Genetically engineered bacterium for high yield of D-pantothenic acid without addition of inducer, construction method and application

Abstract

The invention relates to an inducer-free high-yield D-pantothenic acid genetically engineered bacterium as well as a construction method and application thereof. According to the invention, key genes ilvE and leuA of a branched chain amino acid metabolic pathway are finely down-regulated, so that the engineering bacteria can relieve the inhibition effect of branched chain amino acid synthesis on D-pantothenic acid synthesis while meeting the growth requirements of the engineering bacteria; the lacI gene is knocked out, so that an inducer IPTG does not need to be added in the production process of the engineering strain, an engineering strain which is not added with the inducer IPTG and is used for high-yield D-pantothenic acid is obtained, components of a fermentation culture medium and a fermentation process are optimized, and finally, the shake-flask titer of the D-pantothenic acid reaches 7.23 g / L; when a 5-L fermentation tank is used for fermentation for 48-60 hours, the yield of D-pantothenic acid can reach 90-105 g / L, the fermentation period is shortened by 35%-48% compared with that of an original strain, an inducer IPTG and other amino acids do not need to be added in the fermentation process, and fermentation steps are reduced.

Description

Technical Field

[0001] The invention relates to a genetic engineering bacterium capable of producing high-yield D-pantothenic acid without adding an inducer and a construction method thereof, and application of the bacterium in preparing D-pantothenic acid by microbial fermentation. Background Art

[0002] Pantothenic acid (PA) is an important member of the vitamin B family, also known as vitamin B5 or pantothenic acid. It is an essential nutrient for mammals, including humans and livestock, and is used in the biosynthesis of coenzyme A (CoA) and acyl carrier protein (ACP) in body cells, and then participates in more than one hundred cellular metabolic reactions. Therefore, as an important vitamin and precursor substance, D-pantothenic acid is widely used in feed, medicine, and cosmetics. Among the known D-pantothenic acid synthesis methods, the production of D-pantothenic acid by biological fermentation has attracted attention due to its advantages such as cheap substrates, easy separation, and low toxicity. However, there are still defects in the production of D-pantothenic acid by biological methods, such as unstable fermentation process and low yield. Therefore, it is still a major challenge to construct a higher-yielding D-pantothenic acid strain.

[0003] The branched-chain amino acid metabolic pathway is the main competitive branch for pantothenic acid synthesis (such as glycine, valine, leucine, etc.). In order to reduce the competitive effect of branched-chain amino acids on pantothenic acid synthesis, it is necessary to downregulate the transcriptional expression of genes involved in branched-chain amino acid synthesis, which can reduce the inhibition of branched-chain amino acids on the main pathway genes to a certain extent. However, excessive downregulation will lead to the non-synthesis or very little synthesis of branched-chain amino acids, making the engineered bacteria unable to synthesize amino acids to meet their own growth needs and become nutritionally deficient strains; insufficient downregulation will inhibit the synthesis of the main D-pantothenic acid pathway. Therefore, in order to obtain a pantothenic acid production strain with superior performance, it is necessary to more finely regulate the branched-chain amino acid synthesis pathway. In addition, further optimization of the culture medium components and fermentation parameters can maximize production efficiency. Summary of the invention

[0004] In order to solve the technical problems of low yield of D-pantothenic acid synthesized by microbial fermentation and complex fermentation regulation in the prior art, the present invention uses CRISPR-Cas9-mediated gene editing technology to finely downregulate the synthesis pathway of branched-chain amino acids in the genome of the bottom plate bacteria and knock out the lacI Gene, a genetically engineered bacterium that can produce high D-pantothenic acid without adding inducer IPTG is obtained, and the components of the culture medium required for it are optimized. The genetically engineered bacterium is applied to the preparation of D-pantothenic acid by microbial fermentation.

[0005] The technical solution adopted by the present invention is: a method for constructing a genetically engineered bacterium that produces high-yield D-pantothenic acid without adding an inducer, comprising: using CRISPR-Cas9-mediated gene editing technology to weaken the genome of the bottom plate bacteria. ilvE Gene, leu Gene expression, knockout lacI Gene, to produce genetically engineered bacteria with high production of D-pantothenic acid.

[0006] Refer to Table 1 and Figure 1 The present invention is based on the bottom plate bacteria E. coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / U :: fOI / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* Based on the system metabolic engineering strategy and CRISPR / Cas9 gene editing technology, the existing engineered bacteria ilvE Gene P ilvE The original promoter was replaced by P acn promoter and changed the codon to TTG to obtain H8 / P acn - ilvE TTG strains; further downregulate the branched-chain amino acid synthesis pathway leu Gene expression in engineered bacteria leu The in situ promoter of the gene was replaced by P M12 The promoter is mutated to TTG, and the start codon ATG is mutated to TTG, so as to achieve the purpose of finely regulating the expression of branched-chain amino acids to relieve feedback inhibition and reduce the amino acid addition required for strain growth. lacI The gene was added to achieve the purpose of not adding the inducer IPTG. Finally, a genetically engineered strain for high production of D-pantothenic acid without the addition of inducer was obtained.

[0007] Table 1. Genes and corresponding pathways involved in gene editing Gene Involved pathways Branched-chain amino acid synthesis Branched-chain amino acid synthesis Regulates expression of the lac operon Preferably, the weakening ilvE Methods of gene expression include: ilvE Genetic PilvEThe in situ promoter was replaced by P acn promoter; and / or ilvE The start codon of the gene mutated to TTG. By replacing the weak promoter and down-regulating the branched-chain amino acid synthesis pathway, its inhibition on the main pathway of D-pantothenic acid synthesis can be relieved. ilvE The expression of the gene can further reduce the synthesis of branched-chain amino acids, but has little effect on the growth of the engineered strain.

[0008] Preferably, the weakening leu Methods of gene expression include: leu Gene P leuA The in situ promoter was replaced by P M12 promoter; and / or leu The start codon of the gene mutated from ATG to TTG. leu Gene P leuA The in situ promoter was replaced by P M12 The promoter reduces the biosynthesis of leucine in the branched-chain amino acids, but the engineered strain can still synthesize the amino acids required for its own growth. leu Changing the gene's start codon ATG to TTG can further downregulate the synthesis of branched-chain amino acids, which is an effective strategy for more precise regulation of the branched-chain amino acid synthesis pathway.

[0009] Preferably, the knockout lacI Genetic methods include: using CRISPR / Cas9 gene editing technology to modify the genome of engineered bacteria lacI By knocking out the gene, the engineered bacteria can produce D-pantothenic acid without adding the inducer IPTG.

[0010] Preferably, the bottom plate bacteria is: E. coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / U f :: fOI / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* , denoted as DPAW1.

[0011] As a preference, P acn Promoter-regulated ilvE TTG The nucleotide sequence of the gene is shown in SEQ ID NO. 1; M12 Promoter-regulated leu TTG The nucleotide sequence of the gene is shown in SEQ ID NO. 2; lacI Promoter-regulated lacI The gene nucleotide sequence is shown in SEQ ID NO. 3.

[0012] More specifically, the method for constructing a genetically engineered bacterium that produces high-yield D-pantothenic acid without adding an inducer comprises the following steps: (1) Using the genetically engineered bacterium ZJUTDPAH8 as the base bacterium and naming it W1, we used CRISPR-Cas9-mediated gene editing technology to modify the gene ilvE P ilvE The in situ promoter was replaced by P acn promoter, and ilvE The codon was changed to TTG to obtain DPAH8ΔP ilvE - ilvE ::P acn - ilvE TTG The strain was recorded as engineered strain DPAW2; (2) Further downregulation of genes for branched-chain amino acid synthesis based on engineered bacteria DPAW2 leu Using CRISPR-Cas9-mediated gene editing technology, P leuA The in situ promoter was replaced by P M12 promoter, and leu The codon of was changed from ATG to GTG, and the engineered strain DPAW2ΔP was obtained. leuA - leu ::P M12 - leu TTG , denoted as engineered bacteria DPAW3; (3) Gene knockout was used to knock out the gene in the genome of engineered bacteria DPAW3. lacI Knockout, obtain engineered bacteria DPAW3 Δ lacI , denoted as engineered bacteria DPAW4, which is the genetically engineered bacteria that produces high D-pantothenic acid without adding inducers.

[0013] The present invention also provides a genetic engineering bacterium with high D-pantothenic acid production obtained by any of the above methods.

[0014] The present invention also provides the use of the genetically engineered bacteria with high D-pantothenic acid production in the preparation of D-pantothenic acid by microbial fermentation. The use comprises: inoculating the genetically engineered bacteria with high D-pantothenic acid production into a fermentation medium, fermenting and culturing for 48 to 60 hours at 28 to 37°C and 300 to 450 rpm, and separating and purifying the fermentation supernatant after the fermentation to obtain the D-pantothenic acid.

[0015] Preferably, the fermentation medium comprises: 10-30 g / L glucose, 10-25 g / L ammonium sulfate, 1-5 g / L anhydrous betaine, 1-5 g / L yeast powder, 1-5 g / L potassium dihydrogen phosphate, 0.5-2 g / L anhydrous magnesium sulfate, 1-5 g / L β-alanine, 1-5 mL / L trace element solution, the solvent is deionized water, and the pH value is natural; the trace element solution is composed of: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 10 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, 0.02 g / L NiCl2·7H2O, and the solvent is deionized water. The carbon source concentration is optimized, that is, when the glucose concentration is 20-30 g / L, the D-pantothenic acid production of the engineered bacteria is the highest. The ammonium sulfate concentration is optimized, that is, when the ammonium sulfate concentration is 10-15 g / L, the D-pantothenic acid production of the engineered bacteria is the highest. The optimization of magnesium sulfate concentration means that when the magnesium sulfate concentration is 0.3-0.5 g / L, the D-pantothenic acid production of the engineered bacteria is the highest. The optimization of potassium dihydrogen phosphate concentration means that when the potassium dihydrogen phosphate concentration is 1.5-2 g / L, the D-pantothenic acid production of the engineered bacteria is the highest. The optimization of organic nitrogen source concentration means that when the β-alanine concentration is 1.5-2 g / L, the D-pantothenic acid production of the engineered bacteria is the highest.

[0016] Specifically, the fermentation culture method is as follows: a 5 L fermentation tank is filled with a volume of 1-3 L fermentation medium, sterilized at 115° C. for 30 min, the genetically engineered bacterial strain is inoculated into the 1-3 L fermentation medium, and fermentation culture is performed at 28-37° C., an initial ventilation volume of 3-6 L / min, and an initial stirring speed of 300-450 rpm, ammonia water is used to adjust the pH, and a final concentration of 5 mg / L VB1 and 2 mg / L VB is added at the same time. 12 During the fermentation process, the dissolved oxygen is maintained at 10% to 30% by using a dissolved oxygen serial speed, ammonia water is used as a neutralizer to maintain the pH at 6.7 to 6.9, and feed medium is added to the tank through pH-linked feeding, the glucose concentration is controlled below 5 g / L, and the culture is carried out at 28 to 37° C. for 48 to 60 hours to obtain a fermentation broth, and the supernatant of the fermentation broth is separated and purified to obtain the D-pantothenic acid.

[0017] Preferably, the feed medium is composed of: 500 g / L glucose, 5-25 g / L ammonium sulfate, 2-8 g / L anhydrous betaine, 1-5 g / L yeast powder, 10-20 g / L potassium dihydrogen phosphate, 5-15 g / L anhydrous magnesium sulfate, 40-100 g / L β-alanine, 1-5 mL / L trace element solution, the solvent is deionized water, and the pH value is natural.

[0018] Compared with the prior art, the benefits of the present invention are mainly reflected in the following aspects: the present invention uses CRISPR / Cas9 gene editing technology to further finely downregulate the expression level of key genes in the branched-chain amino acid synthesis pathway of the engineered bacteria on the basis of the existing engineered bacteria, and then knocks out lacI gene, and obtained a high-yield strain DPAW4 without plasmid and without the need to add inducer IPTG during fermentation. E. coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / U :: fOI / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* / ilvE * / leu * / ∆ lacI ; Finally, through the optimization of the components of the culture medium and the fine regulation of the fermentation parameters, the shake flask titer of the strain of the present invention reached 7.23 g / L, and the yield was increased by about 6% compared with the starting strain DPAH8, and no inducer was needed to be added during the fermentation process. Finally, after fermentation in a 5-L fermenter for 48 to 60 hours, the D-pantothenic acid yield could reach 90 to 105 g / L, and the fermentation cycle was shortened by about 35% to 48% compared with the starting strain, and no exogenous amino acids and inducer IPTG were needed to be added during the fermentation process. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The diagram shows the metabolic pathway of D-pantothenic acid and the modification sites.

[0020] Figure 2 is the OD of DPAW2 in Example 1 of the present invention 600 and changes in D-pantothenic acid titer.

[0021] Figure 3 is the OD of DPAW3 in Example 2 of the present invention 600 and changes in D-pantothenic acid titer.

[0022] Figure 4 is the OD of DPAW4 in Example 3 of the present invention 600 and changes in D-pantothenic acid titer.

[0023] Figure 5 is the OD of DPAW5 in Example 4 of the present invention 600 and changes in D-pantothenic acid titer.

[0024] Figure 6 is the OD of DPAW4 before and after the optimization of the culture medium components in Example 5 of the present invention 600 and changes in D-pantothenic acid titer.

[0025] Figure 7 This is a diagram showing the fermentation results of DPAH8 in a 5 L bioreactor in Example 6 of the present invention.

[0026] Figure 8 This is a diagram showing the fermentation results of DPAW4 in a 5 L bioreactor in Example 6 of the present invention.

[0027] Fig. 9 This is a diagram showing the fermentation results of DPAW5 in a 5 L bioreactor in Example 6 of the present invention. DETAILED DESCRIPTION

[0028] The following describes the embodiments of the present invention through specific embodiments, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the following embodiments and features in the embodiments can be combined with each other without conflict.

[0029] Unless otherwise specified, the methods used in the examples of the present invention are all conventional methods, and the reagents used are all commercially available.

[0030] In the following examples, the final concentration of spectinomycin in the culture medium is 0.05 mg / L, and the final concentration of kanamycin in the culture medium is 0.05 mg / L.

[0031] The parent strain of the present invention E. coliW3110 is from the Coli Genetic Stock Center of Yale University, with a deposit date of August 5, 1975 and a deposit number of CGSC#4474, and has been disclosed in patents US 2009 / 0298135A1 and US2010 / 0248311 A1.

[0032] The HPLC determination method for D-pantothenic acid content is as follows: chromatographic conditions: C18 column (250 × 4.6 mm, particle size 5 μm, Agilent Technologies Co., Santa Clara, CA, USA), detection wavelength: 200 nm, column temperature: 30°C; sample treatment: dilute the sample with ultrapure water to keep the D-pantothenic acid content between 0.05 g / L and 0.40 g / L; mobile phase: acetonitrile / water / phosphoric acid: (50 / 949 / 1); data acquisition time: 25 min.

[0033] The primer sequence information used in Examples 1-3 is shown in Table 2.

[0034] Table 2. Primer sequences Primer name Sequence (5'-3') <![CDATA[pT-P ilvE - ilvE -PAM-F]]> TAATACTAGTGAAAGCAGCGATAATCACGTGTTTTAGAGCTAGAAATAGC <![CDATA[pT-P ilvE - ilvE -PAM-R]]> GCTCTAAAACACGTGATTATCGCTGCTTTCACTAGTATTATACCTAGGAC <![CDATA[P ilvE -up-F]]> ATTCTCTAGAGTCGACCTGCCCACCCTTACTGATAACCCC <![CDATA[P ilvE -up-R]]> TGATAAAAGAGGAGAAACCTTTTTTATATTCCTTTTGCGCTC <![CDATA[P ilvE -down-F]]> CCTGTCATTAAGGAGGAGCTTTGACCACGAAGAAAGCTGA <![CDATA[P ilvE -down-R]]> GGGTAATAGATCTAAGCTTCGAGAGGTAGTTACCACCGGC <![CDATA[P acn - ilvE TTG -F]]> AGCGCAAAAGGAATATAAAAAGGTTTCTCCTCTTTTATCAATTTGG <![CDATA[P acn - ilvE TTG -R]]> CAGCTTTCTTCGTGGTCAAAGCTCCTCCTTAATGACAGGG <![CDATA[pT-PAM-P leuA - leu -F]]> TAATACTAGTCGGTGCAAACCATCGCCCGCGTTTTAGAGCTAGAAATAGC <![CDATA[pT-PAM-P leuA - leu -R]]> GCTCTAAAACGCGGGCGATGGTTTGCACCGACTAGTATTATACCTAGGAC <![CDATA[P leuA -up-F]]> ATTCTCTAGAgtcgacCTGCTCACCAAATCAATATCAAAAAAAATC <![CDATA[P leuA -up-R]]> GCCCCAAGGGGTTATGCTAGGGTTTGGGTCCTTGTCTCTTTTAG <![CDATA[P leuA -down-F]]> TTTAAACCAGGAAACAGCTTTTGAGCCAGCAAGTCATTATTTTC <![CDATA[P leuA -down-R]]> GGGTAATAGATCTAAGCTTCTTGATGGTGGTGGCACCGGC <![CDATA[P M12 -leuA-F]]> AAGAGACAAGGACCCAAACCCTAGCATAACCCCTTGGGGC <![CDATA[P M12 -leuA-R]]> ATAATGACTTGCTGGCTCAAAAGCTGTTTCCTGGTTTAAAC pT-PAM--F TAATACTAGTGAGACATCAAGAAATAACGCGTTTTAGAGCTAGAAATAGC pT-PAM--R GCTCTAAAACGCGTTATTTCTTGATGTCTCACTAGTATTATACCTAGGAC -up-F ATTCTCTAGAGTCGACCTGCCGGGCGACGTTTGCCGCTTC -up-R TCACATTAATTGCGTTGCGCATTCACCACCCTGAATTGAC -down-F GTCAATTCAGGGTGGTGAATGCGCAACGCAATTAATGTG -down-R GGGTAATAGATCTAAGCTTCGAGCGAGTAACAACCCGTCG <![CDATA[P acn -VF]]> GGATGGTTCGACAATGGCAG <![CDATA[P acn -VR]]> CGGAAAGTTTGGTTTTCCCG <![CDATA[P M12 -VF]]> GCATTAATTCTTAACATTAATTGATC <![CDATA[P M12 -VR]]> AACGGCATGGTGTAGCCCAC -VF GAAACCACTCACCGTTTCAG -VR CCTTCCTGTAGCCAGCTTTC Example 1: DPAW2 (DPAH8 derivative, ΔP ilvE - ilvE ATG ::P ilvE - ilvE TTG ) Construction and shake flask fermentation Take ZJUTDPAH8( E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS*) was used as the starting strain, and CRISPR-Cas9-mediated gene editing technology was used to modify the P ilvE Promoter with low transcription ability acn (The nucleotide sequence is shown in SEQ ID No. 1) Replace the starting strain ilvE P on gene ilvE promoter and changed the start codon to TTG to finely downregulate ilvE The expression intensity of the gene reduces the synthesis of branched-chain amino acids.

[0035] (1) Construction of pTarget-PAM-P acn - ilvE Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template and pT-P ilvE - ilvE -PAM-F / R was used as primer for PCR amplification. The PCR product was verified by nucleic acid gel electrophoresis and then used Dpn I digestive enzyme was incubated at 37℃ for 3 h and then converted to E. coli DH5α, after screening on a spectacular enzyme plate, sequencing confirmed the correct pTarget-PAM-P ilvE - ilvE Plasmid, used for subsequent ligation of Donor DNA.

[0036] (2) Construction of pTD-P acn - ilvE TTG Plasmid: First, E. coli W3110 genome was used as a template, P ilvE -up-F / R is the primer to amplify the upstream part of donor DNA (F1), P ilvE -down-F / R was used as primer to amplify the downstream part (F2) of donor DNA. E. coli W3110 genome was used as template and P acn -ilvE-F / R is the primer to amplify the promoter P acn and the start codon TTG (F3), and the PCR fragments were purified by gel recovery to obtain F1, F2, and F3; plasmid pTarget-PAM-P ilvE - ilvE go through Xba I and Pst I was incubated at 37 °C for 8 h, and the DNA fragments were recovered by Clean up kit; ®(One step cloning kit, Vazyme Biotech, Nanjing, China) instructions to replace pTarget-PAM-P ilvE - ilvE The vector, fragments F1, F2, and F3 were connected together and verified by sequencing to obtain pTD-P acn - ilvE TTG Plasmid.

[0037] (3) Introduce pCas plasmid (Addgene Plasmid #62225) into ZJUTDPAH8 ( E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc - PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* ), transfer the monoclonal colony to an LB tube containing 0.05 mg / L kanamycin and culture at 30°C overnight; then inoculate it into a 250 mL shake flask containing 50 mL LB medium at a volume concentration of 1%, add 500 μL 1 mol / L L-arabinose, and culture at 150 rpm and 30°C until OD 600 0.4~0.6; 4000 rpm, 4 ℃ centrifugation for 10 min to collect cells and prepare electroporation competent cells. For detailed procedures, see (Molecular Cloning: A Laboratory Manual, 3ed Edition, 99-102).

[0038] (4) Use a pipette to draw an appropriate amount of pTD-P acn - ilvE TTG (about 200 ng) plasmid was mixed with 100 μL of electroporation competent cells prepared in advance, and transferred into a pre-cooled 2 mm electroporation cup. After ice bathing for about 1-2 min, electroporation was performed using an electroporator (MicroPluser TMAfter electroporation, 800 μL of LB medium was immediately added and gently aspirated, and the cells were transferred to a 2 mL Eppendorf tube. After 3-4 h of recovery at 30°C, the cells were coated with LB solid plates containing 0.05 mg / L kanamycin and 0.05 mg / L spectinomycin, and incubated at 30°C for 12-16 h. acn -VF / R were used as primers for colony PCR verification. If a fragment of about 1100 bp was successfully cloned, it was proved to be DPAW3 (DPAH8 derivative, pTarget-P acn - ilvE TTG ) positive colonies.

[0039] (5) Plasmid elimination: Use an inoculation loop to pick up a positive single colony and inoculate it into a LB liquid test tube containing 1 mM IPTG and 0.05 mg / L kanamycin. Incubate at 30°C overnight. The next day, streak the bacterial liquid onto a LB solid plate containing 0.05 mg / L kanamycin. Incubate at 30°C for 24 h. When the bacteria grow to a certain size, pick some single colonies and streak them onto a LB plate containing 0.05 mg / L spectinomycin. Single colonies that cannot be streaked onto the LB plate containing 0.05 mg / L spectinomycin show that their pTarget-P ilvE - ilvE The plasmid was successfully eliminated, and then pTarget-P acn - ilvE TTG The single colonies with successful plasmid elimination were placed in LB test tubes and cultured overnight at 37°C to eliminate the pCas plasmid. The next day, the bacterial solution was streaked on LB plates. After culturing at 37°C for 12 h, some single colonies were picked and streaked on LB plates containing 0.05 mg / L kanamycin. The single colonies that could not be streaked on the LB plate containing 0.05 mg / L kanamycin had their pCas plasmids successfully eliminated, and finally the plasmid-free strain DPAW2 (DPAH8 derivative, ΔP ilvE - ilvE ::P acn - ilvE TTG ).

[0040] (6) Shake flask fermentation: DPAW2 (DPAH8 derivative, ΔP ilvE - ilvE ::P acn - ilvE TTG), with the starting strain ZJUTDPAH8 as the control group, they were inoculated into 10 mL of LB medium and cultured at 37 °C and 200 rpm as pre-cultures; 8-12 h later, 1 mL of the pre-culture was inoculated into a 500 mL shake flask containing 50 mL of MS medium at a 2% inoculum, and then cultured in a constant temperature shaker at 30 °C and 180 rpm for 48 h for strain fermentation; after the fermentation, 1 mL of the fermentation liquid was taken to measure the OD 600 At the same time, 1 mL of fermentation liquid was drawn with a pipette, and centrifuged at 12000 rpm for 3 min at room temperature. The fermentation supernatant was diluted 5 times, and the diluted sample was treated with a water filter membrane to remove impurities. HPLC detection was performed according to Example 1, and OD 600 The D-pantothenic acid content in the fermentation supernatant is shown in FIG2 .

[0041] Depend on Figure 2 It can be seen that the genome is weakened ilvE After the expression of the gene, the growth of the strain increased to a certain extent, but there was no obvious promotion effect on the increase of D-pantothenic acid titer in the shake flask, which was about 6.61 g / L. This may be because the branched-chain amino acid metabolic pathway is the main competitive branch for pantothenic acid synthesis, which reduces the carbon flow to the pantothenic acid synthesis pathway and only weakens ilvE The gene cannot relieve the inhibition of branched-chain amino acid synthesis on D-pantothenic acid synthesis. Considering the need for subsequent transformation, the strain will continue to be transformed on this basis.

[0042] LB medium: 10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, solvent is deionized water, pH value is natural.

[0043] MS culture medium: glucose 20 g / L, (NH4)2SO4 16 g / L, KH2PO4 2 g / L, MgSO4 0.5 g / L, yeast extract 2 g / L, CaCO3 10 g / L, 1 ml / L trace element solution, the solvent is deionized water, pH value is natural; 10 g / L calcium carbonate (sterilized separately); the composition of the trace element solution is: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 1 g / L ZnSO4·7H2O, 0.20 g / L CuSO4, 0.02 g / L NiCl2·7H2O, the solvent is deionized water.

[0044] Example 2: DPAW3 construction and shake flask fermentation Using DPAW2 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to knock in the weak promoter P M12(The nucleotide sequence is shown in SEQ ID NO. 2) Replace the starting strain leuA P on gene leuA The in situ promoter was used and the start codon ATG was changed to TTG to finely downregulate leu The expression intensity of the gene reduces the synthesis of branched-chain amino acids.

[0045] (1) Construction of pTarget-PAM-P leuA - leu Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template and pT-PAM-P leuA - leu -F / R were used as primers for PCR amplification. After the PCR product was verified by nucleic acid gel electrophoresis, it was used Dpn I digestive enzymes were digested at 37℃ for 3 h and then converted to E. coli DH5α, after screening on a spectacular enzyme plate, sequencing confirmed the correct pTarget-PAM-P leuA - leu Plasmid, used for subsequent ligation of Donor DNA.

[0046] (2) Construction of pTD-P M12 - leu TTG Plasmid: First, E. coli W3110 genome was used as a template, P leuA -up-F / R is the primer to amplify the upstream part of donor DNA (F1), P leuA -down-F / R was used as primer to amplify the downstream part (F2) of donor DNA. E. coli W3110 genome was used as template and P M12 -leuA-F / R is the primer to amplify the promoter P M12 and genes leu The start codon TTG (F3) of the target gene was purified by gel recovery to obtain F1, F2 and F3; the plasmid pTarget-PAM-P M12 - leu go through XB I and Pst I was incubated at 37 °C for 8 h, and the DNA fragments were recovered by Clean up kit; ® (One step cloning kit, Vazyme Biotech, Nanjing, China) instructions to replace pTarget-PAM-P M12 - leuThe vector, fragments F1, F2, and F3 were connected together and verified by sequencing to obtain pTD-P M12 - leu TTG Plasmid.

[0047] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the DPAW2 competent cell obtained in Example 1. The preparation method of the DPAW2 competent cell by electroporation was the same as that in Example 1 (3).

[0048] (4) DPAW3 positive colonies were constructed using the same method as in Example 1 (4).

[0049] (5) Plasmid elimination: The implementation method is the same as Example 1 (5) to obtain plasmid-free DPAW3.

[0050] (6) The constructed DPAW3 production strain was used as a control group with the DPAW2 constructed in Example 1, and the shake flask test and detection were carried out according to the method of Example 1 (6). 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 3 shown.

[0051] Depend on Figure 3 It can be seen that the gene knock-in method can be used to finely downregulate genes in the genome leu After the expression of , there was no effect on bacterial growth, but the D-pantothenic acid shake flask titer increased to 6.90 g / L, which was about 4% higher than that of the strain in Example 2. It may be that downregulating this gene diverted part of the carbon flux to branched-chain amino acids to the synthesis of pantothenic acid, thereby promoting the biosynthesis of D-pantothenic acid in the strain.

[0052] Example 3: DPAW4 construction and shake flask fermentation Using DPAW3 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to knock out the genes in the genome of the starting strain. lacI The gene (nucleotide sequence is shown in SEQ ID NO. 3) was knocked out to achieve the purpose of not adding the inducer IPTG.

[0053] (1) Construction of pTarget-PAM- lacI Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template and pT-PAM- lacI -F / R were used as primers for PCR amplification. After the PCR product was verified by nucleic acid gel electrophoresis, it was used Dpn I digestive enzyme was incubated at 37℃ for 3 h and then converted to E. coli DH5α, after screening on a spectacular enzyme plate, sequencing confirmed the correct pTarget-PAM- lacI Plasmid, used for subsequent ligation of Donor DNA.

[0054] (2) Construction of pTD- lacI Plasmid: First, E. coli The W3110 genome was used as a template. lacI -up-F / R is the primer used to amplify the upstream part of donor DNA (F1). lacI -down-F / R is the primer to amplify the downstream part (F2) of donor DNA. F1 and F2 are obtained by gel recovery and purification of PCR fragments; plasmid pTarget-PAM- lacI go through XB I and Pst I was incubated at 37°C for 8 h, and the DNA fragments were recovered using the Clean up kit; ® (One step cloning kit, Vazyme Biotech, Nanjing, China) instructions to pTarget-PAM- lacI The vector, fragments F1 and F2 were connected together and verified by sequencing to obtain pTD- lacI Plasmid.

[0055] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the DPAW3 competent cell obtained in Example 2. The preparation method of the DPAW3 competent cell by electroporation was the same as that in Example 1 (3).

[0056] (4) DPAW4 positive colonies were constructed using the same method as in Example 1 (4).

[0057] (5) Plasmid elimination: The implementation method is the same as Example 1 (5) to obtain plasmid-free DPAW4.

[0058] (6) The constructed DPAW4 production strain was used as a control group with the DPAW3 constructed in Example 3, and the shake flask test and detection were carried out according to the method of Example 1 (6). 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 4 shown.

[0059] Depend on Figure 4 It can be seen that the genome is transformed by gene knockout lacI After gene knockout, there was no significant effect on strain growth, and the D-pantothenic acid shake flask titer was slightly increased to 7.06 g / L.

[0060] Example 4: DPAW5 construction and shake flask fermentation Using DPAH8 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to knock out the genes in the genome of the starting strain. lacI The gene (nucleotide sequence is shown in SEQ ID NO. 3) was knocked out to achieve the purpose of not adding the inducer IPTG.

[0061] (1) Construction of pTarget-PAM- lacI Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template and pT-PAM- lacI -F / R were used as primers for PCR amplification. After the PCR product was verified by nucleic acid gel electrophoresis, it was used Dpn I digestive enzyme was incubated at 37℃ for 3 h and then converted to E. coli DH5α, after screening on a spectacular enzyme plate, sequencing confirmed the correct pTarget-PAM- lacI Plasmid, used for subsequent ligation of Donor DNA.

[0062] (2) Construction of pTD- lacI Plasmid: First, E. coli The W3110 genome was used as a template. lacI -up-F / R is the primer used to amplify the upstream part of donor DNA (F1). lacI -down-F / R is the primer to amplify the downstream part (F2) of donor DNA. F1 and F2 are obtained by gel recovery and purification of PCR fragments; plasmid pTarget-PAM- lacI go through XB I and Pst I was incubated at 37°C for 8 h, and the DNA fragments were recovered using the Clean up kit; ® (One step cloning kit, Vazyme Biotech, Nanjing, China) instructions to pTarget-PAM- lacI The vector, fragments F1 and F2 were connected together and verified by sequencing to obtain pTD- lacI Plasmid.

[0063] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the DPAW3 competent cell obtained in Example 2. The preparation method of the DPAW3 competent cell by electroporation was the same as that in Example 1 (3).

[0064] (4) DPAW4 positive colonies were constructed using the same method as in Example 1 (4).

[0065] (5) Plasmid elimination: The implementation method is the same as Example 1 (5) to obtain plasmid-free DPAW5.

[0066] (6) The constructed DPAW5 production strain was used as a control group with the DPAW4 constructed in Example 3, and the shake flask test and detection were carried out according to the method of Example 1 (6). 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 5 shown.

[0067] Depend on Figure 5 It can be seen that the DPAH8 genome was knocked out by gene knockout. lacI After gene knockout, its growth and yield were lower than those of the control strain DPAW4, with a yield of about 6.86 g / L.

[0068] Example 5: Optimization of shake flask fermentation medium components This embodiment provides an optimized fermentation medium for Escherichia coli, wherein the optimization includes carbon source concentration optimization, ammonium sulfate concentration optimization, magnesium sulfate concentration optimization, potassium dihydrogen phosphate concentration optimization, and organic nitrogen source concentration optimization.

[0069] The carbon source concentration is optimized, that is, when the glucose concentration is 20-30 g / L, the D-pantothenic acid production of the engineered bacteria is the highest. The ammonium sulfate concentration is optimized, that is, when the ammonium sulfate concentration is 10-15 g / L, the D-pantothenic acid production of the engineered bacteria is the highest. The magnesium sulfate concentration is optimized, that is, when the magnesium sulfate concentration is 0.3-0.5 g / L, the D-pantothenic acid production of the engineered bacteria is the highest. The potassium dihydrogen phosphate concentration is optimized, that is, when the potassium dihydrogen phosphate concentration is 1.5-2 g / L, the D-pantothenic acid production of the engineered bacteria is the highest. The organic nitrogen source concentration is optimized, that is, when the organic nitrogen source concentration is 1.5-2g / L, the D-pantothenic acid production of the engineered bacteria is the highest.

[0070] The fermentation medium before optimization included: 10~30g / L glucose, 10~25g / L ammonium sulfate, 1~5g / L anhydrous betaine, 1~5g / L yeast powder, 1~5g / L potassium dihydrogen phosphate, 0.5~2g / L anhydrous magnesium sulfate, 1~5g / L β-alanine, 1~5ml / L trace element solution, the solvent was deionized water, and the pH value was natural; the trace element solution composition was: 10g / L CuCl2, 10g / L FeSO4·7H2O, 10g / L ZnSO4·7H2O, 0.2g / L CuSO4, 0.02g / L NiCl2·7H2O, and the solvent was deionized water.

[0071] The optimized fermentation medium includes: glucose 20 g / L, ammonium sulfate 16 g / L, anhydrous betaine 2 g / L, yeast powder 2 g / L, potassium dihydrogen phosphate 2 g / L, anhydrous magnesium sulfate 0.5 g / L, β-alanine 1.5 g / L, 1 mL / L trace element solution, the solvent is deionized water, and the pH value is natural. The trace element solution consists of: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 10g / L ZnSO4·7H2O, 0.2 g / L CuSO4, 0.02 g / L NiCl2·7H2O, and the solvent is deionized water.

[0072] The engineered bacteria DPAW4 was used as the experimental strain, and the fermentation medium before optimization and the medium after optimization were used for shake flask test and detection. 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 5 shown.

[0073] Depend on Figure 6 It can be seen that after the fermentation medium components were optimized, the strain grew better and the D-pantothenic acid shake flask titer was slightly increased to 7.23 g / L.

[0074] Example 5: D-pantothenic acid producing strains DPAH8, DPAW4, DPAW5 5 L bioreactor fermentation Fermentation was carried out in a 5L fermenter (Shanghai Baoxing, BIOTECH-5BG) and included the following steps: (1) Seed culture: Inoculate the plate into 10 mL LB medium and culture overnight on a shaker at 37°C and 180 rpm. Then inoculate two bottles containing 100 mL LB medium at a volume concentration of 1% as the secondary seed solution and culture for 7 to 12 h.

[0075] (2) Inoculation and fermentation: The volume of the fermentation medium in a 5 L fermenter is 2 L, sterilized at 115°C for 30 min. The temperature is 25-30°C, the initial aeration volume is 3-6 L / min, the initial stirring speed is 300-450 rpm, and the pH is adjusted with ammonia water. A total of 200 mL of two bottles of secondary seed liquid are transferred to a 5 L fermenter containing 2 L of non-resistant fermentation medium, and a final concentration of 5 mg / L VB1 and 2 mg / LVB is added. 12 , and fermentation began. During the fermentation process, the dissolved oxygen was maintained at 10%~30% using a series speed of dissolved oxygen, and the pH was maintained at 6.7~6.9 using ammonia water as a neutralizer. The glucose concentration in the tank was controlled below 5 g / L through pH linkage feeding, and the culture was carried out at 28~37℃ for 60~92 hours to obtain the fermentation liquid. The fermentation liquid is all the substances in the fermentation tank.

[0076] (3) After the fermentation supernatant was diluted 40 times, the diluted sample was treated with a water filter membrane to remove impurities and then tested by HPLC. 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 7 , 8 , as shown in Figure 9.

[0077] As can be seen from the figure, down-regulating the branched-chain amino acid synthesis pathway and knocking out lacI After optimizing the gene and the medium components, the D-pantothenic acid production strain DPAW4 increased the D-pantothenic acid production to 90-105 g / L in a 5 L fermenter after 48-60 hours of fermentation. Compared with the starting strain DPAH8, the engineered strain DPAW4 grew rapidly in the early stage of fermentation, and the fermentation cycle was shortened by about 35%-48%. Compared with the strain DPAW5, it had obvious growth and production advantages, a shortened fermentation cycle, and an increase of about 47% in production at 60 h. In addition, the fermentation process did not require the addition of exogenous amino acids and inducer IPTG, which reduced the fermentation process steps, which was conducive to reducing costs and environmental pollution.

[0078] The fermentation medium is composed of 20 g / L glucose, 16 g / L ammonium sulfate, 2 g / L anhydrous betaine, 2 g / L yeast powder, 2 g / L potassium dihydrogen phosphate, 0.5 g / L anhydrous magnesium sulfate, 1.5 g / L β-alanine, 1 mL / L trace element solution, the solvent is deionized water, and the pH value is natural. The trace element solution is composed of 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 10 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, 0.02 g / L NiCl2·7H2O, and the solvent is deionized water.

[0079] The feed medium is composed of 500 g / L glucose, 10 g / L ammonium sulfate, 4 g / L anhydrous betaine, 2 g / L yeast powder, 14 g / L potassium dihydrogen phosphate, 8 g / L anhydrous magnesium sulfate, 60 g / L β-alanine, 2 mL / L trace element solution, the solvent is deionized water, and the pH value is natural.

[0080] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. A method for constructing a genetically engineered bacterium that produces high-yield D-pantothenic acid without the addition of an inducer, characterized in that: include: Using CRISPR-Cas9-mediated gene editing technology, we weakened ilvE Gene, leu Gene expression, knockout lacI Gene, to produce genetically engineered bacteria with high production of D-pantothenic acid.

2. The method according to claim 1, characterized in that The weakening ilvE Methods of gene expression include: Will ilvE Gene P ilvE The in situ promoter was replaced by P acn promoter; and / or Will ilvE The start codon of the gene was mutated to TTG.

3. The method according to claim 1, characterized in that The weakening leu Methods of gene expression include: Will leu Gene P leuA The in situ promoter was replaced by P M12 promoter; and / or Will leu The start codon of the gene mutated from ATG to TTG.

4. The method according to claim 1, characterized in that The bottom plate bacteria are: E. coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / U f :: fOI / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* .

5. A genetically engineered bacterium with high production of D-pantothenic acid obtained by the method described in any one of claims 1 to 4.

6. The genetically engineered bacterium for high production of D-pantothenic acid as claimed in claim 5, characterized in that: The genetically engineered bacteria that produces high levels of D-pantothenic acid are: E. coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / U f :: fOI / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* / ilvE * / leu * / ∆ lacI .

7. Use of the genetically engineered bacteria with high D-pantothenic acid production as claimed in claim 6 in the preparation of D-pantothenic acid by microbial fermentation, characterized in that: The application comprises: inoculating the genetically engineered bacteria with high D-pantothenic acid production into a fermentation medium, carrying out fermentation culture at 28-37°C and 300-450 rpm for 48-60 hours, and after the fermentation is completed, separating and purifying the fermentation supernatant to obtain the D-pantothenic acid.

8. The use according to claim 7, characterized in that The fermentation medium comprises: 10-30 g / L glucose, 10-25 g / L ammonium sulfate, 1-5 g / L anhydrous betaine, 1-5 g / L yeast powder, 1-5 g / L potassium dihydrogen phosphate, 0.5-2 g / L anhydrous magnesium sulfate, 1-5 g / L beta-alanine, 1-5 mL / L trace element solution, the solvent is deionized water, and the pH value is natural; the trace element solution is composed of: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 10 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, 0.02 g / L NiCl2·7H2O, and the solvent is deionized water.

9. The use according to claim 8, characterized in that The application comprises: loading a 5 L fermentation tank with a volume of 1-3 L fermentation medium, sterilizing at 115° C. for 30 min, inoculating the genetically engineered bacterial strain into the 1-3 L fermentation medium, and performing fermentation culture at 28-37° C., an initial ventilation volume of 3-6 L / min, and an initial stirring speed of 300-450 rpm, adjusting the pH with ammonia water, and adding VB1 with a final concentration of 5 mg / L, VB2 with a final concentration of 2 mg / L, and VB3 with a final concentration of 1.5 mg / L. 12 During the fermentation process, the dissolved oxygen is maintained at 10-30% by using a dissolved oxygen series speed, ammonia water is used as a neutralizer to maintain the pH at 6.7-6.9, and the feed medium is added to the tank through pH-linked feeding. The glucose concentration is controlled below 5 g / L, and the culture is carried out at 28-37°C for 48-60 hours to obtain a fermentation broth. The supernatant of the fermentation broth is separated and purified to obtain the D-pantothenic acid.

10. The use according to claim 9, characterized in that The feed culture medium comprises: 500 g / L glucose, 5-25 g / L ammonium sulfate, 2-8 g / L anhydrous betaine, 1-5 g / L yeast powder, 10-20 g / L potassium dihydrogen phosphate, 5-15 g / L anhydrous magnesium sulfate, 40-100 g / L beta-alanine, 1-5 ml / L trace element solution, the solvent is deionized water, and the pH value is natural.

Images