Protein delivery system based on exosome and application thereof

Abstract

The invention discloses an exosome-based protein delivery system and application thereof. The exosome-based protein delivery system comprises a cargo carrying subsystem and / or an unloading subsystem, wherein a polypeptide peptide fragment expressed by a nucleotide sequence of the cargo carrying subsystem comprises CD63, a connecting peptide, an enterokinase cleavage site and a delivered protein or polypeptide; the polypeptide peptide fragment expressed by the nucleotide sequence of the unloading subsystem comprises CD63, a connecting peptide, enterokinase or an enterokinase light chain. The invention also constructs a human umbilical cord mesenchymal stem cell strain hUC-MSCCDNF-exo from the protein delivery system, and the human umbilical cord mesenchymal stem cell strain hUC-MSCCDNF-exo is preserved in Guangdong Microbial Culture Collection Center on November 13, 2024, and the preservation number is GDMCC NO: 65478. According to the human umbilical cord mesenchymal stem cell strain hUC-MSCCDNF-exo, the purpose of delivering the CDNF to the cytoplasm of a target cell is achieved.

Description

Technical Field

[0001] The present invention relates to the field of drug delivery systems, and in particular to an exosome-based protein delivery system and applications thereof. Background Art

[0002] Exosomes are double-layer membrane lipid inclusions secreted from cells to the extracellular space. They have a diameter of 30-150 nanometers and contain biological macromolecules such as proteins, nucleic acids, and lipids. Exosomes are mainly produced by multivesicular bodies formed by the invagination of intracellular lysosomal particles and released into the extracellular environment through exocytosis. As messengers of intercellular communication, exosomes rely on their unique lipid bilayer structure and the signal molecules they carry to communicate over long distances between different cells, thereby affecting the gene expression and function of cells. Because exosomes have low immunogenicity and good biocompatibility, they can pass through the blood-brain barrier, can target specific cells or tissues, and can prolong the half-life of the encapsulated drugs in the body. Therefore, they are currently being transformed into drug delivery carriers.

[0003] However, the current development of drug delivery systems based on exosomes still has the following shortcomings: (1) The drug loading process of exosomes requires secondary human intervention: The current process of using exosomes to load drugs (such as curcumin, dopamine, paclitaxel, doxorubicin, etc.) first requires obtaining exosomes with high purity, and then mixing the exosomes and the above drugs in proportion under certain conditions. Since this process involves two steps, the following hidden dangers may occur: a. It is difficult to maintain good repeatability in the drug loading process, and it is difficult to ensure the stability of drug loading and release performance between different batches; b. The drug loading process increases the risk of microbial contamination. (2) There is currently no method to make cells directly secrete an exosome that encapsulates a specified protein or peptide.

[0004] Mesenchymal stem cell (MSCs) exosomes are a type of exosomes secreted by MSCs, which have a typical exosome lipid bilayer structure and function. At the same time, due to the biological characteristics of mesenchymal stem cells, the exosomes they secrete are rich in active macromolecules such as cytokines and growth factors compared with the exosomes secreted by other cells. Therefore, mesenchymal stem cell exosomes play an important role in cardiac protection, tissue regeneration, immune regulation, anti-inflammation, etc., and are expected to replace stem cells in the future and become a new treatment method for wound repair, skin regeneration, heart, liver, kidney, nerve and other organ diseases. Summary of the invention

[0005] The present invention constructs an exosome-based protein delivery system based on human umbilical cord mesenchymal stem cell exosomes. The delivery system can secrete a specific exosome that can encapsulate artificially designed proteins or polypeptides with specific functions. The cells deliver the exosome-encapsulated proteins or polypeptides into the cytoplasm through endocytosis, plasma membrane fusion, phagocytosis, etc., thereby achieving the purpose of protein delivery.

[0006] The protein delivery system has the following characteristics: (1) In theory, it can encapsulate and deliver any protein or peptide (except transmembrane proteins). (2) The drug loading of exosomes is completed during the process of cell generation of exosomes, that is, the exosomes secreted by the cells are already drug-loaded exosomes. They can be used after the exosomes are enriched and purified, without the need for artificial drug loading operations, thus greatly improving the repeatability and stability of drug loading. (3) Since the delivered protein or peptide is located inside the exosome, the system mainly delivers proteins or peptides that act on the cytoplasm, and proteins or peptides that act on receptors on the cell membrane are not delivered using this system. (4) The lipid bilayer structure of the exosome can protect the internal proteins or peptides from being degraded by the external environment, thereby prolonging the half-life of the proteins or peptides in the body.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions to achieve the above problems:

[0008] A protein delivery system based on exosomes, including a cargo subsystem and / or an unloading subsystem, which are expression elements of two different polypeptides. Among them, the polypeptide expressed by the cargo subsystem includes the following four parts: from N-terminus to C-terminus: CD63, connecting peptide, enterokinase cleavage site, delivered protein or polypeptide, that is, "CD63-target protein" fusion protein. The cDNA sequence encoding the peptide segment is artificially designed and synthesized. In order to facilitate future modifications, restriction sites are introduced at both ends of the cDNA sequences corresponding to these four parts. Specifically, as one of the embodiments, the cDNA sequence of the cargo subsystem is as follows (5'-3'):

[0009]

[0010]

[0011] (In the above sequence, the underlined italic lowercase letters indicate restriction sites, and the rest of the sequence is in uppercase; the cDNA sequence of the delivered protein or polypeptide is loaded into the expression vector through the 3' BamHI restriction site "ggatcc" and the SalI restriction site "gtcgac")

[0012] (2) The polypeptide expressed by the cargo unloading subsystem consists of three parts, from N-terminus to C-terminus: CD63, connecting peptide, enterokinase or enterokinase light chain. The cDNA sequence encoding the peptide segment was artificially designed and synthesized. In order to facilitate future modification, restriction sites were introduced at both ends of the cDNA sequences corresponding to these three parts. The cDNA sequence of the cargo unloading subsystem is as follows (5'-3'):

[0013]

[0014]

[0015] (In the above sequences, the underlined italic lowercase letters indicate restriction sites, and the rest of the sequences are in uppercase.)

[0016] In actual operation, the choice of restriction sites "gctagc", "atgcat", and "cctagg" of the cargo subsystem is not unique and can be replaced. Therefore, the present invention can obtain different cargo subsystem sequences after replacing the sequences of different restriction sites, and in the sequence of the same cargo subsystem, the design of each restriction site must be different to facilitate precise control of the restriction fragments. If the same restriction site is designed, the enzyme recognition point cannot be accurately located on a certain segment during restriction cutting; similarly, the choice of restriction sites "tctaga", "gctagc", "accggt", and "gcggccgc" of the unloading subsystem is not unique and can be replaced; the nucleotide sequence of the connecting peptide "GGCTCTGGCTCTGGCTCGAGC" is not unique, and can also be replaced with other suitable sequences with connecting functions.

[0017] (3) Promoter design of the unloading subsystem. In the unloading subsystem, in order to make the system highly express the "CD63-enterokinase light chain" fusion protein in a hypoxic environment and not express or express a small amount of the "CD63-enterokinase light chain" fusion protein in a normoxic environment, the promoter of the system was designed to be a hypoxia-responsive promoter.

[0018] (4) Principles of protein delivery system.

[0019] a.CD63 is a four-transmembrane protein that is widely present in the lipid bilayer of exosomes and is one of the classic markers of exosomes. Both the N-terminus and the C-terminus of CD63 are located on the inner side of the membrane of the exosomes. Therefore, the polypeptide peptides expressed by the cargo subsystem can be fused with other proteins or polypeptides at their C-terminus or N-terminus to achieve the purpose of "carrying" these proteins or polypeptides into the exosomes (in practical applications, it is preferred to fuse other proteins or polypeptides at the C-terminus of CD63, because when fused to the C-terminus of CD63, it will be cut behind the K of DDDDK during enzyme cleavage, so there will be no extra DDDDK when the protein or polypeptide is cut off; and if the protein or polypeptide is fused to the N-terminus of CD63, it will be cut before the D of DDDDK during enzyme cleavage, and the delivered protein or polypeptide will have more "DDDDK" impurities when it is cut off). Both the cargo subsystem and the unloading subsystem use the characteristics of CD63 to locate the delivered protein or polypeptide and the enterokinase light chain inside the exosomes. Similarly, the polypeptide peptide expressed by the unloading subsystem may be fused with enterokinase or enterokinase light chain at its C-terminus or N-terminus.

[0020] b. Enterokinase is a heterodimeric serine protease present in the duodenum of mammals. It is composed of a heavy chain and a light chain connected by a disulfide bond. It has the ability to specifically hydrolyze proteins in the pH range of 4.5 to 9.5 and the temperature range of 4 to 45°C. It can efficiently and specifically recognize the DDDDK sequence in the protein and cut it at the C-terminus of the lysine residue. It is reported that the enterokinase light chain also has the ability to recognize the DDDDK sequence and cut it. Therefore, the present invention preferably designs the enterokinase light chain into the unloading subsystem to recognize and cut the DDDDK sequence. Under certain conditions (hypoxia), the enterokinase light chain expressed by the unloading subsystem can recognize the DDDDK sequence of the cargo subsystem and cut it, thereby separating the protein or polypeptide to be delivered in the cargo subsystem from CD63, and turning it into a free protein or polypeptide inside the exosome, achieving the purpose of "unloading".

[0021] c. Since enterokinase is a proteolytic enzyme that can cut proteins with specific sequences, in order to ensure safety, it is necessary to design a "switch" for its expression, which can only promote its high expression under specific conditions. We designed the promoter element of the "CD63-enterokinase light chain" fusion protein gene into a hypoxia-responsive promoter, which makes mesenchymal stem cells not express or express a small amount of "CD63-enterokinase light chain" fusion protein in normoxia, and only highly express "CD63-enterokinase light chain" fusion protein in a hypoxic environment.

[0022] d. In a hypoxic environment, as long as the "CD63-target protein" fusion protein in the exosomes and the "CD63-enterokinase light chain" fusion protein induced by hypoxia are at a suitable distance, the "target protein" will be cut off by the "enterokinase light chain" to become a free protein. After enriching and purifying such exosomes and acting on cells or tissues, the cells will release the "target protein" in the exosomes into the cytoplasm through endocytosis, plasma membrane fusion, phagocytosis, etc., to achieve the purpose of delivery.

[0023] (5) Application of protein delivery system. The delivery system of the present invention is used to deliver brain dopamine neurotrophic factor (CDNF) into the cell cytoplasm. CDNF is a neurotrophic factor that is mainly present in the endoplasmic reticulum of cells and has significant neuroprotective and neurorepair functions. CDNF may exert its functions through the following mechanisms: a. Reducing endoplasmic reticulum (ER) stress by regulating the unfolded protein response (UPR) signaling pathway, thereby providing cell protection. b. Regulating the Raf-JNK-c-Jun pathway through the RTK-PI3K-Akt axis, inhibiting the overactivation and inflammatory response of microglia, improving the local microenvironment of injury, and promoting nerve axon regeneration and spinal cord function recovery. c. By enhancing the functional activity of the proteasome system, CDNF can reverse the degeneration process of dopaminergic neurons. No membrane receptors for CDNF have been found so far. It can be seen that CDNF mainly acts inside the cell, and how exogenous CDNF enters the cell is a problem that must be solved for the clinical application of CDNF.

[0024] The present invention can deliver CDNF into the cell cytoplasm. First, lentiviruses carrying a cargo subsystem and an unloading subsystem are constructed respectively, wherein the cargo subsystem expresses CDNF protein; then these two lentiviruses are used to infect human umbilical cord mesenchymal stem cells, and monoclonal cell lines expressing both the cargo subsystem and the unloading subsystem are screened. We named this human umbilical cord mesenchymal stem cell line hUC-MSC CDNF-exo , deposited in Guangdong Microbial Culture Collection Center on November 13, 2024, with the deposit number GDMCC NO:65478. CDNF-exo After hypoxic culture, the secreted exosomes CDNF-exo are enriched and purified. CDNF-exo contains abundant free CDNF. When CDNF-exo is incubated with cells, CDNF can enter the cell cytoplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Design the schematic diagram for the cargo subsystem structure;

[0026] Figure 2 Design the schematic diagram for the structure of the unloading subsystem;

[0027] Figure 3 It is the principle diagram of the present invention;

[0028] Figure 4 It is the plasmid map of the cargo subsystem;

[0029] Figure 5 Plasmid map for the unloading subsystem;

[0030] Figure 6 This is the Western identification result diagram of Example 6:

[0031] Figure 7 This is the immunofluorescence image after incubation of exosomes and cells in Example 7. DETAILED DESCRIPTION

[0032] In order to allow those skilled in the art to understand the present invention more clearly and intuitively, the present invention will be further described below in conjunction with the accompanying drawings.

[0033] Example 1 Design of the cargo subsystem

[0034] like Figure 1 As shown, the polypeptide expressed by the cargo subsystem includes the following four parts: from N-terminus to C-terminus: CD63, connecting peptide, enterokinase cleavage site, delivered protein or polypeptide, i.e. "CD63-target protein" fusion protein. The cDNA sequence encoding the peptide segment is artificially designed and synthesized. In order to facilitate future modification, restriction sites are introduced at both ends of the cDNA sequences corresponding to these four parts. Specifically, as one of the embodiments, the cDNA sequence of the cargo subsystem is as follows (5'-3'):

[0035]

[0036]

[0037] (In the above sequence, the underlined italic lowercase letters indicate restriction sites, and the rest of the sequence is in uppercase; the cDNA sequence of the delivered protein or polypeptide is loaded into the expression vector through the 3' BamHI restriction site "ggatcc" and the SalI restriction site "gtcgac")

[0038] Example 2 Design of unloading subsystem

[0039] like Figure 2 As shown, the polypeptide expressed by the unloading subsystem consists of three parts, from N-terminus to C-terminus: CD63, connecting peptide, enterokinase or enterokinase light chain. The cDNA sequence encoding the peptide segment is artificially designed and synthesized. In order to facilitate future modification, restriction sites are introduced at both ends of the cDNA sequences corresponding to these three parts. The cDNA sequence of the unloading subsystem is as follows (5'-3'):

[0040]

[0041]

[0042] (In the above sequences, the underlined italic lowercase letters indicate restriction sites, and the rest of the sequences are in uppercase.)

[0043] Protein delivery principles Figure 3 As shown, a lentivirus expressing a cargo subsystem and a lentivirus expressing an unloading subsystem are co-infected with cells, and the exosomes secreted by the cells express the cargo subsystem, and under certain conditions (such as hypoxia), the unloading subsystem is expressed by the enterokinase light chain in the unloading subsystem, and then recognizes the "DDDDK" sequence expressed by the cargo subsystem and cuts it, thereby converting the protein or polypeptide expressed in the cargo subsystem into a free state, and finally releasing the free protein or polypeptide into the target cell in the exosome to complete the delivery purpose.

[0044] Example 3 Construction of a lentivirus expressing a cargo system (CDNF)

[0045] The commercial pCDH-EF1-MCS-T2A-Puro plasmid (HonorGene, HG-VMS0752) was used for transformation; all restriction endonucleases and T4 ligase were purchased from Thermo Fisher Scientific; plasmid mini-extraction purification kits and DNA gel recovery and purification kits were purchased from Axygen; chemically competent cell DH5α strain was purchased from Shanghai Shenggong Biotechnology Co., Ltd.

[0046] 3.1 A DNA fragment was artificially synthesized, which contained cDNAs of the cargo system (SEQ ID NO.1), CDNF (NM_001029954) and EGFP (green fluorescent protein); the fragment between CDNF and EGFP was a T2A connecting peptide, and the nucleotide sequence of CDNF-T2A-EGFP (SEQ ID NO.3) was loaded into the cargo system through the restriction site "ggatcc" of BamHI and the restriction site "gtcgac" of SalI.

[0047] The nucleotide sequence of CDNF-T2A-EGFP is as follows (5'-3'):

[0048]

[0049]

[0050] (In the above sequences, the underlined italic lowercase letters indicate restriction sites, the lowercase letters indicate the cDNA sequence of the T2A connecting peptide, and the rest of the sequences are in uppercase.)

[0051] 3.2 Transformation of pCDH-EF1-MCS-T2A-Puro

[0052] After the plasmid pCDH-EF1-MCS-T2A-Puro vector was expanded and cultured, the plasmid was extracted. After double digestion with NheI and SalI, the 6.4kb fragment was recovered, and then the artificially synthesized DNA fragment synthesized in step 3.1 was double digested with NheI and SalI. The synthesized DNA fragment was cloned into the vector pCDH-EF1-MCS-T2A-Puro after digestion through the same restriction site, and connected using T4 DNAligase ligase. The ligation product was transformed into the competent cell DH5α strain, spread on an ampicillin-resistant solid culture medium plate, and several monoclonal colonies were picked and inoculated into ampicillin-resistant liquid culture medium. The culture was shaken in a constant temperature shaker at 37°C and 200rpm overnight. A small amount of plasmid was extracted and sequenced. The results were confirmed by comparison with SnapGene software to obtain the recombinant plasmid vector pCDH-EF1-cargo system-CDNF-T2A-EGFP ( Figure 4 ).

[0053] 3.3 Vector pCDH-EF1-cargo system-CDNF-T2A-EGFP lentiviral packaging

[0054] HEK293T cells were inoculated into six-well plates and cultured in DMEM medium containing 10% fetal bovine serum. Transfection was performed when the cell confluence reached 70%-80%.

[0055] According to the instructions of EZ Trans Cell Transfection Reagent (High Efficiency) (Shanghai Liji, AC04L092), pCDH-EF1-cargo system-CDNF-T2A-EGFP (20 μg), pVSVG (10 ug), and psPAX2 (15 ug) were co-transfected into HEK293T cells.

[0056] After 6 hours, the culture medium was replaced with DMEM containing 10% fetal bovine serum. After continuing to culture for 60 hours, the culture medium was centrifuged at 3000rpm and 4℃ for 10min to remove cell debris. The supernatant was filtered with a 0.45um low protein binding filter (Millipore SteriflipHV / PVDF) to remove cell debris. The virus-containing culture medium was mixed with a lentivirus concentration kit (Jiman Bio, GM-040801) at a volume ratio of 4:1, placed at 4℃ overnight, and centrifuged at 4℃, 4000g for 25min. Carefully remove the supernatant, add an appropriate volume of DMEM to resuspend to obtain a concentrated virus solution, and store at -80℃.

[0057] Example 4 Construction of a lentivirus expressing the cargo unloading subsystem

[0058] 4.1 A DNA fragment was artificially synthesized, which contained the nucleotide sequence of the hypoxia-responsive promoter (SEQ ID NO.4) and the nucleotide sequence of the cargo unloading subsystem (SEQ ID NO.2). The 5' end of the hypoxia-responsive promoter was the restriction site SpeI, and the 3' end was the restriction site XbaI.

[0059] The nucleotide sequence of the hypoxia-responsive promoter is as follows (5'-3'):

[0060]

[0061] (In the above sequences, the underlined italic lowercase letters indicate restriction sites, and the remaining sequences are capitalized hypoxia response promoter sequences)

[0062] 4.2 Transformation of pCDH-EF1-MCS-T2A-Puro

[0063] After the plasmid pCDH-EF1-MCS-T2A-Puro vector was expanded and cultured, the plasmid was extracted. After double digestion with SpeI and NotI, the 6.5kb fragment was recovered, and the DNA fragment artificially synthesized in step 4.1 was double digested with SpeI and NotI. The synthesized DNA fragment was cloned into the vector pCDH-EF1-MCS-T2A-Puro after digestion through the same restriction site, and connected using T4DNAligase ligase. The ligation product was transformed into the competent cell DH5α strain, spread on an ampicillin-resistant solid culture medium plate, and several monoclonal colonies were picked and inoculated into ampicillin-resistant liquid culture medium. The culture was shaken in a constant temperature shaker at 37°C and 200rpm overnight. A small amount of plasmid was extracted and sequenced. The results were confirmed by comparison with SnapGene software to obtain the recombinant plasmid vector pCDH-Hypoxia Response-Unloading Subsystem-T2A-Puro ( Figure 5 ).

[0064] 4.3 Vector pCDH-hypoxia response-unloading subsystem-T2A-Puro lentiviral packaging

[0065] HEK293T cells were inoculated into six-well plates and cultured in DMEM medium containing 10% fetal bovine serum. Transfection was performed when the cell confluence reached 70%-80%.

[0066] According to the instructions of EZ Trans Cell Transfection Reagent (High Efficiency) (Shanghai Liji, AC04L092), pCDH-Hypoxia Response-Unloading Subsystem-T2A-Puro (20 μg), pVSVG (10 ug), and psPAX2 (15 ug) were co-transfected into HEK293T cells.

[0067] After 6 hours, the culture medium was replaced with DMEM containing 10% fetal bovine serum. After continuing to culture for 60 hours, the culture medium was centrifuged at 3000rpm and 4℃ for 10min to remove cell debris. The supernatant was filtered with a 0.45um low protein binding filter (Millipore SteriflipHV / PVDF) to remove cell debris. The virus-containing culture medium was mixed with a lentivirus concentration kit (Jiman Bio, GM-040801) at a volume ratio of 4:1, placed at 4℃ overnight, and centrifuged at 4℃, 4000g for 25min. Carefully remove the supernatant, add an appropriate volume of DMEM to resuspend to obtain a concentrated virus solution, and store at -80℃.

[0068] Example 5 Construction of a human umbilical cord mesenchymal stem cell line expressing both a cargo subsystem (CDNF) and an unloading subsystem

[0069] 5.1 Human umbilical cord mesenchymal stem cells (MSCs) are isolated and obtained according to conventional and recognized methods, or human umbilical cord mesenchymal stem cells (MSCs) are obtained through other channels.

[0070] 5.2 Infected cells: Inoculate MSC cells into six-well plates and culture them with DMEM / F12 culture medium containing 10% fetal bovine serum. When the cell confluence reaches 70%-80%, add the lentivirus of the cargo subsystem (CNDF) and the unloading subsystem for infection. 24 hours after infection, culture the cells in an oxygen-deficient environment (1% O2 concentration); 48-72 hours after infection, replace the culture medium with fresh culture medium (containing puromycin at a final concentration of 4ug / ml) for screening. After 2-3 days of screening, use an inverted fluorescence microscope to observe the expression of green fluorescence, and use a flow cytometer (FACSAria IIU, BD Biosciences) to sort cells with green fluorescence to obtain a human umbilical cord mesenchymal stem cell line, named hUC-MSC. CDNF-exo The cell line was deposited in Guangdong Provincial Microbiological Culture Collection Center on November 13, 2024, with the deposit number GDMCC NO:65478.

[0071] Example 6 Enrichment of exosomes CDNF-exo and analysis

[0072] 6.1 Inoculation of commercially purchased hUC-MSC and hUC-MSC CDNF-exo Cell lines were placed in 15 cm culture dishes. When the cell confluence reached 70%-80%, the culture medium was removed, washed once with PBS, and replaced with serum-free DMEM / F12 culture medium for hypoxic culture. The culture medium was collected after 48 h of culture. The hypoxic environment was simulated using a three-gas incubator (ESCO, CLL-170T-8) set to 95% N2, 1% O2, and 4% CO2.

[0073] 6.2 After the culture medium was precooled at -80°C, it was freeze-dried for 5 hours using a vacuum freeze dryer (Scientz-50F / A) to concentrate the culture medium to half its volume. According to the instructions of the exosome extraction and purification kit (Shanghai Yumeibo Biotechnology, UR52121), the exosomes were extracted and stored in a -80°C low-temperature refrigerator.

[0074] 6.3Western identification: The extracted exosomes were detected by immunoblotting of hUC-MSC exo (control) and hUC-MSC CDNF-exo The expression levels of CDNF and CD63 in the culture medium. The specific steps include: taking an equal volume of egg exosomes, separating them by SDS-PAGE, and transferring them to a polyvinylidene fluoride membrane (PVDF, Merck millipore, ISEQ00010). Block the membrane with 5% skim milk at room temperature for 1 hour. Then incubate with CDNF antibody (Abcam, ab253238) and CD63 antibody (proteintech, 25682-1-AP) at 4°C overnight, and finally incubate with HRP-conjugated affinipure goat anti-rabbit IgG (H+L) secondary antibody. Application Plus ultrasensitive chemiluminescent reagent (Shanghai Qinxiang, 1810212) was used to detect protein expression levels, and ChemiScope 6100 chemiluminescent plate imaging system was used to observe the bands. The results showed that both groups of samples expressed CD63, but hUC-MSC CDNF-exo The secreted exosomes are rich in CDNF, while the exosomes secreted by hUC-MSCs do not contain CDNF ( Figure 6 ).

[0075] Example 7 Incubating CDNF-exo with cells to analyze the expression and localization of CDNF in cells

[0076] 7.1 Inoculate 4000 hUC-MSC cells into a glass bottom culture dish (Jie Te, BDD011035), and add an equal amount of hUC-MSC after the cells adhere to the wall. exo (control) or hUC-MSC CDNF-exo , and observed after overnight culture.

[0077] 7.2 Immunofluorescence identification: Add 4% paraformaldehyde (PFA) and soak for 20 minutes at room temperature to fix the cells. Aspirate the fixative and wash 3 times with PBS. Add 0.25% Triton X-100 and soak for 20 minutes at room temperature. Aspirate 0.25% Triton X-100 and wash 3 times with PBS. Add 10% blocking serum (goat serum) and incubate at 37°C for 1 hour. Add CDNF antibody (Abcam, ab253238) or endoplasmic reticulum marker Calnexin antibody (Invitrogen, MA5-31501) and incubate overnight at 4°C. Add 0.1% Triton X-100 and wash 3 times at 80rpm, 2min / time. Add secondary antibody Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor TM Plus 488 (Invitrogen, A32723, 1:500), Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor TM Plus555 (Invitrogen, A21428, 1:500) was incubated at 37°C for 1 hour. 0.1% Triton X-100 was washed 3 times at 80 rpm, 2 min / time. DAPI staining was performed for 10 min, and PBS was washed 3 times. An inverted fluorescence microscope was used to image and take pictures. The green fluorescence was marked with CDNF, and the red fluorescence was marked with endoplasmic reticulum ( Figure 7 ). Add hUC-MSC CDNF-exo CDNF was expressed in the cells and localized in the endoplasmic reticulum. exo There is no expression of CDNF in the cells. This result shows that hUC-MSC CDNF-exo It can deliver the encapsulated CDNF into the cell interior and is mainly localized in the endoplasmic reticulum. Scale bar: 10 μm. Figure 7 The white dashed lines in the figure are cell outlines.

[0078] The above description of the embodiments is to facilitate the understanding and application of the present invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the embodiments herein, and improvements and modifications made to the present invention by those skilled in the art based on the disclosure of the present invention should be within the scope of protection of the present invention.

Claims

1. A protein delivery system based on exosomes, characterized in that: It comprises a cargo subsystem and / or an unloading subsystem, wherein the polypeptide peptide segment expressed by the nucleotide sequence of the cargo subsystem sequentially comprises CD63, a connecting peptide, an enterokinase cleavage site, and a delivered protein or polypeptide, and in the cDNA sequence encoding the peptide segment, restriction sites are respectively arranged at both ends of the cDNA sequence corresponding to CD63, a connecting peptide, an enterokinase cleavage site, and a delivered protein or polypeptide; The polypeptide peptide segment expressed by the nucleotide sequence of the unloading subsystem includes CD63, connecting peptide, enterokinase or enterokinase light chain in sequence. In the cDNA sequence encoding the peptide segment, restriction sites are provided at both ends of the cDNA sequence corresponding to CD63, connecting peptide, enterokinase or enterokinase light chain.

2. The exosome-based protein delivery system according to claim 1, characterized in that The cDNA sequence encoding the cargo system is shown in SEQ ID NO.

1.

3. The exosome-based protein delivery system according to claim 1, characterized in that: The cDNA sequence encoding the unloading subsystem is shown as SEQ ID NO.

2.

4. The exosome-based protein delivery system according to claim 1, characterized in that The promoter of the unloading subsystem is a hypoxia-responsive promoter, and preferably, its nucleotide sequence is shown in SEQ ID NO.

4.

5. The exosome-based protein delivery system according to claim 1, characterized in that The enterokinase cleavage site is the DDDDK sequence in the amino acid sequence; CD63, the connecting peptide, the enterokinase cleavage site, and the delivered protein or polypeptide are arranged in sequence from the N-terminus to the C-terminus or from the C-terminus to the N-terminus on the polypeptide peptide segment expressed by the nucleotide sequence of the cargo subsystem, preferably from the N-terminus to the C-terminus; CD63, connecting peptide, enterokinase or enterokinase light chain are arranged in sequence from N-terminus to C-terminus or from C-terminus to N-terminus on the polypeptide peptide segment expressed by the nucleotide sequence of the unloading subsystem, preferably from N-terminus to C-terminus.

6. The exosome-based protein delivery system according to claim 1, characterized in that The connecting peptide expressed by the nucleotide sequences of the cargo subsystem and the unloading subsystem is a T2T connecting peptide.

7. Use of an exosome-based protein delivery system as claimed in claim 1 in delivering proteins to the cytoplasm of target cells.

8. The use according to claim 7, characterized in that The steps include: S1, construction of lentivirus expressing cargo system; S2, construction of lentivirus expressing the cargo unloading subsystem; S3. Construction of a cell line expressing both the cargo subsystem and the unloading subsystem; S4. Incubate the exosomes with the target cells to deliver the protein or peptide into the target cells.

9. A human umbilical cord mesenchymal stem cell line hUC-MSC CDNF-exo , deposited in Guangdong Provincial Microbiological Culture Collection Center on November 13, 2024, with the deposit number GDMCC NO:65478.

10. The human umbilical cord mesenchymal stem cell strain hUC-MSC according to claim 9 CDNF-exo The application of delivering CDNF to the cytoplasm of target cells is specifically the application in preparing drugs for neuroprotection and repair.

Images