A genetically engineered bacterium with high-yield D-pantothenic acid without inducer addition, construction method and application

Abstract

The present invention relates to a genetically engineered bacterium for high-yield D-pantothenic acid without inducer addition, a construction method and an application. The present invention mainly finely down-regulates the key genes in the branched-chain amino acid metabolic pathway ilvE , leuA , so that while the engineered bacterium meets its own growth requirements, the inhibition of D-pantothenic acid synthesis by branched-chain amino acid synthesis is relieved; knocking out lacI gene enables the engineered bacterium not to require the addition of inducer IPTG during the production process, obtaining an engineered strain for high-yield D-pantothenic acid without the addition of inducer IPTG, and optimizing the components of the fermentation medium and the fermentation process. Finally, the shaking flask titer of D-pantothenic acid reaches 7.23 g / L; fermenting in a 5-L fermenter for 48 to 60 hours, the yield of D-pantothenic acid can reach 90 to 105 g / L, and the fermentation cycle is shortened by 35% to 48% compared with the starting strain. No inducer IPTG and other amino acids need to be added during the fermentation process, reducing the fermentation steps.

Description

Technical Field

[0001] The present invention relates to a genetically engineered bacterium with high yield of D-pantothenic acid without addition of inducer and a construction method thereof, and its application in the preparation of D-pantothenic acid by microbial fermentation. Background Art

[0002] Pantothenic acid (PA), an important member of the vitamin B family, is also known as vitamin B5 or pantothenic acid. It is an essential nutrient for mammals including humans and livestock, and is used in the biosynthesis of coenzyme A (CoA) and acyl carrier protein (ACP) in body cells, and then participates in more than a hundred cellular metabolic reactions. Therefore, as an important vitamin and precursor substance, D-pantothenic acid is widely used in feed, medicine, cosmetics and other aspects. Among the known methods for synthesizing D-pantothenic acid, the production of D-pantothenic acid by biological fermentation has attracted attention due to advantages such as cheap substrates, easy separation, and low toxicity. However, there are still defects in the current production of D-pantothenic acid by biological methods, such as unstable fermentation process, low yield and other problems. Therefore, constructing a higher-yield D-pantothenic acid strain is still a great challenge.

[0003] The branched-chain amino acid metabolic pathway is the main competitive branch for pantoic acid synthesis (such as glycine, valine, leucine, etc.). In order to reduce the competitive effect of branched-chain amino acids on pantoic acid synthesis, it is necessary to down-regulate the transcriptional expression of genes involved in branched-chain amino acid synthesis, which can reduce the inhibition of the main pathway genes by branched-chain amino acids to a certain extent. However, excessive down-regulation will lead to no synthesis or very little synthesis of branched-chain amino acids, making the engineered bacterium unable to synthesize amino acids required for its own growth and becoming a nutritional auxotrophic strain; insufficient down-regulation will inhibit the synthesis of the main pathway of D-pantothenic acid. Therefore, to obtain a pantoic acid-producing strain with excellent performance, it is necessary to more precisely regulate the branched-chain amino acid synthesis pathway. In addition, further optimization of the culture medium components and fermentation parameters can maximize the production efficiency. Summary of the Invention

[0004] In order to solve the technical problems of low yield and complex fermentation regulation in the synthesis of D-pantothenic acid by microbial fermentation in the prior art, the present invention uses CRISPR-Cas9-mediated gene editing technology to finely down-regulate the branched-chain amino acid synthesis pathway in the chassis bacterium genome, and knockout the lacI gene in the genome to obtain a genetically engineered bacterium with high yield of D-pantothenic acid without addition of inducer IPTG, and optimize the components of the culture medium required therefor, and apply the genetically engineered bacterium to the preparation of D-pantothenic acid by microbial fermentation.

[0005] The technical solution adopted by the present invention is: a construction method of a genetically engineered bacterium with high yield of D-pantothenic acid without addition of inducer, including: using CRISPR-Cas9-mediated gene editing technology to weaken in the chassis bacterium genomeilvE Genes leuA gene expression, knockout lacI gene to obtain a genetically engineered bacterium with high yield of D-pantothenic acid.

[0006] Referring to Table 1 and Figure 1 , in the chassis bacterium of the present invention E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* (which has been disclosed in CN 118910112 A), comprehensively applying systematic metabolic engineering strategies, using CRISPR / Cas9 gene editing technology, by replacing the P ilvE original promoter of the gene in the existing engineered bacterium with P ilvE promoter and changing the codon to TTG, H8 / P acn - acn - ilvE TTG strain is obtained; further down-regulating the expression of the leuA gene in the branched-chain amino acid synthesis pathway, replacing the in-situ promoter of the leuA gene in the engineered bacterium with P M12 promoter and mutating the start codon ATG to TTG to achieve the purpose of precisely regulating the expression of branched-chain amino acids to relieve feedback inhibition and reduce the addition of amino acids required for strain growth. On this basis, the present invention also knocks out the lacI gene in the genome to achieve the purpose of not requiring the addition of inducer IPTG. Finally, a genetically engineered strain for high-yield D-pantothenic acid without the addition of inducer is obtained.

[0007] Table 1. Genes and corresponding pathways involved in gene editing

[0008] gene involved pathway branched-chain amino acid synthesis branched-chain amino acid synthesis regulates the expression of the lactose operon

[0009] Preferably, the method for weakening the ilvE gene expression includes:ilvE of the gene PilvE the in-situ promoter is replaced with P acn promoter; and / or ilvE the start codon of the gene is mutated to TTG. By replacing the weak promoter to down-regulate the branched-chain amino acid synthesis pathway, its inhibition on the main D-pantothenic acid synthesis pathway can be relieved. By weakening ilvE the expression of the gene can further reduce the synthesis of branched-chain amino acids, but has little impact on the growth of the engineered strain.

[0010] Preferably, the method for weakening leuA the gene expression includes: replacing leuA the P leuA in-situ promoter of the gene with P M12 promoter; and / or leuA changing the start codon of the gene from ATG to TTG. Replacing leuA the P leuA in-situ promoter of the gene with P M12 promoter reduces the biosynthesis of leucine in branched-chain amino acids, but the engineered strain can still synthesize the amino acids required for its own growth. Changing leuA the start codon ATG of the gene to TTG can further down-regulate the synthesis of branched-chain amino acids and is an effective strategy for more precise regulation of the branched-chain amino acid synthesis pathway.

[0011] Preferably, the method for knocking out lacI the gene includes: using the CRISPR / Cas9 gene editing technology to knock out the lacI gene on the genome of the engineered bacterium, so that the engineered bacterium can produce D-pantothenic acid without adding the inducer IPTG.

[0012] Preferably, the chassis bacterium is: E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS*, denoted as DPAW1.

[0013] Preferably, the acn gene nucleotide sequence regulated by the promoter ilvE TTG is as shown in SEQ ID NO. 1; the M12 gene nucleotide sequence regulated by the promoter leuA TTG is as shown in SEQ ID NO. 2; the lacI gene nucleotide sequence regulated by the promoter lacI is as shown in SEQ ID NO. 3.

[0014] More specifically, the method for constructing the genetically engineered bacterium with high-yield D-pantothenic acid without adding inducer includes the following steps:

[0015] (1) Using the genetically engineered bacterium ZJUTDPAH8 as the chassis bacterium and naming it W1, applying the CRISPR-Cas9-mediated gene editing technology, replacing the ilvE P ilvE in-situ promoter with the acn promoter, and changing the codon of the ilvE gene to TTG, obtaining the DPAH8ΔP ilvE - ilvE ::P acn - ilvE TTG strain, denoted as the engineered bacterium DPAW2;

[0016] (2) Further down-regulating the gene leuA for branched-chain amino acid synthesis on the basis of the engineered bacterium DPAW2, applying the CRISPR-Cas9-mediated gene editing technology, replacing the leuA P M12 in-situ promoter with the leuA promoter, and changing the codon of the leuA - leuA gene from ATG to GTG, obtaining the engineered bacterium DPAW2ΔP M12 - leuA TTG , denoted as the engineered bacterium DPAW3;

[0017] (3) Knocking out the lacI gene on the genome of the engineered bacterium DPAW3 by gene knockout method, obtaining the engineered bacterium DPAW3 Δ lacI , denoted as the engineered bacterium DPAW4, which is the genetically engineered bacterium with high-yield D-pantothenic acid without adding inducer.

[0018] The present invention also provides a genetically engineered bacterium with high D-pantothenic acid production constructed by any of the above methods.

[0019] The present invention also provides the application of the genetically engineered bacterium with high D-pantothenic acid production in the preparation of D-pantothenic acid by microbial fermentation. The application includes: inoculating the genetically engineered bacterium with high D-pantothenic acid production into a fermentation medium, and performing fermentation culture at 28-37 °C and 300-450 rpm for 48-60 h. After the fermentation is completed, the supernatant of the fermentation broth is taken and separated and purified to obtain the D-pantothenic acid.

[0020] Preferably, the fermentation medium includes: 10-30 g / L of glucose, 10-25 g / L of ammonium sulfate, 1-5 g / L of anhydrous betaine, 1-5 g / L of yeast powder, 1-5 g / L of potassium dihydrogen phosphate, 0.5-2 g / L of anhydrous magnesium sulfate, 1-5 g / L of β-alanine, 1-5 mL / L of trace element solution, with deionized water as the solvent and the pH value being natural; the composition of the trace element solution is: 10 g / L of CuCl2, 10 g / L of FeSO4·7H2O, 10 g / L of ZnSO4·7H2O, 0.2 g / L of CuSO4, 0.02 g / L of NiCl2·7H2O, with deionized water as the solvent. The optimization of the carbon source concentration means that the D-pantothenic acid production of the genetically engineered bacterium is the highest when the glucose concentration is 20-30 g / L. The optimization of the ammonium sulfate concentration means that the D-pantothenic acid production of the genetically engineered bacterium is the highest when the ammonium sulfate concentration is 10-15 g / L. The optimization of the magnesium sulfate concentration means that the D-pantothenic acid production of the genetically engineered bacterium is the highest when the magnesium sulfate concentration is 0.3-0.5 g / L. The optimization of the potassium dihydrogen phosphate concentration means that the D-pantothenic acid production of the genetically engineered bacterium is the highest when the potassium dihydrogen phosphate concentration is 1.5-2 g / L. The optimization of the organic nitrogen source concentration means that the D-pantothenic acid production of the genetically engineered bacterium is the highest when the β-alanine concentration is 1.5-2 g / L.

[0021] Specifically, the method of fermentation culture is: loading 1-3 L of fermentation medium into a 5 L fermenter, sterilizing at 115 °C for 30 min, inoculating the genetically engineered bacterium strain into 1-3 L of fermentation medium, and performing fermentation culture at 28-37 °C, with an initial aeration rate of 3-6 L / min and an initial stirring speed of 300-450 rpm. The pH is adjusted with ammonia water, and at the same time, VB1 with a final concentration of 5 mg / L and VB 12 ; during the fermentation process, the dissolved oxygen is maintained at 10%-30% by using dissolved oxygen in series with the rotation speed, ammonia water is used as a neutralizing agent to maintain the pH at 6.7-6.9, the feeding medium is added into the tank through pH-linked feeding, the glucose concentration is controlled below 5 g / L, and it is cultured at 28-37 °C for 48-60 h to obtain the fermentation broth. The supernatant of the fermentation broth is taken and separated and purified to obtain the D-pantothenic acid.

[0022] Preferably, the feeding medium is composed of: 500 g / L of glucose, 5 - 25 g / L of ammonium sulfate, 2 - 8 g / L of anhydrous betaine, 1 - 5 g / L of yeast powder, 10 - 20 g / L of potassium dihydrogen phosphate, 5 - 15 g / L of anhydrous magnesium sulfate, 40 - 100 g / L of β-alanine, 1 - 5 mL / L of trace element solution, with deionized water as the solvent and the pH value being natural.

[0023] Compared with the prior art, the advantages of the present invention are mainly reflected in: the present invention uses the CRISPR / Cas9 gene editing technology to further finely down-regulate the expression level of key genes in the branched-chain amino acid synthesis pathway of the engineering bacteria on the basis of the existing engineering bacteria, and then by knocking out lacI the gene, a high-yield strain DPAW4 without plasmid and without the need to add inducer IPTG during the fermentation process is obtained, that is E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* / ilvE * / leuA * / ∆ lacI ; finally, through the optimization of the medium components and the fine regulation of the fermentation parameters, the flask titer of the strain of the present invention reaches 7.23 g / L, and the yield is increased by about 6% compared with the starting strain DPAH8, and no inducer needs to be added during the fermentation process. Finally, using a 5-L fermenter for fermentation for 48 - 60 hours, the D-pantothenic acid yield can reach 90 - 105 g / L, the fermentation cycle is shortened by about 35% - 48% compared with the starting strain, and no exogenous amino acids and inducer IPTG need to be added during the fermentation process. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 It is the D-pantothenic acid metabolic pathway diagram and the modification sites.

[0025] Figure 2 It is the OD 600 and the change of D-pantothenic acid titer of DPAW2 in Example 1 of the present invention.

[0026] Figure 3 For the OD of DPAW3 in Example 2 of the present invention 600 and the change in D-pantothenic acid titer.

[0027] Figure 4 For the OD of DPAW4 in Example 3 of the present invention 600 and the change in D-pantothenic acid titer.

[0028] Figure 5 For the OD of DPAW5 in Example 4 of the present invention 600 and the change in D-pantothenic acid titer.

[0029] Figure 6 For the OD of DPAW4 before and after optimization of the culture medium components in Example 5 of the present invention 600 and the change in D-pantothenic acid titer.

[0030] Figure 7 For the fermentation result diagram of DPAH8 in a 5 L bioreactor in Example 6 of the present invention.

[0031] Figure 8 For the fermentation result diagram of DPAW4 in a 5 L bioreactor in Example 6 of the present invention.

[0032] Figure 9 For the fermentation result diagram of DPAW5 in a 5 L bioreactor in Example 6 of the present invention. Detailed implementation manners

[0033] The following specific embodiments illustrate the implementation manners of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific implementation manners. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, without conflict, the following embodiments and the features in the embodiments can be combined with each other.

[0034] In the embodiments of the present invention, unless otherwise specified, the methods used are all conventional methods, and the reagents used can all be obtained from commercial channels.

[0035] In the following embodiments, the final concentration of spectinomycin in the culture medium is 0.05 mg / L, and the final concentration of kanamycin in the culture medium is 0.05 mg / L.

[0036] The parental strain of the present invention E. coliW3110 is from the Coli Genetic Stock Center of Yale University. The preservation date is August 5, 1975, and the preservation number is CGSC#4474. It has been disclosed in Patents US 2009 / 0298135A1 and US2010 / 0248311 A1.

[0037] The HPLC determination method for D-pantothenic acid content is as follows: Chromatographic conditions: C18 column (250 × 4.6 mm, particle size 5 μm, Agilent Technologies Co., Santa Clara, CA, USA), detection wavelength: 200 nm, column temperature: 30 °C; sample treatment: dilute the sample with ultrapure water to keep the D-pantothenic acid content between 0.05 g / L and 0.40 g / L; mobile phase: acetonitrile / water / phosphoric acid: (50 / 949 / 1); data acquisition time: 25 min.

[0038] The primer sequence information used in Examples 1-3 is shown in Table 2.

[0039] Table 2. Primer Sequences

[0040] Primer name Sequence (5’-3’) <![CDATA[pT-P ilvE - ilvE -PAM-F]]> TAATACTAGTGAAAGCAGCGATAATCACGTGTTTTAGAGCTAGAAATAGC <![CDATA[pT-P ilvE - ilvE -PAM-R]]> GCTCTAAAACACGTGATTATCGCTGCTTTCACTAGTATTATACCTAGGAC <![CDATA[P ilvE -up-F]]> ATTCTCTAGAGTCGACCTGCCCACCCTTACTGATAACCCC <![CDATA[P ilvE -up-R]]> TGATAAAAGAGGAGAAACCTTTTTATATTCCTTTTGCGCTC <![CDATA[P ilvE -down-F]]> CCTGTCATTAAGGAGGAGCTTTGACCACGAAGAAAGCTGA <![CDATA[P ilvE -down-R]]> GGGTAATAGATCTAAGCTTCGAGAGGTAGTTACCACCGGC <![CDATA[P acn - ilvE TTG -F]]> AGCGCAAAAGGAATATAAAAAGGTTTCTCCTCTTTTATCAATTTGG <![CDATA[P acn - ilvE TTG -R]]> CAGCTTTCTTCGTGGTCAAAGCTCCTCCTTAATGACAGGG <![CDATA[pT-PAM-P leuA - leuA -F]]> TAATACTAGTCGGTGCAAACCATCGCCCGCGTTTTAGAGCTAGAAATAGC <![CDATA[pT-PAM-P leuA - leuA -R]]> GCTCTAAAACGCGGGCGATGGTTTGCACCGACTAGTATTATACCTAGGAC <![CDATA[P leuA -up-F]]> ATTCTCTAGAgtcgacCTGCTCACCAAATCAATATCAAAAAAAATC <![CDATA[P leuA -up-R]]> GCCCCAAGGGGTTATGCTAGGGTTTGGGTCCTTGTCTCTTTTAG <![CDATA[P leuA -down-F]]> TTTAAACCAGGAAACAGCTTTTGAGCCAGCAAGTCATTATTTTC <![CDATA[P leuA -down-R]]> GGGTAATAGATCTAAGCTTCTTGATGGTGGTGGCACCGGC <![CDATA[P M12 -leuA-F]]> AAGAGACAAGGACCCAAACCCTAGCATAACCCCTTGGGGC <![CDATA[P M12 -leuA-R]]> ATAATGACTTGCTGGCTCAAAAGCTGTTTCCTGGTTTAAAC pT-PAM--F TAATACTAGTGAGACATCAAGAAATAACGCGTTTTAGAGCTAGAAATAGC pT-PAM--R GCTCTAAAACGCGTTATTTCTTGATGTCTCACTAGTATTATACCTAGGAC -up-F ATTCTCTAGAGTCGACCTGCCGGGCGACGTTTGCCGCTTC -up-R TCACATTAATTGCGTTGCGCATTCACCACCCTGAATTGAC -down-F GTCAATTCAGGGTGGTGAATGCGCAACGCAATTAATGTG -down-R GGGTAATAGATCTAAGCTTCGAGCGAGTAACAACCCGTCG <![CDATA[P acn -VF]]> GGATGGTTCGACAATGGCAG <![CDATA[P acn -VR]]> CGGAAAGTTTGGTTTTCCCG <![CDATA[P M12 -VF]]> GCATTAATTCTTAACATTAATTGATC <![CDATA[P M12 -VR]]> AACGGCATGGTGTAGCCCAC -VF GAAACCACTCACCGTTTCAG -VR CCTTCCTGTAGCCAGCTTTC

[0041] Example 1: Construction and shake flask fermentation of DPAW2 (DPAH8 derivative, ΔP ilvE - ilvE ATG ::P ilvE - ilvE TTG )

[0042] Using ZJUTDPAH8 ( E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS*) As the starting strain, the promoter P predicted by the website https: / / salislab.net to have a lower transcriptional ability than P in Escherichia coli was replaced by using the CRISPR-Cas9 mediated gene editing technology, and the start codon was changed to TTG to finely down-regulate ilvE the expression intensity of the promoter P acn (the nucleotide sequence is shown in SEQ ID No. 1) and replace the P on the starting strain ilvE gene, and reduce the synthesis of branched-chain amino acids. ilvE promoter, and change the start codon to TTG to finely down-regulate ilvE the expression intensity of the gene and reduce the synthesis of branched-chain amino acids.

[0043] (1) Construction of pTarget-PAM-P acn - ilvE plasmid: Using the pTarget F plasmid (Addgene Plasmid #62226) as a template, PCR amplification was performed with pT-P ilvE - ilvE -PAM-F / R as primers. After the PCR product was verified by nucleic acid gel electrophoresis, it was digested with Dpn I enzyme at 37 °C for 3 h, and then transformed into E. coli DH5α. After screening on a spectinomycin plate and sequencing verification, the correct pTarget-PAM-P ilvE - ilvE plasmid was obtained for subsequent ligation of Donor DNA.

[0044] (2) Construction of pTD-P acn - ilvE TTG plasmid: First, using the E. coli W3110 genome as a template, the upstream part (F1) of the donor DNA was amplified with P ilvE -up-F / R as primers, and the downstream part (F2) of the donor DNA was amplified with P ilvE -down-F / R as primers. Then, using the E. coli W3110 genome as a template, the promoter P acn and the start codon TTG (F3) were amplified with P acn -ilvE-F / R as primers. The PCR fragments F1, F2, and F3 were obtained by gel recovery and purification of the PCR fragments; the plasmid pTarget-PAM-P ilvE - ilvE was digested with Xba I and Pst I at 37 °C for 8 h, and the DNA fragment was recovered using the Clean up kit; according to ClonExpress ®(One step clone kit, Vazyme Biotech, Nanjing, China). The instruction manual ligates the pTarget-PAM-P ilvE - ilvE vector, fragment F1, F2, and F3 together, and verifies by sequencing to obtain pTD-P acn - ilvE TTG plasmid.

[0045] (3) Introduce the pCas plasmid (Addgene Plasmid #62225) into ZJUTDPAH8 ( E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc - PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* ), transfer the monoclonal colony to an LB test tube containing 0.05 mg / L kanamycin, and culture overnight at 30 °C; then inoculate at an inoculation volume concentration of 1% into a 250 mL Erlenmeyer flask containing 50 mL of LB medium, and add 500 μL of 1 mol / L L-arabinose, culture at 150 rpm and 30 °C until OD 600 0.4 - 0.6; centrifuge at 4000 rpm and 4 °C for 10 min to collect cells and prepare electrocompetent cells. The detailed procedure is described in (Molecular Cloning: A Laboratory Manual, 3ed Edition, 99 - 102).

[0046] (4) Use a pipette to aspirate an appropriate amount of pTD-P acn - ilvE TTG (about 200 ng) plasmid and mix it with 100 μL of pre-prepared electrocompetent cells, transfer them together into a pre-cooled 2 mm electroporation cuvette, after ice-bathing for about 1 - 2 min, use an electroporator (MicroPluser TM, perform electrotransformation using BIO-RAD. Immediately after electrotransformation, add 800 μL of LB medium and gently aspirate it immediately, transfer it to a 2 mL Ep tube, resuscitate at 30 °C for 3 - 4 h, then spread it on an LB solid plate containing 0.05 mg / L kanamycin and 0.05 mg / L spectinomycin, and incubate it upside down at 30 °C for 12 - 16 h, using P acn -VF / R as primers for colony PCR verification. If a fragment of about 1100 bp can be successfully cloned, it proves to be a positive colony of DPAW3 (DPAH8 derivative, pTarget-P acn - ilvE TTG ).

[0047] (5) Plasmid curing: Use an inoculation loop to pick a positive single colony and inoculate it into an LB liquid test tube containing 1 mM IPTG and 0.05 mg / L kanamycin, culture it overnight at 30 °C. The next day, streak the bacterial solution on an LB solid plate containing 0.05 mg / L kanamycin, culture it at 30 °C for 24 h. When the bacteria grow to a certain size, pick some single colonies and streak them on an LB plate containing 0.05 mg / L spectinomycin. The single colonies that cannot grow on the LB plate containing 0.05 mg / L spectinomycin indicate that the pTarget-P ilvE - ilvE plasmid has been successfully cured. Then pick the single colonies with successfully cured pTarget-P acn - ilvE TTG plasmid into an LB test tube, culture it overnight at 37 °C for curing the pCas plasmid. The next day, streak the bacterial solution on an LB plate, culture it at 37 °C for 12 h, then pick some single colonies and streak them on an LB plate containing 0.05 mg / L kanamycin. The single colonies that cannot grow on the LB plate containing 0.05 mg / L kanamycin indicate that the pCas plasmid has been successfully cured, and finally obtain the plasmid-free strain DPAW2 (DPAH8 derivative, ΔP ilvE - ilvE ::P acn - ilvE TTG ).

[0048] (6) Shake flask fermentation: Use DPAW2 (DPAH8 derivative, ΔP ilvE - ilvE ::P acn - ilvE TTG), using the starting strain ZJUTDPAH8 as the control group, inoculate them into 10 mL of LB medium respectively, and culture at 37 °C and 200 rpm to obtain pre-cultures; after 8 - 12 h, inoculate 1 mL of the pre-culture into a 500 mL shake flask containing 50 mL of MS medium at an inoculation amount of 2%, and then culture in a constant temperature shaker at 30 °C and 180 rpm for 48 h for strain fermentation; after the fermentation is completed, take 1 mL of the fermentation broth to measure the OD 600 value. At the same time, use a pipette to aspirate 1 mL of the fermentation broth, centrifuge at 12000 rpm at room temperature for 3 min, dilute the fermentation supernatant by 5 times, and use a water-based filter membrane to remove impurities from the diluted sample, and then perform HPLC detection according to Example 1. The OD 600 and the content of D-pantothenic acid in the fermentation broth supernatant are shown in Figure 2.

[0049] It can be seen from Figure 2 that after weakening the expression of the ilvE gene on the genome, the growth of the strain has a certain increase, but there is no obvious promotion effect on the titer of D-pantothenic acid in the shake flask, which is about 6.61 g / L. This may be because the branched-chain amino acid metabolic pathway is the main competitive branch for the synthesis of pantolactone, reducing the carbon flow to the pantolactone synthesis pathway, and only weakening the ilvE gene cannot relieve the inhibition of D-pantothenic acid synthesis by branched-chain amino acid synthesis. Considering the subsequent transformation needs, the strain was further modified on this basis.

[0050] LB medium: 10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, the solvent is deionized water, and the pH value is natural.

[0051] MS medium: 20 g / L glucose, 16 g / L (NH4)2SO4, 2 g / L KH2PO4, 0.5 g / L MgSO4, 2 g / L yeast extract, 10 g / L CaCO3, 1 ml / L trace element solution, the solvent is deionized water, and the pH value is natural; 10 g / L calcium carbonate (sterilized separately); the trace element solution composition is: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 1 g / L ZnSO4·7H2O, 0.20 g / L CuSO4, 0.02 g / L NiCl2·7H2O, and the solvent is deionized water.

[0052] Example 2: Construction of DPAW3 and shake flask fermentation

[0053] Using DPAW2 as the starting strain, applying the CRISPR-Cas9-mediated gene editing technology, through the gene knock-in method, the weak promoter P M12Replace the starting strain with (nucleotide sequence shown in SEQ ID NO. 2). leuA on the gene P leuA in-situ promoter, and change the start codon ATG to TTG to finely down-regulate leuA the expression intensity of the gene and reduce the synthesis of branched-chain amino acids.

[0054] (1) Construct pTarget-PAM-P leuA -[[]] leuA plasmid: Using the pTarget F plasmid (Addgene Plasmid #62226) as a template and pT-PAM-P leuA -[[]] leuA -F / R as primers for PCR amplification. After verifying the PCR product by nucleic acid gel electrophoresis, use Dpn I digestion enzyme to incubate at 37 °C for 3 h, and then transform it into E. coli DH5α. After screening with a spectinomycin plate and verifying by sequencing, obtain the correct pTarget-PAM-P leuA -[[]] leuA plasmid for subsequent ligation of Donor DNA.

[0055] (2) Construct pTD-P M12 -[[]] leuA TTG plasmid: First, using the E. coli W3110 genome as a template, amplify the upstream part (F1) of the donor DNA with P leuA -up-F / R as primers, and amplify the downstream part (F2) of the donor DNA with P leuA -down-F / R as primers. Then, using the E. coli W3110 genome as a template, amplify the promoter P M12 and the start codon TTG of the gene M12 (F3) with P leuA -leuA-F / R as primers. Purify the PCR fragments by gel extraction to obtain F1, F2, and F3; the plasmid pTarget-PAM-P M12 -[[]] leuA After incubation with Xba I and Pst I at 37 °C for 8 h, recover the DNA fragment with the Clean up kit; according to the ClonExpress ® (One step clone kit, Vazyme Biotech, Nanjing, China) instruction manual, pTarget-PAM-P M12 -[[]] leuAThe vector, fragments F1, F2, and F3 were ligated together, and pTD-P was verified by sequencing. M12 - leuA TTG plasmid.

[0056] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the DPAW2 competent cells obtained in Example 1. The method for preparing the electrocompetent DPAW2 cells was the same as that in Example 1(3).

[0057] (4) DPAW3 positive colonies were constructed. The construction method was the same as that in Example 1(4).

[0058] (5) Plasmid curing: The implementation method was the same as that in Example 1(5) to obtain plasmid-free DPAW3.

[0059] (6) Using the constructed DPAW3 production strain with the DPAW2 constructed in Example 1 as a control group, flask tests and detections were carried out according to the method in Example 1(6). OD 600 and the content of D-pantothenic acid in the fermentation broth supernatant were as Figure 3 shown.

[0060] It can be Figure 3 seen that after the expression of the gene leuA on the genome was finely down-regulated by gene knock-in, the growth of the cells was not affected, but the titer of D-pantothenic acid in the flask increased to 6.90 g / L, which was about 4% higher than that of the strain in Example 2. It may be that down-regulating this gene caused a part of the carbon flux flowing to the branched-chain amino acids to shift to the synthesis of pantolactone, thus promoting the biosynthesis of D-pantothenic acid by the strain.

[0061] Example 3: Construction of DPAW4 and flask fermentation

[0062] Using DPAW3 as the starting strain, the gene lacI (nucleotide sequence shown in SEQ ID NO. 3) on the genome of the starting strain was knocked out by the CRISPR-Cas9 mediated gene editing technology to achieve the purpose of no addition of the inducer IPTG.

[0063] (1) Construction of pTarget-PAM- lacI plasmid: Using the pTarget F plasmid (Addgene Plasmid #62226) as a template, PCR amplification was carried out with pT-PAM- lacI -F / R as primers. After the PCR product was verified by nucleic acid gel electrophoresis, it was digested with Dpn I restriction enzyme at 37 °C for 3 h, and then transformed into E. coliDH5α was screened on a spectinomycin plate and verified by sequencing to obtain the correct pTarget-PAM- lacI plasmid for subsequent ligation of Donor DNA.

[0064] (2)Construction of pTD- lacI plasmid: First, using the E. coli W3110 genome as a template, lacI -up-F / R as primers to amplify the upstream part (F1) of the donor DNA, lacI -down-F / R as primers to amplify the downstream part (F2) of the donor DNA. The PCR fragments were purified by gel extraction to obtain F1 and F2; the plasmid pTarget-PAM- lacI was digested with Xba I and Pst I and incubated at 37 °C for 8 h, and the DNA fragments were recovered using a Clean up kit; according to the ClonExpress ® (One step clone kit, Vazyme Biotech, Nanjing, China) instruction manual, the pTarget-PAM- lacI vector, fragment F1, and F2 were ligated together, and pTD- lacI plasmid was obtained through sequencing verification.

[0065] (3)The pCas plasmid (Addgene Plasmid #62225) was introduced into the DPAW3 competent cells obtained in Example 2. The method for preparing DPAW3 electrocompetent cells was the same as that in Example 1(3).

[0066] (4)DPAW4 positive colonies were constructed, and the construction method was the same as that in Example 1(4).

[0067] (5)Plasmid curing: The implementation method was the same as that in Example 1(5) to obtain plasmid-free DPAW4.

[0068] (6)The constructed DPAW4 production strain was used with the DPAW3 constructed in Example 3 as a control group, and flask tests and detections were carried out according to the method in Example 1(6). OD 600 and the content of D-pantothenic acid in the fermentation broth supernatant were as Figure 4 shown.

[0069] As Figure 4 can be seen, after knocking out the lacI gene by gene knockout on the genome, there was no significant effect on the growth of the strain, and the flask titer of D-pantothenic acid increased slightly to 7.06 g / L.

[0070] Example 4: Construction and flask fermentation of DPAW5

[0071] Using DPAH8 as the starting strain, the CRISPR-Cas9-mediated gene editing technology was applied, and through gene knockout, the lacI gene (nucleotide sequence shown in SEQ ID NO. 3) on the genome of the starting strain was knocked out to achieve the purpose of no addition of the inducer IPTG.

[0072] (1) Construction of pTarget-PAM- lacI plasmid: Using the pTarget F plasmid (Addgene Plasmid #62226) as the template, and pT-PAM- lacI -F / R as primers for PCR amplification. After the PCR product was verified by nucleic acid gel electrophoresis, it was digested with Dpn I enzyme at 37 °C for 3 h, and then transformed into E. coli DH5α. After screening on a spectinomycin plate and sequencing verification, the correct pTarget-PAM- lacI plasmid was obtained for subsequent ligation of Donor DNA.

[0073] (2) Construction of pTD- lacI plasmid: First, using the E. coli W3110 genome as the template, lacI -up-F / R as primers to amplify the upstream part (F1) of the donor DNA, and lacI -down-F / R as primers to amplify the downstream part (F2) of the donor DNA. The PCR fragments were purified by gel extraction to obtain F1 and F2; the plasmid pTarget-PAM- lacI was digested with Xba I and Pst I at 37 °C for 8 h, and the DNA fragment was recovered using a Clean up kit; according to the ClonExpress ® (One step clone kit, Vazyme Biotech, Nanjing, China) instruction manual, the pTarget-PAM- lacI vector, fragment F1, and F2 were ligated together, and the pTD- lacI plasmid was obtained through sequencing verification.

[0074] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the DPAW3 competent cells obtained in Example 2. The preparation method of DPAW3 electrocompetent cells was the same as that in Example 1(3).

[0075] (4) DPAW4 positive colonies were constructed, and the construction method was the same as that in Example 1(4).

[0076] (5) Plasmid elimination: The implementation method was the same as that in Example 1(5), and plasmid-free DPAW5 was obtained.

[0077] (6) Using the constructed DPAW5 production strain with the constructed DPAW4 in Example 3 as the control group, shake flask tests and detections were carried out according to the method in Example 1(6). OD 600 and the content of D-pantothenic acid in the supernatant of the fermentation broth were as Figure 5 shown.

[0078] It can be seen from Figure 5 that after the gene on the DPAH8 genome was knocked out by gene knockout, compared with the control strain DPAW4, its growth and yield were both lower, and the yield was about 6.86 g / L. lacI

[0079] Example 5: Component optimization of the shake flask fermentation medium

[0080] This example provides an optimized fermentation medium for Escherichia coli, and the optimizations include carbon source concentration optimization, ammonium sulfate concentration optimization, magnesium sulfate concentration optimization, potassium dihydrogen phosphate concentration optimization, and organic nitrogen source concentration optimization.

[0081] The optimization of the carbon source concentration means that the D-pantothenic acid yield of the engineering bacteria is the highest when the glucose concentration is 20 - 30 g / L. The optimization of the ammonium sulfate concentration means that the D-pantothenic acid yield of the engineering bacteria is the highest when the ammonium sulfate concentration is 10 - 15 g / L. The optimization of the magnesium sulfate concentration means that the D-pantothenic acid yield of the engineering bacteria is the highest when the magnesium sulfate concentration is 0.3 - 0.5 g / L. The optimization of the potassium dihydrogen phosphate concentration means that the D-pantothenic acid yield of the engineering bacteria is the highest when the potassium dihydrogen phosphate concentration is 1.5 - 2 g / L. The optimization of the organic nitrogen source concentration means that the D-pantothenic acid yield of the engineering bacteria is the highest when the organic nitrogen source concentration is 1.5 - 2 g / L.

[0082] The fermentation medium before optimization included: glucose 10 - 30 g / L, ammonium sulfate 10 - 25 g / L, anhydrous betaine 1 - 5 g / L, yeast powder 1 - 5 g / L, potassium dihydrogen phosphate 1 - 5 g / L, anhydrous magnesium sulfate 0.5 - 2 g / L, β-alanine 1 - 5 g / L, 1 - 5 ml / L trace element solution, with deionized water as the solvent and the pH value being natural; the composition of the trace element solution was: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 10 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, 0.02 g / L NiCl2·7H2O, with deionized water as the solvent.

[0083] ​The optimized fermentation medium includes: 20 g / L of glucose, 16 g / L of ammonium sulfate, 2 g / L of anhydrous betaine, 2 g / L of yeast powder, 2 g / L of potassium dihydrogen phosphate, 0.5 g / L of anhydrous magnesium sulfate, 1.5 g / L of β-alanine, 1 mL / L of trace element solution, with deionized water as the solvent and the pH value being natural. The composition of the trace element solution is: 10 g / L of CuCl2, 10 g / L of FeSO4·7H2O, 10 g / L of ZnSO4·7H2O, 0.2 g / L of CuSO4, 0.02 g / L of NiCl2·7H2O, with deionized water as the solvent.

[0084] Using the engineering bacterium DPAW4 as the experimental strain, shake flask tests and detections were carried out using the fermentation medium before optimization and the optimized medium. OD 600 and the content of D-pantothenic acid in the supernatant of the fermentation broth are as Figure 5 shown.

[0085] It can be Figure 6 seen that after optimizing the components of the fermentation medium, the growth of the strain is better, and the shake flask titer of D-pantothenic acid has a slight increase to 7.23 g / L.

[0086] Example 5: Fermentation of D-pantothenic acid-producing strains DPAH8, DPAW4, and DPAW5 in a 5 L bioreactor

[0087] The fermentation was carried out in a 5 L fermenter (Shanghai Baoxing, BIOTECH-5BG) and included the following steps:

[0088] (1) Seed culture: Inoculate on a plate into 10 mL of LB medium and culture overnight on a shaker at 37 °C and 180 rpm. Then inoculate at a volume concentration of 1% into two bottles containing 100 mL of LB medium each as the secondary seed liquid and culture for 7 - 12 h.

[0089] (2) Inoculation and fermentation: The volume of the fermentation medium in the 5 L fermenter is 2 L, and it is sterilized at 115 °C for 30 min. At 25 - 30 °C, the initial aeration rate is 3 - 6 L / min, and the initial stirring speed is 300 - 450 rpm. Adjust the pH with ammonia water. Transfer a total of 200 mL of the two bottles of secondary seed liquid to the 5 L fermenter containing 2 L of the fermentation medium without resistance, and simultaneously add VB1 with a final concentration of 5 mg / L and VB 12 , and start fermentation. During the fermentation process, use dissolved oxygen in series with the rotation speed to maintain the dissolved oxygen at 10% - 30%, use ammonia water as the neutralizing agent to maintain the pH at 6.7 - 6.9, control the glucose concentration in the tank below 5 g / L through pH-linked feeding, and culture at 28 - 37 °C for 60 - 92 h to obtain the fermentation broth. The fermentation broth is all substances in the fermenter.

[0090] (3) After diluting the fermentation supernatant 40-fold, the diluted sample was subjected to impurity removal treatment using a water-based filter membrane, and then HPLC detection was performed. OD 600 and the D-pantothenic acid content in the fermentation broth supernatant are as shown in Figure 7 , 8 , and Figure 9.

[0091] As can be seen from the figure, after downregulating the branched-chain amino acid synthesis pathway, knocking out the lacI gene and optimizing the culture medium components, the D-pantothenic acid-producing strain DPAW4 increased the D-pantothenic acid yield to 90 - 105 g / L after fermentation in a 5 L fermenter for 48 - 60 hours. Compared with the starting strain DPAH8, the engineered strain DPAW4 grew rapidly in the early stage of fermentation, and the fermentation cycle was shortened by about 35% - 48%; compared with the strain DPAW5, it had obvious growth and production advantages, the fermentation cycle was shortened, and the yield at 60 h was increased by about 47%; moreover, no exogenous amino acids and inducer IPTG needed to be added during the fermentation process, reducing the fermentation process steps, which was beneficial to reducing costs and environmental pollution.

[0092] Among them, the composition of the fermentation medium is as follows: 20 g / L glucose, 16 g / L ammonium sulfate, 2 g / L anhydrous betaine, 2 g / L yeast powder, 2 g / L potassium dihydrogen phosphate, 0.5 g / L anhydrous magnesium sulfate, 1.5 g / L β-alanine, 1 mL / L trace element solution, with deionized water as the solvent and the pH value being natural. The composition of the trace element solution is: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 10 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, 0.02 g / L NiCl2·7H2O, with deionized water as the solvent.

[0093] The composition of the feeding medium is as follows: 500 g / L glucose, 10 g / L ammonium sulfate, 4 g / L anhydrous betaine, 2 g / L yeast powder, 14 g / L potassium dihydrogen phosphate, 8 g / L anhydrous magnesium sulfate, 60 g / L β-alanine, 2 mL / L trace element solution, with deionized water as the solvent and the pH value being natural.

[0094] The above-described embodiments are merely descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope of the present invention.

Claims

1. A method for constructing a genetically engineered bacterium that produces high-yield D-pantothenic acid without the addition of an inducer, characterized in that: include: Using CRISPR-Cas9-mediated gene editing technology, the expression of ilvE and leuA genes was weakened and lacI gene was knocked out in the genome of Chassis bacteria to obtain a genetically engineered bacterium with high production of D-pantothenic acid. The method for weakening the expression of the ilvE gene comprises: ilvE The in situ promoter was replaced by P acn promoter, the start codon of the ilvE gene was mutated to TTG; The method for weakening the expression of the leuA gene comprises: leuA The in situ promoter was replaced by P M12 promoter, mutating the start codon of the leuA gene from ATG to TTG; The base bacteria is: E.coli W3110, Trc-EcilvD* / BspanBA* / CgpanC* / alsS* / BspanB* / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc-PpfkB / Trc-gcvTHP / lafU::folP / yeeP::Trc-Apt2#82-serAglyA-P panB -panB / gapC::Trc-alsS*.

2. The genetically engineered bacteria for high production of D-pantothenic acid obtained by the method of claim 1, characterized in that: The genetically engineered bacteria for high production of D-pantothenic acid are: E. coli W3110, Trc-EcilvD* / BspanBA* / CgpanC* / alsS* / BspanB* / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc-PpfkB / Trc-gcvTHP / lafU::folP / yeeP::Trc-Apt2#82-serAglyA-P panB -panB / gapC::Trc-alsS* / ilvE* / leuA* / ΔlacI.

3. Use of the genetically engineered bacteria with high D-pantothenic acid production as claimed in claim 2 in the preparation of D-pantothenic acid by microbial fermentation, characterized in that: The application includes: inoculating the genetically engineered bacteria with high D-pantothenic acid production into a fermentation medium, carrying out fermentation culture at 28-37°C and 300-450rpm for 48-60h, and after the fermentation is completed, separating and purifying the supernatant of the fermentation liquid to obtain the D-pantothenic acid.

4. The use according to claim 3, characterized in that The fermentation medium comprises: 10-30 g / L of glucose, 10-25 g / L of ammonium sulfate, 1-5 g / L of anhydrous betaine, 1-5 g / L of yeast powder, 1-5 g / L of potassium dihydrogen phosphate, 0.5-2 g / L of anhydrous magnesium sulfate, 1-5 g / L of beta-alanine, and 1-5 mL / L of trace element solution, wherein the solvent is deionized water and the pH value is natural; the trace element solution comprises: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 10 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, and 0.02 g / L NiCl2·7H2O, and the solvent is deionized water.

5. The use according to claim 4, characterized in that The application comprises: loading a 5L fermentation tank with a volume of 1-3L fermentation medium, sterilizing at 115°C for 30 minutes, inoculating the genetically engineered bacterial strain into the 1-3L fermentation medium, and performing fermentation culture under the conditions of 28-37°C, an initial ventilation volume of 3-6L / min, and an initial stirring speed of 300-450rpm, adjusting the pH with ammonia water, and adding VB1 with a final concentration of 5mg / L, VB2 with a final concentration of 2mg / L, and VB3 with a final concentration of 1.5mg / L. 12 During the fermentation process, the dissolved oxygen is maintained at 10-30% by using a dissolved oxygen serial speed, ammonia water is used as a neutralizer to maintain the pH at 6.7-6.9, and the feed medium is added into the tank through pH linkage feeding, the glucose concentration is controlled below 5 g / L, and the culture is carried out at 28-37° C. for 48-60 hours to obtain a fermentation broth, and the supernatant of the fermentation broth is separated and purified to obtain the D-pantothenic acid.

6. The use according to claim 5, characterized in that The feed culture medium comprises: 500 g / L glucose, 5-25 g / L ammonium sulfate, 2-8 g / L anhydrous betaine, 1-5 g / L yeast powder, 10-20 g / L potassium dihydrogen phosphate, 5-15 g / L anhydrous magnesium sulfate, 40-100 g / L beta-alanine, 1-5 ml / L trace element solution, the solvent is deionized water, and the pH value is natural.

Images