Application of LYS2 in synthesizing cyclic (proline-valine) in pichia guilliermondii

Abstract

The invention provides application of a gene LYS2 in production of a ring (proline-valine), and belongs to the technical field of biology. The invention discovers the application of LYS2 in synthesizing the ring (proline-valine) in the pichia guilliermondii for the first time. The nucleotide sequence of the gene LYS2 is shown as SEQ ID NO: 1 in a sequence table; the amino acid is as shown in a sequence table SEQ ID NO: 2. A complete ORF (nucleotide 1-3825) exists in DNA (deoxyribonucleic acid) in a sequence table No.1 from the first nucleotide at the 5'end to the initiation codon ATG and from the 3825th nucleotide to the termination codon TAA. After the LYS2 provided by the invention is over-expressed in a recombinant strain, the yield of cyclo (proline-valine) can be remarkably improved by shake flask fermentation, and the LYS2 has the advantage of industrial amplification. The gene provided by the invention plays an important role in ring (proline-valine) synthesis and synthesis of other secondary metabolites.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to LYS2 Genes and their applications. Background Art

[0002] Cyclo(proline-valine) is a dipeptide formed by the condensation of L-proline and L-valine. Cyclo(proline-valine) has a variety of activities such as antibacterial, antitumor, antiarrhythmic, neuroprotective and immunomodulatory, and has broad prospects in the fields of medical treatment and new drug development. The biosynthesis of cyclodipeptides depends on the enzyme catalysis of the cyclodipeptide synthase family and the non-ribosomal peptide synthetase family. Cyclodipeptide synthases include oxidoreductases, 2-oxoglutarate-dependent monooxygenases, cyclodipeptide oxidases (CDOs) and cytochrome p450 enzymes (p450s), methyltransferases (MTs) and prenyltransferases. Non-ribosomal peptide synthetases are a class of multi-domain, modular giant synthases that can synthesize natural products with a wide range of biological activities.

[0003] Non-ribosomal peptide synthetases (NRPS) are a class of large multifunctional enzymes that are widely found in fungi, bacteria, and some plants. Unlike typical ribosome-associated protein synthesis, NRPS can synthesize polypeptide compounds, which usually have important biological activities, such as antibiotics, toxins, hormones, etc. Vancomycin, bleomycin, cyclosporin A, daptomycin, etc. commonly used in clinical practice are all products of NRPS. Unlike ribosome-associated protein synthesis, NRPS connects non-standard amino acid units one by one through a series of unique enzymatic activities to form linear or circular polypeptide chains. The products of NRPS usually have structural diversity and functional diversity, which makes them have important application value in biology, pharmacy and industry.

[0004] NRPS consists of multiple modules, which are arranged in a specific spatial order, and each module includes multiple domains with different functions. The typical NRPS module has an adenylation (A) domain, a thiolation (T) domain, and a condensation (C) domain, which are responsible for the activation of amino acids, the extension of peptide chains, the formation of amide bonds, and the release of peptide chains, respectively. These amino acids are usually transported by non-standard aminoacyl carriers instead of typical tRNA. The A domain is responsible for recognizing and activating amino acids, the T / PCP domain is responsible for carrying amino acids and nascent peptide chains, and the C domain is responsible for catalyzing the formation of peptide bonds. In addition to the A, T, and C domains, NRPS may also include some domains for peptide chain modification, such as epimerization domains, oxidation domains, formylation domains, methylation domains, heterocyclization domains, reduction domains, etc. The last module of NRPS generally includes a thioesterase domain, which is responsible for terminating extension and releasing the end product, and some can also mediate the cyclization of mature products at the same time. In addition, some terminal reductases or certain C domains have similar activities to the TE domain and can replace the TE domain and also play the role of releasing the final product.

[0005] At present, the exploration of NRPS genes is limited, and only a small number of NRPS genes have been identified. The lack of high-resolution structural information of NRPS extension modules has hindered people from further understanding the catalytic mechanism of this type of giant synthase. For example, the key domains in NRPS, how amino acids recognize substrates, how activation and extension modification domains are embedded in the organizational structure of the whole enzyme, how the complete giant synthase synthesizes the final product through the movement of key domains, and how the various domains of itself dynamically coordinate to complete the catalytic cycle are all unknown. Therefore, it is urgent to explore more NRPS genes to reveal their catalytic role in the synthesis of cyclodipeptides for the synthesis of cyclodipeptides, and can be used for industrial scale-up.

[0006] Generally speaking, LYS2 Regulates the L-lysine biosynthetic pathway, the secondary metabolite biosynthetic pathway, and the amino acid biosynthetic pathway. In these pathways in yeast, Lys2p functions to activate α-aminoadipate by ATP-dependent adenylation and subsequently reduce the activated α-aminoadipate using NADPH. The enzyme binds the activated α-aminocaproate to its phosphopantetheine group before reducing it to (S)-2-amino-6-oxohexanoate. This specialized enzyme functions as an oxidoreductase that specifically targets aldehyde or oxygen groups in the donor and converts them to NADPH. + or NADP + As receptors. LYS2 The research on LYS2 Regulation of the proline-valine loop in yeast has not been reported.LYS2 Studies of the regulatory loop (proline-valine) in yeast are highly needed. Summary of the invention

[0007] In order to achieve the above-mentioned object of the invention, the technical solution of the present invention is as follows: In one aspect, the present invention provides a gene LYS2 , which was derived from the marine yeast Pichia quaternaria isolated from the mangrove sediments of the North Sea in this experiment. Pichia guilliermondii ) GXDK6, described LYS2 The nucleotide sequence is shown in SEQ ID NO: 1, and the amino acid sequence encoded by the nucleotide sequence is shown in SEQ ID NO: 2.

[0008] Pichia guilliermongosaccharomyces cerevisiae carrying this gene Pichia guilliermondii ) GXDK6 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on June 25, 2018, with the deposit number CGMCC No.16007.

[0009] Sequence Listing SEQ ID NO: 1 is LYS2 The nucleotide sequence of this gene is located between nucleotides 1 to 3825 of the clone, starting with the start codon ATG at nucleotides 1-3 and ending with the stop codon TAA at nucleotides 3823-3825. This ORF has a total of 3825 nucleotides and can encode a polypeptide consisting of 1274 amino acids. Naganishia cereali The large subunit of α-aminoadipate reductase is 99% identical to Meyerozyma sp The sequence identity of the large subunit of L-2-aminoadipate reductase of JA9 is 97%, which is consistent with Candida albicans The identity of α-aminoadipate reductase of ATCCMYA-2876 was 72.4%, confirming that the gene was the gene encoding the large subunit of α-aminoadipate reductase LYS2 There is currently no information about LYS2 Reports related to the synthesis of cyclo(proline-valine).

[0010] The present invention provides a gene LYS2 Application in the preparation of cyclo(proline-valine).

[0011] Preferably, the invention relates to the use of the invention to improve the yield of cyclic (proline-valine).

[0012] The present invention also provides a recombinant microorganism, which is a recombinant microorganism that upregulates the ring (proline-valine).

[0013] Preferably, the expression level or activity of cyclo(proline-valine) in the recombinant microorganism is increased; orLYS2 Gene gain, increased copy number or increased activity.

[0014] The present invention provides LYS2 In the wild-type strain mediated by overexpression plasmid pGAPZ A Pichia guilliermondii After overexpression in GXDK6, the cyclic (proline-valine) can be produced after shake flask fermentation, with a significantly increased yield and advantages for industrial scale-up.

[0015] Through LYS2 Knockout of Pichia guilliermondii Loss of the ability of GXDK6 to synthesize the RING(proline-valine).

[0016] The protein Lys2p encoded by the gene provided by the present invention is expressed in marine yeast Pichia guilliermondii GXDK6 has broad applications in the synthesis of cyclic (proline-valine) and bulk synthesis of cyclic (proline-valine). BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 For amplification from Pichia guilliermondii LYS2 Electrophoresis of the purified gene (3825 bp).

[0018] Figure 2 pGAPZ A- LYS2 Electropherogram of recombinant vector verification (2062 bp).

[0019] Figure 3 for LYS2 Knockout validation diagram (1, 2, 3 in Figure A correspond to the PCR products amplified using primers validation-2-F and validation-2-R, and the resulting band size is 2726 bp. Bands 4, 5, and 6 are PCR products obtained using primers validation-1-F and validation-1-R, and the band size is 2809 bp. Bands 7, 8, and 9 are target genes. LYS2 In panel B, bands 1 and 2 correspond to PCR products amplified using primers Validation-3-F and Validation-3-R, with a band size of 2825 bp. ).

[0020] Figure 4 for Pichia guilliermondii Liquid phase determination results of GXDK6 ring (proline-valine).

[0021] Figure 5 Figure 2 is a graph showing the yield of cyclic (proline-valine) in the overexpression strain.

[0022] Figure 6 for LYS2 Diagram of the liquid phase assay of the knockout strain loop (proline-valine). DETAILED DESCRIPTION

[0023] The present invention is further described in detail below in conjunction with specific embodiments, which are intended to explain the present invention rather than to limit it.

[0024] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0025] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0026] Example 1 Gene LYS2 The cloning method comprises the following steps: Step 1: From Pichia guilliermondii Genomic DNA was extracted and purified from GXDK6 using the following steps: (1) Pichia guilliermondii The GXDK6 seed solution was inoculated into 100 mL YPD medium and cultured for 12 h. 2 mL of bacterial suspension was taken and centrifuged at 8000 rpm for 2 min. The supernatant was discarded and the bacterial pellet was retained. (2) Extraction using the Yeast Genome Extraction Kit (Solabo) Pichia guilliermondii GXDK6 genomic DNA.

[0027] Step 2: LYS2 Gene amplification (1) Using GXDK6 genomic DNA as template, LYS2 -F and LYS2 -R primer pair (Table 1) PCR amplification LYS2 The obtained fragment was 3825 bp in size and had no mixed bands ( Figure 1 ).

[0028] Step 3: LYS2 Gene purification The DNA fragment obtained in step 2 was directly purified by column recovery, and the target fragment was purified and recovered using a bio-gel recovery and purification kit (purchased from Shanghai Bio-Engineering Technology Co., Ltd.).

[0029] Sequence Listing SEQ ID NO: 1 is LYS2 The nucleotide sequence encoded by it is shown in SEQ ID NO: 2.

[0030] LYS2 The nucleotide sequence (SEQ ID NO: 1) is as follows: LYS2 The amino acid sequence of the encoded protein (SEQ ID NO: 2) is as follows

[0031] Example 2 LYS2 The method for constructing an overexpression plasmid comprises the following steps: Step 1: Use the plasmid pGAPZ A provided by TAKARA Company of Japan as an overexpression vector. E. coli DH5α was used as the cloning host for the overexpression vector. The purchased plasmid was transformed into E. coli DH5α, cultured in a shaking incubator at 37 °C for 12 h. Take 2 mL of bacterial suspension, centrifuge at 8000 rpm for 2 min, retain the bacterial pellet, and use the rapid plasmid extraction kit (Tiangen, Beijing) for plasmid extraction; Step 2: Linearize the extracted pGAPZ A plasmid using the reverse amplification method to obtain a fragment of 2884 bp with no mixed bands in electrophoresis, and purify and recover the linearized vector fragment using a bio-gel recovery and purification kit (purchased from Shanghai Bio-Engineering Technology Co., Ltd.); Step 3: Pichia guilliermondii GXDK6 genomic DNA was used as template. LYS2 -F1 and LYS2 -R1 primer pair PCR amplification LYS2 The fragment was 3825 bp in size and there was no impurity band in the electrophoresis. The target fragment was directly purified by column recovery and purification using a bio-gel recovery and purification kit (purchased from Shanghai Bio-Engineering Technology Co., Ltd.); Step 4: Use seamless cloning method to LYS2 Construct into linearized pGAPZ A vector, construct LYS2 Overexpression vector. Ligase-independent single-fragment one-step cloning kit (purchased from Novazonics, catalog number C112-01).

[0032] The seamless cloning construction comprises the following steps: Incubate the recombination cloning reaction solution at 50°C for 15 min, then cool to 4°C or immediately place on ice for cooling. Take 5-10 μl of the recombination product and add it to 100 μl E. coliIn DH5α competent cells, gently tap the tube wall to mix, and let it stand on ice for 30 min. After heat shock in a 42℃ water bath for 45 sec, immediately place it on ice to cool for 2-3 min. Add 900 μl LB liquid culture medium (without adding antibiotics) and culture at 37℃ shaking for 1 h (speed 200-250 rpm). Centrifuge at 5,000 rpm for 5 min and discard 900 μl supernatant. Resuspend the bacteria with the remaining culture medium, and use a sterile spreading stick to gently spread it on an LB plate containing 50 μg / mL hygromycin. Culture it in a 37℃ incubator. The next day, pick the positive clones and culture them overnight. Extract the plasmid for PCR verification. The electrophoresis diagram of the recombinant vector verification is shown below. Figure 2 As shown, the recombinant plasmid pGAPZA- LYS2 The primers for plasmid construction are shown in Table 1: Table 1 Primers for constructing LYS2 overexpression vector Name: Primer sequence LYS2-F: ATGTCTGACTTCTGGATCGAC; LYS2-R: TTAGTCAATTGTATCATCTGGTGATTC; pGAPZ AF:CGGCCGCCAGCTTGGGCC; pGAPZ AR:GATCCGAGACGGCCGGCTGG; LYS2-F1: CCAGCCGGCCGTCTCGGATCATGTCTGACTTCTGGATCGACTACTT; LYS2-R1: GGGCCCAAGCTGGCGGCCGTTAGTCAATTGTATCATCTGGTGATTCT; Verify-F:AAATATCTGGCTCCGTTGC; Verify-R:CGAAGAAGGCATGATGCAA;

[0033] Example 3 LYS2 Expression of overexpression plasmids in wild-type hosts LYS2 Construction of overexpression strains The recombinant plasmid obtained in Example 2 was transformed by electroporation Pichia guilliermondii GXDK6 competent cells were then added with 1 mL of YPD medium and incubated on a shaker at 30 °C, 200 rpm for 5 h. Transformants were then selected on YPD plates containing 1 mg / mL zeocin. All mutants were verified by PCR using primers.

[0034] Example 4 Shake flask fermentation to verify the production of cyclic (proline-valine) by recombinant strains: 1. Reagents YPD medium: Each liter of medium contains 10 g yeast powder, 20 g tryptone, 20 g glucose, and deionized water to 1 L; 2. The above solution is sterilized by high pressure steam at a temperature of 115°C for 15 min. 3. Fermentation medium: 20 g glucose, 5 g ammonium sulfate, 0.1 g sodium chloride, 0.5 g magnesium sulfate heptahydrate per liter of medium, dilute to 1 L with sterile deionized water; The above solution was sterilized by high pressure steam at a temperature of 115°C for 15 min.

[0035] Instruments: Constant temperature shaker, constant temperature incubator.

[0036] 4. Shake flask fermentation method: (1) Inoculate the recombinant strain into 100 ml of YPD medium containing 1 mg / mL bleomycin and culture at 30 °C and 200 rpm for 12 h; (2) Take 2 mL of the seed solution after 12 h of culture and inoculate it into 100 mL of fermentation medium. Incubate at 30 °C and 200 rpm for 24 h. (3) Take 2 mL of fermentation broth and centrifuge it (12000 rpm, 1 min). Take 1 mL of supernatant sample for sample treatment and HPLC detection. For sample treatment method, see Method 1. For detection method, see Experimental Method 2.

[0037] Experimental method 1 The pretreatment method of cyclo(proline-valine) fermentation broth sample is as follows: After centrifugation of 2 mL of fermentation broth (12000 rpm, 1 min), 1 ml of supernatant was added with an equal volume of ethyl acetate for three extractions, 600 μl of organic phase was taken and freeze-dried using a freeze-drying vacuum concentrator, and the dried sample was added with 600 μl of chromatographic grade methanol solution and dissolved for 5 min, and the dissolved solution was filtered through a 0.22 μm organic filter membrane.

[0038] Experimental method 2 HPLC determination of cyclic (proline-valine) in fermentation broth The parameters of HPLC are as follows: Chromatographic column: SB-C18, 4.6 mm × 250 mm, 5 μm; Mobile phase A: 100% methanol, mobile phase B: ultrapure water: mobile phase A: mobile phase B = 30:70; Column temperature: 30°C; Flow rate: 1.0 mL / min; Detection wavelength: 220 nm; Injection volume: 1 μL; Detection time: 15 min.

[0039] HPLC spectrum Figure 4 As shown, the peak time of the ring (proline-valine) is 6.7 min. The determination results show that ( Figure 5 ), the cyclic (proline-valine) production of the overexpression strain relative to the wild type Pichia guilliermondii GXDK6 increased the yield by 45.5% to 28.31 mg / L, further proving that the gene LYS2 role.

[0040] Example 5 LYS2 The knockout plasmid construction method is as follows: Step 1: Use the plasmid pMD18-T provided by TAKARA of Japan as the knockout vector. E. coli DH5α was used as the knockout vector cloning host. The purchased pMD18-T plasmid was transformed into E. coli DH5α, cultured in a shaking incubator at 37 °C for 12 h. Take 2 ml of bacterial suspension, centrifuge at 8000 rpm for 2 min, retain the bacterial pellet, and use the rapid plasmid extraction kit (Tiangen, Beijing) for plasmid extraction; Step 2: Linearize the extracted pMD18-T plasmid using the reverse amplification method to obtain a fragment of 2692 bp with no mixed bands in electrophoresis, and purify and recover the linearized vector fragment using a bio-gel recovery and purification kit (purchased from Shanghai Bio-Engineering Technology Co., Ltd.); Step 3: Pichia guilliermondii GXDK6 genomic DNA was used as a template to amplify LYS2 2 kb DNA fragments upstream of the coding region (UP-2000) and 2 kb DNA fragments downstream (DOWN-2000). Hygromycin B selection marker gene (hyg, 1911 bp) was amplified from pMD18-T vector. Purification was performed directly on the column, and the target fragment was purified and recovered using the Bio-Gel recovery and purification kit (purchased from Shanghai Bio-Gel Bio-Engineering Technology Co., Ltd.); Step 4: Use seamless cloning to integrate the three fragments into the purified linearized vector pMD18-T to obtain the knockout vector. Non-ligase-dependent single-fragment one-step cloning kit (purchased from Novozyme Co., Ltd., catalog number C112-01); Step 5: Transform the knockout vector into E. coli DH5α and culture at 37°C for 12-18 hours. Identify the positive clones by blue-white screening. Verify the correct bands by colony PCR and electrophoresis ( Figure 3 ), select a single colony and culture it for another 12 hours. Use a plasmid extraction kit (Sangon, China) to extract the knockout plasmid. The primers are shown in Table 2: Table 2 LYS2 knockout vector primer list Name:Primers sequence pMD18-TF:GGTACCGAGCTCGAATTC; pMD18-TR:GTCGACCTGCAGGCATG; LYS2-U2000-F:TTGCATGCCTGCAGGTCGACCGCCAAGTTCATGACTTGGA; LYS2-U2000-R: GACTCCTCCGATTTTGATTGGTACTGTAGTGGTGAAA; HYG-F: ACAAACAGCCAACATTCAGT; HYG-R: CTCGCATTGGCTCATACGGCTTCG; LYS2-D2000-F:CTCGCCATTGGCTCATACGGCTTCG; LYS2-D2000-R: CGAATTCGAGCTCGGTACCCACATAGTTCTCATGAGGATCAACC; Validation-1-F:TTGGAGCAACCACCCATTCA; Validation-1-R:GAACCGGCGCTTATGAAAC; Validation-2-F: GGCCTTGGAACCCATCAAC; Validation-2-R:CGAATTCGAGCTCGGTACCCACATAGTTCTCATGAGGATCAACC; Validation-3-F:ACAAACAGCCAACATTCAGT; Verification-3-R: AGAATTGGTTTACCAACCGG;

[0041] Example 6 LYS2 Deletion strain construction Use primers to amplify the knockout cassette, purify the knockout cassette fragment, and electroporate into Pichia guilliermondiiIn GXDK6 competent cells, LYS2 Gene knockout. GXDK6 competent cells were plated on hygromycin-resistant YPD plates and cultured at 30 °C for 2 days, and positive colonies resistant to hygromycin B were screened. The deletion mutants were verified using the corresponding primer genes. LYS2 Knockout strains. Evaluation by HPLC LYS2 The production of the ring (proline-valine) in the deletion strain was determined LYS2 Gene in Pichia guilliermondii Function of GXDK6 in C-Cyclic (proline-valine) biosynthesis.

[0042] Example 7 LYS2 The knockout strain's ability to synthesize the ring (proline-valine) Will LYS2 The deletion strain was inoculated into the fermentation medium and fermented in a shake flask. The fermentation liquid was taken and processed for cyclic (proline-valine) determination. The specific method is shown in the shake flask fermentation method, sample pretreatment method and sample detection method above. The results are shown in Figure 6 Shown, indicating LYS2 The gene deletion leads to Pichia guilliermondii The loss of the ability of GXDK6 to synthesize the proline-valine ring further demonstrated LYS2 exist Pichia guilliermondii Essential role of the synthetic ring (proline-valine) in GXDK6.

[0043] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that for ordinary technicians in this field, several variations and improvements can be made, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Genes LYS2 , characterized in that, The gene LYS2 The nucleotide sequence is shown in SEQ ID NO:

1.

2. The gene according to claim 1 LYS2 , characterized in that, Gene LYS2 The nucleotide sequence of the gene is LYS2 The initiation codon ATG, nucleotides 3823-3825 from the 5' end are LYS2 The termination codon TAA is present and there is a complete open reading frame ORF.

3. LYS2 The encoded protein is characterized in that The amino acid sequence of the protein is shown in SEQ ID NO:

2.

4. The gene according to claim 1 LYS2 Application in the preparation of cyclo(proline-valine).

5. The use according to claim 4, characterized in that: The application is application in improving the yield of cyclic (proline-valine).

6. A recombinant microorganism, characterized in that The recombinant microorganism is a recombinant microorganism that upregulates the ring (proline-valine).

7. The recombinant microorganism according to claim 6, characterized in that The expression level or activity of cyclo(proline-valine) in the recombinant microorganism is increased; or LYS2 Gene gain, increased copy number or increased activity.

Images