000026 gene: 5'-CCATGATGCAGAAGTGCCAA-3' (SEQ ID NO.12), the reverse primer R3: 5'-GCTCAGCACGCATCTTTGAC-3' (SEQ ID NO.13). The primers are located in the same part of the three variable splicing regions to detect the overall RNA expression level of the three variable splicing regions of the gene. RNA extraction from pepper leaves, reverse transcription of the first strand of cDNA, and fluorescence quantitative PCR were all performed using the kit according to the instructions.

[0085] The results are as follows Figure 3 As shown, the expression level of Capana00g000026 gene was significantly reduced after silencing.

[0086] Example 8: Real-time fluorescence quantitative PCR detection of CMV virus accumulation

[0087] On the 4th and 7th day after inoculation, the leaves of each plant system in Example 5 and each plant system in Example 6 were sampled to extract RNA and reverse transcription and real-time fluorescence quantitative PCR were performed to detect the accumulation of the virus. The pepper gene CaUbi3 was still used as an internal reference gene, and the forward primer for CMV virus detection was F6: 5'-TTCCTGCCTCCTCGGAC TTA-3' (SEQ ID NO.14), and the reverse primer R4: 5'-CTCGAGCGCATCGTCTTTTG-3' (SEQ ID NO.15).

[0088] The results showed that after the Capana00g000026 gene was silenced in the experimental group in Example 5, the accumulation of CMV in the leaves of the experimental group plants increased significantly compared with the control group. Figure 4 shown.

[0089] The results also showed that after the gene (Capana00g000026 gene) was overexpressed in the experimental group in Example 6, the accumulation of CMV in the leaves of the plant system of the experimental group was significantly reduced compared with the control group (GFP). Figure 5 Similarly, the disease phenotype of the experimental group in Example 6 (the leaves of the plant system in which the Capana00g000026 gene of pepper was overexpressed) was relatively weakened compared with the control group, as shown in FIG. Figure 6 shown.

Claims

1. A pepper gene Capana00g000026, characterized in that The nucleotide sequence of the pepper gene Capana00g000026 is shown in SEQ ID NO.05, SEQ ID NO.06, and SEQ ID NO.07, and the protein sequence encoded by the gene is shown in SEQ ID NO.16, SEQ ID NO.17, and SEQ ID NO.

18.

2. Use of the pepper gene Capana00g000026 as claimed in claim 1 in improving the disease resistance of plants to cucumber mosaic virus.

3. The use of the pepper gene Capana00g000026 according to claim 1 in improving the resistance of plants to cucumber mosaic virus, characterized in that: The plant is pepper.

4. An overexpression vector based on the pepper gene Capana00g000026 according to claim 1, characterized in that: The overexpression vector is obtained by connecting the coding region of the pepper gene Capana00g000026 into the overexpression vector.

5. The overexpression vector according to claim 4, characterized in that The overexpression vector is p19.

Images