Resistance molecular marker of diaphorina citri against thiamethoxam as well as application and detection method of resistance molecular marker

Abstract

The invention discloses a resistance molecular marker of diaphorina citri against thiamethoxam as well as application and a detection method of the resistance molecular marker. According to the application disclosed by the invention, the molecular markers of the diaphorina citri on the resistance to the thiamethoxam, namely cytochrome P450 genes DcitCYP6K3, DcitCYP4V1, DcitCYP15A4 and DcitCYP301a2, are explored by virtue of synergistic experiments, enzyme activity determination and expression profile analysis. The molecular marker is strong in specificity and high in stability, whether a to-be-detected sample is a thiamethoxam-sensitive strain or a thiamethoxam-resistant strain can be known by analyzing the relative expression quantity of the molecular marker of the to-be-detected sample of the diaphorina citri, so that the drug resistance of the diaphorina citri can be monitored at any time, and the early monitoring of the drug resistance of the diaphorina citri is facilitated; the method has important significance on the continuous and effective control of the drug resistance of diaphorina citri and the prevention and treatment of the huanglongbing.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and relates to a molecular marker, in particular to a molecular marker of resistance of citrus psyllid to thiamethoxam and an application and detection method thereof. Background Art

[0002] Huanglongbing (HLB) is a devastating disease in the citrus industry. It can cause chlorosis of citrus leaves, branch dieback, fruit drop, deformed small fruits, low internal quality of fruits, and ultimately the death of trees. The citrus psyllid (Diaphorinacitri Kuwayama, Hemiptera: Psyllidae) is the vector of Huanglongbing. Currently, there is no cure for Huanglongbing. In production, the spread of Huanglongbing is mainly prevented by controlling the damage of citrus psyllid.

[0003] Chemical control is the main way to control citrus psyllids. Thiamethoxam is the main agent registered for the control of citrus psyllids in my country. However, the long-term and large-scale use of chemical agents has led to the occurrence of high-level resistance in citrus psyllids, which affects the efficient control of citrus psyllids and poses serious challenges to the sustainable development of the citrus industry. Resistance monitoring is an important way to guide scientific use of pesticides and delay the development of resistance in citrus psyllids. Traditional resistance monitoring is mainly carried out through bioassays, which are labor-intensive and time-consuming. It is necessary to invent new methods for monitoring citrus psyllid resistance. In view of this, we compared the resistance differences of different citrus psyllid populations in the field, identified resistance-related genes and conducted functional analysis, clarified the molecular mechanism of citrus psyllid resistance to commonly used insecticides, and on this basis established a molecular marker technology for citrus psyllid resistance to insecticides. Summary of the invention

[0004] The research team of the inventor collected resistant strains of citrus psyllids in orchards in Chongzuo area of ​​Nanning, Guangxi, and tested them to be resistant to Thiamethoxam. Enzyme activity determination and synergistic experiments showed that the cytochrome P450 enzyme system is mainly involved in the metabolism and detoxification of Thiamethoxam. Subsequent transcriptome sequencing and RT-qPCR results showed that four cytochrome P450 genes DcitCYP6K3, DcitCYP4V1, DcitCYP15A4 and DcitCYP301a2 of the resistant strains were significantly upregulated, and finally RNAi technology further proved the role of these four P450 genes in the formation of citrus psyllid resistance to Thiamethoxam. The upregulated expression of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4 and DcitCYP301a2 can be used as molecular marker genes for citrus psyllid resistance to Thiamethoxam. Based on this, the present application protects the following technical solutions:

[0005] The first aspect of the present invention provides a molecular marker for citrus psyllid resistance to thiamethoxam, wherein the molecular marker is any one or more combinations of citrus psyllid cytochrome P450 genes shown in the following nucleotide sequences:

[0006] The DcitCYP6K3 gene shown in SEQ ID NO.25, the DcitCYP4V1 gene shown in SEQ ID NO.26, the DcitCYP15A4 gene shown in SEQ ID NO.27, and the DcitCYP301a2 gene shown in SEQ ID NO.28.

[0007] The second aspect of the present invention provides a primer pair for detecting the above-mentioned molecular markers, and the primer sequences of the primer pairs are: the primer pair sequence for detecting the DcitCYP6K3 gene is shown in SEQ ID NO.1 and SEQ ID NO.2, the primer pair sequence for detecting the DcitCYP4V1 gene is shown in SEQ ID NO.5 and SEQ ID NO.6, the primer pair sequence for detecting the DcitCYP15A4 gene is shown in SEQ ID NO.13 and SEQ ID NO.14, and the primer pair sequence for detecting the DcitCYP301a2 gene is shown in SEQ ID NO.3 and SEQ ID NO.4.

[0008] The third aspect of the present invention provides the use of the above-mentioned molecular markers in the classification of citrus psyllid populations sensitive to thiamethoxam and populations resistant to thiamethoxam.

[0009] In the application technology scheme, the expression level of the above-mentioned molecular marker gene is detected for the citrus psyllid to be tested. If the expression level of the molecular marker gene of the citrus psyllid to be tested is significantly higher than the gene expression level of the sensitive population, it can be judged that the citrus psyllid to be tested is resistant to thiamethoxam; if there is no significant difference in the expression level of the molecular marker gene between the citrus psyllid to be tested and the sensitive population, it cannot be judged that the citrus psyllid to be tested is resistant to thiamethoxam.

[0010] The fourth aspect of the present invention provides a method for detecting the above-mentioned molecular markers, taking the citrus psyllid sensitive population to the pesticide as a control, and detecting the expression level of the above-mentioned molecular marker gene of the citrus psyllid to be tested. If the expression level of the molecular marker gene of the citrus psyllid to be tested is significantly higher than that of the sensitive population, it can be determined that the citrus psyllid to be tested is resistant to thiamethoxam; if there is no significant difference in the expression level of the molecular marker gene between the citrus psyllid to be tested and the sensitive population, it cannot be determined that the citrus psyllid to be tested is resistant to thiamethoxam.

[0011] The above-mentioned detection method includes the following steps: extracting the total RNA of the citrus psyllid to be tested, reversing it into cDNA, performing qPCR amplification using the cDNA as a template, using the sensitive population as a control, and determining the expression level of the molecular marker gene in the object to be tested. When the expression level of the molecular marker gene in the object to be tested is significantly higher than that in the sensitive population, it can be determined that the citrus psyllid to be tested is resistant to thiamethoxam.

[0012] The above detection method uses the above primer pair for qPCR amplification.

[0013] The qPCR amplification reaction system for the above detection method is: 2×ChamQUniversal SYBRqPCRMasterMix10μL, 1μL of forward and reverse primers with a concentration of 10μM, 4μL of cDNA template, supplemented with ddH 2 0 to 20 μL;

[0014] The qPCR amplification conditions were: pre-denaturation at 95°C for 3 min; then denaturation at 95°C for 10 sec, annealing at 55°C for 30 sec, and 40 cycles.

[0015] The fifth aspect of the present invention provides a dsRNA that interferes with the above-mentioned molecular marker genes, the dsRNA sequence of the DcitCYP6K3 gene is shown in the 344th to 845th base sequence of the sequence shown in SEQ ID NO.25, the dsRNA sequence of the DcitCYP4V1 gene is shown in the 1096th to 1523rd base sequence of the sequence shown in SEQ ID NO.26, the dsRNA sequence of the DcitCYP15A4 gene is shown in the 391st to 805th base sequence of the sequence shown in SEQ ID NO.27, and the dsRNA sequence of the DcitCYP301a2 gene is shown in the 708th to 1206th base sequence of the sequence shown in SEQ ID NO.28.

[0016] The sixth aspect of the present invention provides any of the following uses of the above-mentioned dsRNA:

[0017] 1) Use in inhibiting the expression of the molecular marker gene or preparing a product for inhibiting the expression of the molecular marker gene;

[0018] 2) Use in increasing the sensitivity of citrus psyllid to thiamethoxam or in preparing a product that increases the sensitivity of citrus psyllid to thiamethoxam;

[0019] 3) Use of thiamethoxam in increasing the control effect of thiamethoxam on citrus psyllids or in preparing products that increase the control effect of thiamethoxam on citrus psyllids.

[0020] The beneficial effects of the present invention are:

[0021] The present invention discovers and verifies the molecular marker of citrus psyllid's resistance to thiamethoxam through synergistic experiments, enzyme activity determination and expression spectrum analysis. The marker has strong specificity and high stability. By analyzing the relative expression amount of the molecular marker of the citrus psyllid sample to be tested, it can be known whether the sample to be tested is a sensitive strain or a resistant strain to thiamethoxam, so that the resistance of citrus psyllid can be monitored at any time, which is conducive to the early monitoring of the resistance of citrus psyllid, and has important significance for the continuous and effective control of the resistance of citrus psyllid and the prevention and treatment of Huanglongbing.

[0022] The present invention provides specific forward and reverse primers of molecular markers of citrus psyllid resistance to thiamethoxam, and also provides an optimized qPCR system and an amplification program, which can successfully and quickly detect the relative expression amounts of citrus psyllid detoxification metabolism-related genes DcitCYP6K3, DcitCYP4V1, DcitCYP15A4 and DcitCYP301a2. If the expression amount is significantly higher than that of citrus psyllid sensitive populations, it can be judged that the citrus psyllid to be tested is resistant to thiamethoxam.

[0023] The detection method of the invention is simple and quick to operate, has strong detection specificity and high sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The graphs are the differential expression results of P450s, CarE and GST genes in SS and THRS populations of Psyllid citri. The bar graphs are the mean ± standard deviation of three replicates. The significant results were determined using Student's t-test (**p<0.01).

[0025] Figure 2 These are the results of comparative activities of P450s, CarE and GSTs in different populations of citrus psyllid, SS: sensitive population of citrus psyllid; THRS: thiamethoxam-resistant population of citrus psyllid; error bars represent the standard deviation of the mean of three independent replicates; significant results were determined using Student's t-test (**p<0.01).

[0026] Figure 3 The expression patterns of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4 and DcitCYP301a2 in different tissues and developmental stages of THRS are shown. One-way analysis of variance (ANOVA) was used for statistical comparison. The bar graphs are the mean ± standard deviation of three replicates. Different letters on the bars indicate significant differences (Duncan, P < 0.05). HE: head, CU: epidermis, MG: midgut, MT: Malpighian tubules, FB: fat body, TE: testis, OV: ovary; Egg, 1st-5th: 1st-5th instar nymphs, Adult: adult.

[0027] Figure 4 The expression pattern of P450 gene of THRS under different concentrations of thiamethoxam stress is shown: AD: LC30 treatment, EH: LC50 treatment, IL: LC70 treatment; the bar graph is the mean ± standard deviation of three replicates; the significant results were determined using Student's t-test (**p<0.01*p<0.05).

[0028] Figure 5 Shows H 2 Expression of P450 genes after O and dseGFP treatment: Artificial feed without dsRNA was replaced by H2O; The bar graph is the mean ± SD of three replicates; The significant results were determined by Student's t-test (**p<0.01*p<0.05).

[0029] Figure 6 The results show the target gene silencing efficiency of Psyllid citrus and the effect of P450 gene knockdown on thiamethoxam toxicity: AD: silencing efficiency of 4 P450 genes after 48h of silencing treatment, EH: silencing efficiency of 4 P450 genes after 72h of silencing treatment, IL: sensitivity of P450 gene knockout of SS to thiamethoxam, MP: sensitivity of P450 gene knockout of THRS to thiamethoxam; the bar graphs are the mean ± standard deviation of three replicates; significant results were determined using Student's t-test (**p<0.01*p<0.05). DETAILED DESCRIPTION

[0030] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0031] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0032] Example 1: Transcriptome sequencing of thiamethoxam-resistant and sensitive strains of citrus psyllid

[0033] 1 Materials

[0034] 1.1 Insect sources for testing

[0035] The sensitive population of citrus psyllid (SS) was collected from Yanshan, Guilin, Guangxi (25.01°N, 110.33°E) in 2020 and has been raised in the insect breeding room of Guangxi Specialty Crops Research Institute in Guilin. It has not been exposed to any pesticides during this period and has been raised for more than 50 generations. The thiamethoxam-resistant population (THRS) was collected from Chongzuo, Nanning, Guangxi (22.40°N, 107.26°E) in 2023 and sprayed with a lethal dose of 30% (LC 30 ) concentration of thiamethoxam (CAS registration number

[0036] 153719-23-4) for each generation screening, and 20 generations have been raised continuously so far. Both strains are raised in 120-mesh mesh insect cages with a cage size of 60×60×90cm; 5 to 6 pots of Murraya aromatica plants are placed in each insect cage. The breeding temperature is 26±1℃, the lighting conditions are 14L:10D (light:dark), and the relative humidity is 70-85%.

[0037] 1.2 Main reagent sources

[0038] ReliaPrepTM RNA Tissue Miniprep System (Promage, catalog number: Z6111);

[0039] HiScriptⅢ1st Strand cDNA Synthesis Kit (+gDNA wiper) reverse transcription kit (Nanjing Novogene Biotech Co., Ltd., catalog number: R312);

[0040] ChamQTM Universal SYBR qPCR Master Mix (Nanjing Novozymes Biotech Co., Ltd., catalog number: Q711).

[0041] 2 Methods

[0042] 2.1 Collection of thiamethoxam-resistant and -sensitive strains of citrus psyllid

[0043] Use the fluke tube to collect sensitive and resistant strains of citrus psyllids that have just emerged from their fowls for 3-7 days, and then collect them into 1.5mL enzyme-free tubes. There are about 50 insects in each enzyme-free tube, and three tubes are collected as replicates. After preparation, use liquid nitrogen to quickly freeze and store in a -80℃ refrigerator for later use.

[0044] 2.2 Transcriptome sequencing and expression profiling analysis

[0045] The prepared samples were sent to Beijing Biomarker Biotechnology Co., Ltd. for transcriptome sequencing on the Illumina HiSeq platform.

[0046] 2.3 Construction of cDNA library and sequencing

[0047] First, Oligo(dT) magnetic beads were used to separate the mRNA of Psyllid from the total RNA and enrich the mRNA. The mRNA was fragmented by treating with a specific buffer. The fragmented mRNA was used as a template and combined with random oligonucleotide primers to synthesize the first strand of cDNA under the action of M-MuLV reverse transcriptase. The complementary strand of cDNA was synthesized by a combination of DNA polymerase I, RNase H, deoxyribonucleoside triphosphates (dNTPs) and buffer. The double-stranded cDNA was purified by QiaQuick PCR extraction kit, and the poly(A) end was repaired and the sequencing adapter was connected at the same time. AMPureXP beads were used to screen the cDNA fragments of about 150 bp, and the concentration of the library was further increased by PCR amplification. The PCR product was then purified again using AMPureXP beads to obtain the final library. The constructed library was quantitatively detected by qPCR method for effective concentration (the concentration must be greater than 2nM) to ensure that it meets the quality standards. After the library was qualified, it was sequenced using the Illumina HiSeqTM 2500 sequencing platform.

[0048] 2.4 Data quality control and reference sequence comparison

[0049] To ensure that the reads are of high enough quality, the original sequencing data (rawreads) are subjected to a screening procedure to remove reads with adapters, low-quality reads, and reads containing more than 10% N bases, thereby obtaining high-quality cleanreads. The cleanreads are aligned with the genome sequence of the citrus psyllid, and the reads aligned to the reference genome are called mapped reads. The percentage of mapped reads to clean reads is used to assess whether the selected reference genome assembly meets the information analysis requirements, and then the transcripts are assembled and compared with the existing annotation information to identify annotated genes with known functions and potential new genes.

[0050] 2.5 Analysis and enrichment of differentially expressed genes

[0051] DESeq software was used to perform differential expression analysis between sample groups to identify gene sets with different expression levels under two biological conditions. For samples lacking biological replication, EBseq method was used for differential expression analysis. The criteria for screening differentially expressed genes were set as fold change (FC) ≥ 2 and false discovery rate (FDR) < 0.01. Based on FDR < 0.01 and |log 2The screening condition of (FC)|>1 was used to determine the significantly differentially expressed genes (DEGs) between THRS and SS of citrus psyllid. Subsequently, functional enrichment analysis of Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) was performed on all the screened DEGs, and the significance level was set at P≤0.05.

[0052] 2.6 RT-qPCR verification of differentially expressed genes

[0053] The HiScriptⅢ1st Strand cDNA Synthesis Kit was used to reverse transcribe the RNA returned after transcriptome sequencing by the sequencing company to synthesize cDNA. The method steps were carried out according to the instructions of the kit, the reaction system was 20μL, and the reaction conditions were: 37℃, 15min; 85℃, 5sec. The obtained cDNA was used as a template for qPCR to detect the relative expression of genes with upregulated expression in the transcriptome results. Ten differentially expressed genes were selected for verification, and the target gene RT-qPCR primer sequences were designed using Primer 6 software. GAPDH and β-actin genes were used as internal reference genes and synthesized by Beijing Qingke Biotechnology Co., Ltd. The primer sequences are shown in Table 1.

[0054] Table 1 RT-qPCR primer sequence information

[0055] Gene name Primer sequence (5'-3') SEQ ID NO DcitCYP6K3-F CCACATATCAAGTCTGCTCCTGTC SEQ ID NO.1 DcitCYP6K3-R AAGTGCCAATTAGAATGCCGAAGT SEQ ID NO.2 DcitCYP301a2-F TGGTCATGGTGCTAGGATGTGTCT SEQ ID NO.3 DcitCYP301a2-R ACCTTGTACTCCAGTGGCTTGTGA SEQ ID NO.4 DcitCYP4V1-F CGTCATCCGCAAATACAGCAGGAA SEQ ID NO.5 DcitCYP4V1-R AGTTAGCCGTCTTCGTGGTGTCT SEQ ID NO.6 DcitCYP4C30-F CTGACCAGACCTGAGCACATAGA SEQ ID NO.7 DcitCYP4C30-R GCGATGCGAATGCCACTTAGC SEQ ID NO.8 DcitCYP4g6-F GAAGCCGCCAAGAGACCAGTA SEQ ID NO.9 DcitCYP4g6-R TCCAACACAACCTGCTCCATATTAG SEQ ID NO.10 DcitCYP313b1-F GGAGCGGATGGCACAATGTT SEQ ID NO.11 DcitCYP313b1-R TGAGAACGAAATAGGTGGGATTGG SEQ ID NO.12 DcitCYP15A4-F TGCCATTAGTGGAAGCCGTCTT SEQ ID NO.13 DcitCYP15A4-R TGGTATCTTCGGTCGCTCTGTG SEQ ID NO.14 DcitCYP4C41-F CCGAGGATACAGCAGGAACATTGTG SEQ ID NO.15 DcitCYP4C41-R AGTTAGCCGTCTTCGTGGTGTCT SEQ ID NO.16 DcitCCE32-F CGGTAGTGACAACTGCCTCTTCC SEQ ID NO.17 DcitCCE32-R ATTGCCTCCCTTGAATGCTCCTC SEQ ID NO.18 DcitGSTD1-F GAGCCGTGCCATCATTGCCTAC SEQ ID NO.19 DcitGSTD1-R GTTGACGATGCCTCTCGCCTTG SEQ ID NO.20 DcitActin1-F TGTGACGAAGAAGTTGCTGC SEQ ID NO.21 DcitActin1-R TGGGGTATTTCAGGGTCAGG SEQ ID NO.22 DcitGAPDH2-F CATGGCAAGTTCAACGGTGA SEQ ID NO.23 DcitGAPDH2-R CGATGCCTTCTCAATGGTGG SEQ ID NO.24

[0056] The qPCR reaction system was as follows: ChamQ Universal SYBR qPCR Matser Mix 10 μL, 1 μL of 10 μM forward and reverse primers, 4 μL of cDNA template of the sample to be tested, supplemented with ddH 2 The amplification program was as follows: pre-denaturation at 95°C for 3 min, followed by denaturation at 95°C for 10 sec, annealing at 55°C for 30 sec, and 40 cycles.

[0057] 2.7 Data Analysis

[0058] RT-qPCR analysis software was qPCRsoft4.0. The relative expression levels of genes in the treatment group and the control group were calculated by one-way ANOVA and Duncan's new multiple range method using SPSS 20.0 software.

[0059] 3 Results

[0060] 3.1 Sequencing quality

[0061] After constructing cDNA libraries and sequencing 6 samples of citrus psyllid SS and THRS, a total of 42.59Gb of CleanData was obtained. Each sample reached 6.54Gb of Clean date, the GC content was above 40.43%, and the Q30 base percentage was above 96.73%, indicating that the sequencing quality was good.

[0062] 3.2 Number of differentially expressed genes

[0063] A total of 1420 DEGs were obtained from the thiamethoxam-resistant population THRS and the sensitive line SS (letter A), of which 702 were up-regulated and 718 were down-regulated. The log2(FC) ranged from -12.35 to 8.21.

[0064] 3.3 GO function enrichment of differentially expressed genes

[0065] After GO enrichment analysis, DEGs were enriched into 34 functional groups in three main categories. Among them, in the classification of "biological process", "cellular process" and "metabolic process" had the largest number of genes in this category. "Binding" and "catalytic activity" were the subcategories with the largest number in the "molecular function" category.

[0066] 3.4 KEGG functional enrichment of differentially expressed genes

[0067] KEGG is the main public database for pathways. Pathway significant enrichment can determine the most important biochemical metabolic pathways and signal transduction pathways involved in genes. In this study, 432 DEGs were classified and annotated in the KEGG database, and "Metabolism" accounted for the largest proportion in the classification. Among them, the most enriched pathways were "lysosome" and "Autophagy" pathways, both containing 16 DEGs. The three metabolic pathways related to drug metabolism, "ABC transporters", "drug metabolism-other enzymes", "drug metabolism-cytochrome P450" and "Metabolism ofxenobiotics by cytochrome P450", respectively contained 5, 7, 4 and 5 DEGs, which may be involved in the metabolism of thiamethoxam by citrus psyllids.

[0068] 3.5 Statistics of metabolism-related differentially expressed genes

[0069] Insects have evolved mechanisms to use detoxification enzymes and transporters to decompose or block drugs before they act on their targets. The main detoxification enzymes are P450s, CCEs and GSTs; the main transporters are ABCs, UGTs, etc. In this study, based on the results of RNA sequencing, a total of 28 genes related to metabolism were found, including 17 P450s genes, 2 ESTs genes, 1 GST gene, 2 UGTs genes, and 6 ABCs genes.

[0070] 3.6 RT-qPCR verification of differentially expressed detoxification enzyme genes

[0071] In order to verify the accuracy of the transcriptome sequencing results and further confirm the expression of detoxification enzyme-related genes, we compared and analyzed the differentially expressed detoxification enzyme genes. We selected 8 P450 genes, 1 CarE gene and 1 GST gene for RT-qPCR analysis (as shown in Table 2). Figure 1 As shown, compared with the sensitive population SS, 7 P450s genes DcitCYP6K3, DcitCYP301a2, DcitCYP4V1, DcitCYP4g6, DcitCYP313b1, DcitCYP15A4 and DcitCYP4C41 were up-regulated by 2.13, 2.52, 2.69, 1.21, 1.74, 1.64 and 1.33 times in the resistant population THRS, respectively; DcitCYP4C30 gene was down-regulated by 6.46 times in THRS. Compared with the sensitive population SS, CCEs gene DcitCCE32 was up-regulated by 1.54 times in the resistant line THRS; GST gene DcitGSTD1 was up-regulated by 1.40 times in the resistant line THRS.

[0072] Table 2 Statistics of detoxification enzyme gene information

[0073]

[0074]

[0075] Example 2: Bioassay and synergistic assay of citrus psyllids against thiamethoxam

[0076] 1 Materials and Reagents

[0077] 1.1 Insect sources for testing

[0078] The laboratory sensitive population (SS) and thiamethoxam-resistant population (THRS) are the same as those in Example 1.

[0079] 1.2 Main Reagents

[0080] 97% Thiamethoxam original powder (Liuzhou Huinong Chemical Co., Ltd.)

[0081] Diethyl maleate (DEM), piperonyl butoxide (PBO) and triphenyl phosphate (TPP) were purchased from Sigema, USA.

[0082] 2 Methods

[0083] 2.1 Bioassay

[0084] The toxicity of thiamethoxam to citrus psyllid adults was determined by the glass tube film method, which was improved based on the bottle bioassay method of Kanga and Chen (Chen et al., 2017; Kanga et al., 2016). The experiments were conducted on adult citrus psyllids that had emerged about one week ago (without distinguishing between female and male insects). First, thiamethoxam (97%) was diluted with acetone to 1000 mg·L -1 As the mother solution, according to the results of the preliminary experiment, the mother solution was diluted into 5-6 concentrations of thiamethoxam solution, and it was prepared and used immediately; then, 200 μL of thiamethoxam-acetone dilution or acetone (control) was added to a clean, dry 20mL flat-bottomed glass tube (diameter 1.5cm, height 8cm) with a pipette, and then the glass tube was quickly laid flat and rolled on the table until the acetone evaporated and a uniform drug film formed on the inner wall; then, 15-20 citrus psyllids were sucked into the glass tube using a sucker and gently blown into the glass tube, and the glass tube mouth was sealed with a nylon net (100 mesh) and a rubber band, and placed flat in an artificial incubator (temperature: 26±1℃, light conditions: 14L:10D, humidity: 70-85%). After 5 hours, the mortality rate was counted and recorded, and the citrus psyllid was gently touched with a soft brush. If the insect did not move, it was considered dead. Each concentration was repeated 3 times.

[0085] 2.2 Synergist experiment

[0086] Since citrus psyllids have a high resistance to thiamethoxam, the esterase inhibitor triphenyl phosphate (TPP), the glutathione S-transferase inhibitor diethyl maleate (DEM) and the multifunctional oxidase inhibitor piperonyl butoxide (PBO) were used as synergists to determine their synergistic effects on thiamethoxam in sensitive and resistant populations. -1 The synergist stock solution was diluted into 3-5 concentration gradients; similarly, 1000 mg·L -1 The thiamethoxam stock solution was diluted to 5-6 concentrations as needed. A preliminary experiment was conducted. This method was improved based on the leaf dipping method of Naeem and Tian (Naeem et al., 2019; Tian et al., 2016), and the method is as follows:

[0087] First, use a measuring cylinder to measure 20-50mL of ultrapure water and add it to a 250mL triangular flask, and weigh 0.2g-0.5g of agar and add it to a mixture containing 1% agar, then put it in an oven and heat it for 2 minutes to completely dissolve the agar. After cooling down in the room, take 10mL and add it to a plastic disposable culture dish with a diameter of 90mm, and let it stand at room temperature until the agar solidifies. Then, wash the fresh citrus leaves (similar in area) with ultrapure water, dry them, cut off the petioles with scissors and cut the leaves in half along the midrib. Put them in the synergist solution with different concentration gradients and immerse them for 30s. Take out the leaves with tweezers, place them face down on a clean, inverted glass culture dish with a diameter of 20mm, and use a pipette to absorb 200μL of the synergist solution of the corresponding concentration and evenly apply it on the back surface of the leaves. After ventilation and drying at room temperature, lay the treated leaves face down on the agar bed (the paving area accounts for more than 85% of the total area of ​​the culture dish). Finally, 25 citrus psyllid adults were placed in a 1.5 mL centrifuge tube, placed in an ice box for 60-90 seconds to freeze them, and then quickly transferred to a culture dish with a short-bristled brush, covered with a lid, and sealed with a sealing film in a "cross" shape to ensure that there is sufficient oxygen in the dish and prevent the citrus psyllid from escaping. Acetone treatment was used as a control. Each synergist concentration was repeated 3 times, and the above culture dish was placed in an artificial climate box with a temperature of 26±2°C, a humidity of 75±5%, and a light intensity of 16:8 (L:D). After 48 hours, the mortality rate of citrus psyllids under different concentrations of synergists was observed and counted, and the optimal synergist concentration was selected. Then, the surviving adults were subjected to toxicity determination using the drug film method to explore whether the synergist works.

[0088] Based on the preliminary experiment, the highest concentration of the three synergists was selected as 20 mg·L -1 After 48 hours, there was no significant difference in mortality between the control group and the control group. After toxicity test, it was found that the mortality of adults that had fed on leaves containing synergists increased significantly. The synergistic effect of synergists was determined according to the pre-experimental method. Finally, the LC without synergists 50 Divide by the LC using the enhancer 50 Calculate the synergistic ratio (SR).

[0089] 1.2 Data Analysis

[0090] The experimental results were processed using PoloPlus and the median lethal concentration (LC 50 ), degrees of freedom (df), 95% confidence interval, chi-square value and other values ​​to evaluate the rationality of the results, and then use the LC of the resistant population 50 / LC for sensitive populations 50 The resistance ratio (RR) was calculated.

[0091] 3 Results

[0092] As shown in Table 3, the LC values ​​of thiamethoxam against SS and THRS strains of citrus psyllids 50 The values ​​were 0.22 mg·L -1 and 15.59 mg·L -1 The resistance multiple was 70.86 times. The esterase activity inhibitor TPP reduced the LC of SS and THRS populations. 50 Reduced to 0.15 mg·L -1 and 9.92 mg·L -1 , with 1.46-fold and 1.57-fold synergistic effects, respectively. The glutathione S-transferase inhibitor DEM increased the LC of the SS and THRS populations. 50 Reduced to 0.16 mg·L -1 and 10.44 mg·L -1 , with 1.38-fold and 1.49-fold synergistic effects, respectively. The multifunctional oxidase inhibitor PBO increased the LC of the SS and THRS populations. 50 Reduced to 0.14 mg·L -1 and 7.81 mg·L -1 , with 1.57 and 2.00 times synergistic effects respectively. The results of toxicity assay preliminarily proved that P450 played a leading role in the resistance of citrus psyllid to thiamethoxam.

[0093] Table 3 Toxicity of thiamethoxam to SS and THRS of citrus psyllid

[0094]

[0095] Example 3: Determination of enzyme activity of sensitive and thiamethoxam-resistant strains of citrus psyllid

[0096] 1 Materials and Reagents

[0097] 1.1 Insect sources for testing

[0098] The laboratory sensitive population (SS) and thiamethoxam-resistant population (THRS) were subjected to the same experiment 1.

[0099] 1.2 Main Reagents

[0100] 7-Ethoxycoumarin and 7-hydroxycoumarin were purchased from Sigema, USA;

[0101] CarE activity assay kits (BC0845) and GST activity assay kits (BC0355) were purchased from Beijing Solebow Company.

[0102] 2 Methods

[0103] 2.1 Drawing of bovine serum albumin standard curve

[0104] The prepared 1000μg / mL bovine serum albumin standard solution (BSA) was diluted to 7 concentration gradients with 0.5mol / L Tris-HCL (pH 7.5). Samples were added to the ELISA plate, 200μL Coomassie Brilliant Blue G-250 solution and 50μL bovine serum albumin solutions of different concentrations, and 50μL 0.5mol / L Tris-HCL (pH 7.5) was added to the control wells. Each group was repeated three times, and after reacting at 37℃ for 10min, the absorbance at 595nm was measured with an ELISA instrument. Finally, the concentration of bovine serum albumin was used as the x-axis (μg / mL), and the difference between the OD value of the treatment group and the OD value of the control group (ΔOD) was used as the y-axis to draw the bovine serum albumin standard curve. The establishment of the bovine serum albumin standard curve is shown in Table 4.

[0105] Table 4 BSA standard curve reaction system

[0106]

[0107] 2.2 Protein content determination

[0108] The protein content in the crude enzyme solution was determined according to Bradford's Coomassie brilliant blue method (Bradford, 1976). 200 μL Coomassie brilliant blue G-250 solution and 50 μL crude enzyme solution to be tested were added to the ELISA plate, and 50 μL 0.5 mol / L Tris-HCL (pH 7.5) solution was added as the control group. The experiment was set up for three biological replicates. After reacting at 37°C for 10 minutes, the absorbance at 595 nm was measured with an ELISA instrument. The protein content in the crude enzyme solution was calculated using the bovine serum albumin standard curve.

[0109] 2.3 Determination of cytochrome P450 oxidase specific activity

[0110] Preparation of crude enzyme solution: 50 citrus psyllid adults were placed in a 1.5 mL enzyme-free (DNase / RNase-Free) centrifuge tube, 1 mL 0.1 mol / L phosphate buffer (containing 0.5 mol / L DTT, 0.1 mol / L PMSF, 0.1 mol / L EDTA, 10% glycerol) was added, and the mixture was ground into a homogenate using a vibration grinder on ice. The mixture was centrifuged at 14000 × g for 20 min at 4°C, and the supernatant was placed in a new 1.5 mL enzyme-free centrifuge tube and immediately placed on ice for subsequent experiments. Sensitive strains of citrus psyllid adults were used as controls, and 3 replicates were set for each group.

[0111] Enzyme activity determination: The relative activity of cytochrome P450 oxidase between sensitive and resistant populations of citrus psyllids was determined using 7-ethoxycoumarin as the reaction substrate, which was slightly modified according to the method of Tang Tao and Bass (Tang Tao, 2019; Bass et al., 2011). 365 μL of 0.1 mol / L pH 7.5 phosphate buffer, 5 μL of 40 mmol / L 7-ethoxycoumarin, 10 μL of 10 mmol / L NADPH and 120 μL of the enzyme solution to be tested were added to a 1.5 mL centrifuge tube in sequence. After shaking for 15 min at 30 °C, the reaction tube was immediately transferred to ice and 300 μL of 15% trichloroacetic acid (TCA) was added to terminate the reaction. The mixture after the termination reaction was centrifuged at 15000×g for 2 min, and the supernatant was aspirated as much as possible, and 100 μL was added to a 96-well ELISA plate, and 50 μL of 1.6 mol / L pH 11.5 glycine-sodium hydroxide (Gly-NaOH) was added. The content of 7-hydroxycoumarin was detected using Thermo's Varioskan Flash. Fluorescence microplate reader, with an excitation wavelength of 358 nm and an emission wavelength of 456 nm. Each treatment was repeated three times. A standard curve was made using 7-hydroxycoumarin standards, and the fluorescence intensity value was converted into nmol 7-hydroxycoumarin.

[0112] Drawing of the standard curve of 7-hydroxycoumarin: Using phosphate buffer as the control, dilute 0.01mmol / L 7-hydroxycoumarin with phosphate buffer, add 100μL Ly-NaOH and mix well, then measure the concentration immediately, draw the standard curve with the actual content of 7-hydroxycoumarin as the x-axis and the difference between the OD value of the treatment group and the OD value of the control group (ΔOD) as the y-axis. The establishment of the standard curve of 7-hydroxycoumarin is shown in Table 5.

[0113] Calculation of specific activity: specific activity = (C production × V total) / (T × Pro)

[0114] C is the product concentration (nmol), V is the total reaction volume (μL), T is the reaction time (min), and Pro is the protein content (mg).

[0115] Table 5 7-Hydroxycoumarin standard curve reaction system

[0116]

[0117] 2.4 Determination of the relative activity of carboxylesterase and glutathione-S-transferase

[0118] Preparation of crude enzyme solution: 50 citrus psyllid adults were placed in a 1.5 mL enzyme-free centrifuge tube, 1 mL of 0.1 mol / L phosphate buffer (pH 7.5) was added, and the mixture was ground into a homogenate using a vibration grinder on ice. The mixture was centrifuged at 14,000 × g for 20 min at 4°C, and the supernatant was placed in a new 1.5 mL enzyme-free centrifuge tube and immediately placed on ice for subsequent experiments. Sensitive strains of citrus psyllid adults were used as controls, and 3 replicates were set for each group.

[0119] The preparation method of cytochrome P450 oxidase crude enzyme solution is basically the same as that of esterase and glutathione-S-transferase crude enzyme solution, except that the latter two use phosphate buffer (pH 7.5) without other mixtures. Its activity is measured and calculated according to the instructions of Solarbio's carboxylesterase (CarE) activity detection kit and glutathione S-transferase (GST) activity detection kit.

[0120] 3 Results

[0121] The regression equation of bovine serum albumin is y = 0.0037x + 0.1014, R 2 =0.9991, which is suitable as a standard curve for calculating protein content. The regression equation of 7-hydroxycoumarin is y=413.8x+44.169, R 2 =0.9965, which is suitable as a standard curve for calculating the amount of 7-hydroxycoumarin produced.

[0122] To further understand the role of detoxification enzymes in insecticide resistance, the crude enzyme activities of P450s, CarEs, and GSTs of SS and THRS populations of Psyllid citri were determined. Figure 2 As shown, there were significant differences in the activities of the three detoxification enzymes between the SS and THRS populations. The activities of P450s, CarEs and GSTs in the THRS population were 1.71-fold, 1.37-fold and 1.33-fold higher than those in the SS population, respectively.

[0123] Example 4: Analysis of spatiotemporal expression patterns of P450 genes in Citrus psyllid

[0124] 1 Materials and Reagents

[0125] 1.1 Insect sources for testing

[0126] The laboratory sensitive population (SS) and thiamethoxam-resistant population (THRS) are the same as those in Example 1.

[0127] 1.2 Main Reagents

[0128] 97% Thiamethoxam original powder (Liuzhou Huinong Chemical Co., Ltd.).

[0129] 2 Methods

[0130] 2.1 Sample collection from different tissues of Psyllid citri

[0131] 100 citrus psyllid adults that had emerged for 5-7 days were collected from the SS strain and the THRS strain of citrus psyllid, respectively. They were placed on an ice box for 30-60 seconds before dissection to freeze them unconscious, and then soaked in 70% alcohol for 20-30 seconds and washed three times with sterile water. The psyllids were then transferred to a dissection dish containing pre-cooled PBS, and various tissues were dissected out under a stereo microscope. Finally, 7 tissues including head, epidermis, midgut, Malpighian tubules, fat body, testis, and ovary were collected with forceps in a 1.5 mL enzyme-free centrifuge tube, quickly frozen with liquid nitrogen, and stored in a -80°C refrigerator for subsequent use. Three biological replicates were set for each sample.

[0132] 2.2 Sample collection of citrus psyllids at different developmental stages

[0133] Female adults of citrus psyllids that were about to lay eggs (yellow abdomen) were selected from the SS and THRS strains of citrus psyllids and transferred to new cages. They were selected to be raised on Murraya odora containing tender shoots. After 7-10 days of egg laying, all adults were transferred out. The tender shoots of Murraya odora containing eggs were cut off, and 1000-1200 eggs were observed and collected using a stereo microscope and tweezers. The remaining eggs continued to grow in the cage, and nymphs of different ages were collected in time. 800-1000 1st instar nymphs, 600-800 2nd instar nymphs, 300-500 3rd instar nymphs, 100-200 4th instar nymphs, 50 5th instar nymphs, and 30 adults were collected. Three biological replicates were set for each group. The samples were collected in 1.5mL enzyme-free centrifuge tubes, and were quickly frozen and killed with liquid nitrogen and stored in a -80℃ refrigerator for subsequent use.

[0134] 2.3 Sample collection for citrus psyllid induced by pesticides

[0135] Under the pressure of pesticides, pests can enhance their ability to detoxify and metabolize pesticides by up-regulating the expression of toxin-regulating enzyme genes, thereby better adapting to the environment. In order to study the effect of pesticides on the expression of four P450 up-regulated genes, the glass tube film method was used to stress the resistant strain of citrus psyllid with thiamethoxam. This method was improved based on previous studies (Tiwari et al., 2011; Yu and Killiny, 2018). Similar to the bioassay method, the difference is that the citrus leaves were immersed in acetone-thiamethoxam for 30 seconds, dried, and placed in a glass tube with a layer of film on the inner wall. According to the bioassay results, LC 30 (10.30mg·L -1 ), LC 50 (15.59mg·L -1 ), / LC 70 ((23.58mg·L -1) were used to treat citrus psyllid adults for 1h, 2h, 4h, 12h and 24h, with 25 citrus psyllids treated in each treatment. Acetone treatment was used as a control, and each treatment was repeated three times. Surviving adults were collected in 1.5mL enzyme-free centrifuge tubes at each time point, quickly killed with liquid nitrogen, and the samples were stored in a -80℃ refrigerator for subsequent use.

[0136] 2.4 Real-time fluorescence quantitative PCR

[0137] RNA was extracted from all the samples collected above and the first-strand cDNA was synthesized.

[0138] Using all the obtained cDNA samples as templates, the relative expression levels of 24 genes, including DCCYP6K3, DCCYP4V1, DCCYP15A4 and DCCYP301a, were analyzed by real-time quantitative PCR at different developmental stages, in different tissues and under different concentrations of thiamethoxam. The primer sequences of the four P450 genes are shown in Table 1, and the quantitative PCR reaction method and conditions were the same as above.

[0139] 3 Results

[0140] 3. Expression patterns of the 14 P450 genes in different tissues

[0141] The expression patterns of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4 and DcitCYP301a2 in different tissues of THRS were detected by RT-qPCR. Figure 3 AD), DcitCYP6K3 was expressed at the lowest level in the ovary and at the highest level in the Malpighian tubules, which was 9287.94 times that of the ovary, followed by the midgut and head, which were 3414.17 times and 12.87 times that of the ovary, respectively. DcitCYP4V1 was expressed at the lowest level in the head and at the highest level in the testis, which was 47.97 times that of the head, followed by the Malpighian tubules and fat body, which were 32.29 times and 28.22 times that of the head, respectively. DcitCYP15A4 was expressed at the lowest level in the ovary and at the highest level in the testis, which was 77.35 times that of the ovary, followed by the Malpighian tubules and midgut, which were 18.67 times and 13.23 times that of the ovary, respectively. DcitCYP301a2 was expressed at the lowest level in the midgut and at the highest level in the fat body, which was 19.17 times that of the midgut, followed by the epidermis and testis, which were 7.97 times and 7.65 times that of the midgut, respectively.

[0142] 3. Expression patterns of the 24 P450 genes in different developmental stages

[0143] The expression patterns of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4 and DcitCYP301a2 in different developmental stages of THRS were detected by RT-qPCR. Figure 3 EH), these four P450 genes are expressed in every developmental stage. From the egg stage to the adult stage, the expression levels of DcitCYP6K3 and DcitCYP15A4 show a trend of first increasing and then decreasing with the increase of insect age, while the expression levels of DcitCYP4V1 and DcitCYP301a2 show a trend of first decreasing, then increasing, and then decreasing. DcitCYP6K3, DcitCYP15A4 and DcitCYP301a2 are most expressed in nymphs. The expression levels of DcitCYP6K3 in the second instar nymph, DcitCYP15A4 in the third instar nymph and DcitCYP301a2 in the fourth instar nymph are 12.82 times, 30.42 times and 30.60 times that of adults, respectively. The expression level of DcitCYP4V1 was highest in the adult stage, followed by the fourth-instar nymph, which were 5.19 times and 4.07 times that of the first-instar nymph, respectively.

[0144] The ORF sequences of genes DcitCYP6K3, DcitCYP4V1, DcitCYP15A4 and DcitCYP301a2 are shown in SEQ ID NOs. 25, 26, 27 and 28 respectively.

[0145] 3. Response of 34 P450 genes to different concentrations of pesticides

[0146] To further explore the relationship between thiamethoxam and the four P450 genes, we used three concentrations (LC 30 (10.30mg·L -1 ), LC 50 (15.59mg·L -1 ), / LC 70 ((23.58mg·L -1 )) was used to induce the THRS population of citrus psyllid, and the expression patterns of the corresponding genes were measured at 1h, 2h, 4h, 12h and 24h after treatment.

[0147] The results are as follows Figure 4 As shown:

[0148] LC 30After treatment with 1% CYP6K3, the expression of DcitCYP6K3 was significantly upregulated by 2.05, 1.42 and 1.54 times at 1h, 2h and 4h, respectively, compared with the control group; DcitCYP4V1 showed significant upregulation at all treatment times, increasing by 1.48, 3.08, 1.78, 1.66 and 1.62 times, respectively; the expression patterns of DcitCYP15A4 and DcitCYP301a2 were similar to those of DcitCYP6K3, and the expression of DcitCYP15A4 was significantly upregulated by 2.25, 1.29 and 1.19 times at 1h, 2h and 4h, respectively; the expression of DcitCYP301a2 was significantly upregulated by 1.48, 1.57 and 1.24 times at 1h, 2h and 4h, respectively ( Figure 4 AD).

[0149] LC 50 After treatment with 100 μg / mL of dcitCYP6K3, the expression of DcitCYP6K3 was significantly upregulated at 1 h, 2 h, 4 h and 12 h, increasing by 6.62-, 4.10-, 1.60- and 1.85-fold, respectively; the expression of DcitCYP4V1 was significantly upregulated at 1 h, 2 h, 4 h and 24 h, increasing by 3.26-, 2.31-, 1.31- and 1.14-fold, respectively; the expression pattern of DcitCYP15A4 was similar to that of DcitCYP6K3, which was upregulated at 1 h, 2 h, 4 h and 12 h, increasing by 2.93-, 1.81-, 1.44- and 1.23-fold, respectively; DcitCYP301a2 was upregulated at 1 h, 2 h, 12 h and 24 h, increasing by 2.95-, 1.31-, 1.31- and 1.14-fold, respectively ( Figure 4 EH).

[0150] In LC 70 Under the treatment of thiamethoxam with different doses, the four P450 genes were upregulated to varying degrees at each time point compared with the control group. The expression of DcitCYP6K3 was significantly upregulated by 3.70 times, 6.09 times, 3.61 times, 1.22 times and 1.39 times at 1h, 2h, 4h, 12h and 24h, respectively; the expression of DcitCYP4V1 was significantly upregulated by 1.26 times, 2.34 times, 4.29 times, 1.26 times and 1.50 times at 1h, 2h, 4h, 12h and 24h, respectively; The expression of citCYP15A4 was significantly upregulated by 3.70-fold, 2.50-fold, 3.00-fold, 1.22-fold and 1.45-fold at 1h, 2h, 4h, 12h and 24h, respectively; the expression of DcitCYP301a2 was significantly upregulated by 4.80-fold, 4.09-fold, 2.35-fold, 1.48-fold and 1.42-fold at 1h, 2h, 4h, 12h and 24h, respectively. Figure 4 IL).

[0151] Example 5: Sensitivity to thiamethoxam after P450 gene silencing

[0152] 1 Materials and Reagents

[0153] 1.1 Insect sources for testing

[0154] The laboratory sensitive population (SS) and thiamethoxam-resistant population (THRS) are the same as those in Example 1.

[0155] 1.2 Main Reagents

[0156] 97% thiamethoxam powder (Liuzhou Huinong Chemical Co., Ltd., China);

[0157] ChamQ TM Universal qPCR Master Mix: Nanjing Novozymes (China);

[0158] HiScript III RT SuperMix for qPCR (+gDNAwiper): Nanjing Novogene (China);

[0159] III 1st Strand c DNA Synthesis Kit: Nanjing Novogene (China);

[0160] TranscriptAid T7 High Yield Transcription Kit: Thermo Fisher Scientific, USA.

[0161] 2 Methods

[0162] 2.1 Cloning of target gene and recovery of target fragment

[0163] Total RNA extraction from citrus psyllids: 20 citrus psyllids were collected and purified according to the ReliaPrep TM RNATissue MiniprepSystem RNA instructions for extracting total RNA.

[0164] Synthesis of the first-strand cDNA of Citrus psyllid: Using the extracted RNA as template, The III 1st Strand cDNA Synthesis Kit (+gDNAwiper) (vazyme) was used for reverse transcription synthesis of the first-strand cDNA of citrus psyllid.

[0165] Primer 6 software was used to design the primers for RNAi synthesis, and the enhanced green fluorescent protein eGFP gene (Genbank: CAA58789.1) was used as a control. After the design was completed, a T7 promoter sequence was added to the 5' end. The primer sequences are shown in Table 6.

[0166] Table 6 RNAi primer sequence information

[0167]

[0168] Using the synthesized cDNA as a template, 2×Phanta Max Master Mix (vazyme) was used for PCR reaction to amplify the target fragment. The following reaction mixture was added to the PCR tube:

[0169]

[0170] After centrifugation, perform the following reaction procedure on a PCR instrument:

[0171]

[0172] The reaction product was subjected to 1% agarose gel (with blue light dye added) electrophoresis, and the target DNA band was purified and recovered using FastPure GelDNAExtraction Mini Kit (Vazyme).

[0173] 2.2 Ligation and transformation of target fragment and vector

[0174] Bioxm v2.7 software was used to analyze the restriction sites of the four target genes. Combined with the restriction sites on the pCold II vector, the pCold II vector was double-digested with KpnI and PstI, and the following reaction mixture was added on ice:

[0175]

[0176] After the reaction, the reaction product was subjected to 1% agarose gel (adding blue light dye) electrophoresis detection (120V, 30min), and the target band was purified and recovered using FastPure Gel DNA Extraction Mini Kit (Vazyme). Referring to the instructions of ClonExpress Ultra One Step Cloning Kit V2 (C116) (Vazyme), a reaction mixture for connecting the vector and the target fragment was prepared on ice.

[0177] After the reaction is completed, the cells are immediately placed on ice for DH5α competent cell transformation.

[0178] 2.3 Recombinant plasmid detection

[0179] Pick 3-5 single colonies from the plate in 2.2 into a 1.5mL centrifuge tube containing 1mL LB medium and antibiotics, and take 2μL of it as a template for bacterial liquid PCR amplification detection. The remaining bacterial liquid is cultured at 37℃, 200rpm for 4-6h. After gel electrophoresis detection, if the bacterial liquid is positive, it will be sent to Chongqing Qingke Biotechnology for sequencing.

[0180] 2.4 Recombinant plasmid extraction

[0181] 100 μL of the bacterial solution with correct sequencing was taken and added to a 10 mL glass tube of culture medium (containing antibiotics) and cultured overnight at 37°C and 200 rpm. The plasmid was extracted using EndoFree Mini Plasmid Kit II.

[0182] 2.5 Synthesis and purification of dsRNA

[0183] The plasmid extracted in 2.4 was used as a template, and the PCR product was amplified with the primers in Table 6. After gel recovery, it was used as a template for dsRNA synthesis. The eGFP (Genbank: CAA58789.1) gene primers were used as a control, and the dsRNA was synthesized using the TranscriptAid T7 High Yield Transcription Kit.

[0184] The product obtained above was purified to obtain dsRNA, which was kept in a -80°C refrigerator for future use.

[0185] The dsRNA sequence of the DcitCYP6K3 gene is shown in the base sequence from 344 to 845 of the sequence shown in SEQ ID NO.25, the dsRNA sequence of the DcitCYP4V1 gene is shown in the base sequence from 1096 to 1523 of the sequence shown in SEQ ID NO.26, the dsRNA sequence of the DcitCYP15A4 gene is shown in the base sequence from 391 to 805 of the sequence shown in SEQ ID NO.27, and the dsRNA sequence of the DcitCYP301a2 gene is shown in the base sequence from 708 to 1206 of the sequence shown in SEQ ID NO.28.

[0186] 2.6 Feeding dsRNA

[0187] Film feeding was used to silence genes in adults of Psyllid citrus (Tang et al., 2021), as follows:

[0188] (1) Starvation treatment of citrus psyllids: aspirate citrus psyllids into an insect cage without Murraya aromatica (30×30×30 cm3) and place it in an incubator for 5-6 hours.

[0189] (2) Artificial feed preparation: Artificial feed contains 20% sucrose, 0.1% green food dye and 0.4% yellow food dye (Yu and Killiny, 2018).

[0190] (3) Preparation of feeding device: Cut the Parafilm into small pieces, then gently pull it to the thinnest (so that the mouthparts of citrus psyllids can pierce it), and spread it flat on one side of an acrylic tube (inner diameter 15mm, thickness 20mm, height 60mm). Use a pipette to drip 100μL of artificial feed mixed with dsRNA onto the membrane, and then wrap it with a layer of Parafilm so that the artificial feed is distributed on the surface of the tube mouth. Transfer 15 starved psyllids from the other side of the tube mouth into the tube, and stuff a sponge wrapped in black cloth into it. Add 150μL of sterile water to the sponge to keep it moist (Pan et al., 2024). Feed for 72h, and collect live insects to detect silencing efficiency and sensitivity to thiamethoxam. Feeding dseGFP was used as a control, and three biological replicates were set. Based on the preliminary experiment, the silencing efficiency was better when the dsRNA concentration was 1000ng / μL and fed for 72h.

[0191] 2.7 Silencing efficiency and insecticide sensitivity testing

[0192] Silencing efficiency detection: Live citrus psyllid adults in 2.6 were collected and those fed with dseGFP were used as controls. RNA was extracted and reverse transcribed into cDNA. RT-qPCR was performed to detect the expression level of the target gene to evaluate the effectiveness of RNAi.

[0193] Insecticide sensitivity test: live citrus psyllid adults in 2.6 were collected, and those fed with dseGFP were used as controls. The LC50 concentrations of the two populations were used as the test concentrations to determine the mortality rate of citrus psyllids after silencing of the target gene. The bioassay method was referred to Example 2.

[0194] 3 Results

[0195] 3.14 P450 gene silencing efficiency

[0196] To investigate the relationship between overexpressed DcitCYP6K3, DcitCYP4V1, DcitCYP15A4, and DcitCYP301a2 and thiamethoxam resistance, we silenced these genes using RNAi and then used thiamethoxam bioassay to evaluate the role of these genes in thiamethoxam resistance. 2O instead) and dseGFP treatment for 48h and 72h, there was no significant difference in the expression levels of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4 and DcitCYP301a2 ( Figure 5 ). After feeding the dsRNA corresponding to the four P450 genes, the four P450 genes can be effectively silenced. In addition, compared with the 48h feeding dsRNA treatment, the silencing efficiency of the 72h feeding treatment is better. After 48h of dsRNA silencing treatment, compared with the control fed with dseGFP, the expression levels of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4 and DcitCYP301a2 decreased significantly, down 34.44%, 26.75%, 20.32% and 22.38% respectively ( Figure 6 AD); After 72h of dsRNA silencing treatment, compared with the control fed with dseGFP, the expression levels of DcitCYP6K3, DcitCYP4V1, DcitCYP15A4 and DcitCYP301a2 decreased significantly, by 45.41%, 37.61%, 34.29% and 47.34%, respectively ( Figure 6 Therefore, the subsequent bioassay experiments used feeding dsRNA treatment for 72 h.

[0197] 3.2 Determination of sensitivity to thiamethoxam after P450 gene silencing

[0198] After feeding dsRNA to the two populations of citrus psyllids SS and THRS for 72 hours, active adults were collected to determine the sensitivity of citrus psyllids to thiamethoxam. The bioassay results showed that after silencing DcitCYP6K3, DcitCYP4V1, DcitCYP15A4 and DcitCYP301a2, the mortality of SS increased by 25.17%, 19.62%, 20.17% and 23.00% respectively compared with the control ( Figure 6 IL), and the mortality rates of THRS increased by 28.42%, 21.15%, 22.46%, and 26.15%, respectively ( Figure 6 MP). These results indicate that silencing of the four P450 genes increased the sensitivity of P. citri to thiamethoxam.

Claims

1. A molecular marker for thiamethoxam resistance in citrus psyllid, characterized in that: The molecular marker is any one or more combinations of the citrus psyllid cytochrome P450 genes shown in the following nucleotide sequences: The DcitCYP6K3 gene shown in SEQ ID NO.25, the DcitCYP4V1 gene shown in SEQ ID NO.26, the DcitCYP15A4 gene shown in SEQ ID NO.27, and the DcitCYP301a2 gene shown in SEQ ID NO.

28.

2. A primer pair for detecting the molecular marker according to claim 1, characterized in that: The primer sequences of the primer pairs are: the primer pair sequence for detecting the DcitCYP6K3 gene is shown as SEQ ID NO.1 and SEQ ID NO.2, the primer pair sequence for detecting the DcitCYP4V1 gene is shown as SEQ ID NO.5 and SEQ ID NO.6, the primer pair sequence for detecting the DcitCYP15A4 gene is shown as SEQ ID NO.13 and SEQ ID NO.14, and the primer pair sequence for detecting the DcitCYP301a2 gene is shown as SEQ ID NO.3 and SEQ ID NO.

4.

3. Use of the molecular marker according to claim 1 in the classification of citrus psyllid populations sensitive to thiamethoxam and populations resistant to thiamethoxam.

4. The use according to claim 3, characterized in that: The expression level of the molecular marker gene described in claim 1 is detected for the citrus psyllid to be tested. If the expression level of the molecular marker gene of the citrus psyllid to be tested is significantly higher than the gene expression level of the sensitive population, it can be determined that the citrus psyllid to be tested is resistant to thiamethoxam; if there is no significant difference in the expression level of the molecular marker gene between the citrus psyllid to be tested and the sensitive population, it cannot be determined that the citrus psyllid to be tested is resistant to thiamethoxam.

5. A method for detecting a molecular marker according to claim 1, characterized in that: Taking the citrus psyllid sensitive population to the pesticide as a control, the expression level of the molecular marker gene described in claim 1 is detected for the citrus psyllid to be tested. If the expression level of the molecular marker gene of the citrus psyllid to be tested is significantly higher than that of the sensitive population, it can be determined that the citrus psyllid to be tested is resistant to thiamethoxam; if there is no significant difference in the expression level of the molecular marker gene between the citrus psyllid to be tested and the sensitive population, it cannot be determined that the citrus psyllid to be tested is resistant to thiamethoxam.

6. The method according to claim 5, characterized in that: The method comprises the following steps: extracting total RNA of the citrus psyllid to be tested, reversing it into cDNA, performing qPCR amplification with the cDNA as a template, taking a sensitive population as a control, determining the expression level of the molecular marker gene in the tested object, and when the expression level of the molecular marker gene in the tested object is significantly higher than that in the sensitive population, it can be determined that the citrus psyllid to be tested is resistant to thiamethoxam.

7. The method according to claim 6, characterized in that: The primer pair according to claim 2 is used for qPCR amplification.

8. The method according to claim 7, characterized in that: The qPCR amplification reaction system was: 2×ChamQ Universal SYBR qPCR Master Mix 10 μL, 1 μL each of the forward and reverse primers at a concentration of 10 μM, 4 μL of cDNA template, supplemented with ddH O to 20 μL; The qPCR amplification conditions were: pre-denaturation at 95°C for 3 min; then denaturation at 95°C for 10 sec, annealing at 55°C for 30 sec, and 40 cycles.

9. A dsRNA that interferes with the molecular marker gene of claim 1, characterized in that: The dsRNA sequence of the DcitCYP6K3 gene is shown in the base sequence from 344 to 845 of the sequence shown in SEQ ID NO.25, the dsRNA sequence of the DcitCYP4V1 gene is shown in the base sequence from 1096 to 1523 of the sequence shown in SEQ ID NO.26, the dsRNA sequence of the DcitCYP15A4 gene is shown in the base sequence from 391 to 805 of the sequence shown in SEQ ID NO.27, and the dsRNA sequence of the DcitCYP301a2 gene is shown in the base sequence from 708 to 1206 of the sequence shown in SEQ ID NO.

28.

10. Any of the following uses of the dsRNA according to claim 9: 1) Use in inhibiting the expression of the molecular marker gene or preparing a product for inhibiting the expression of the molecular marker gene; 2) Use in increasing the sensitivity of citrus psyllid to thiamethoxam or in preparing a product that increases the sensitivity of citrus psyllid to thiamethoxam; 3) Use of thiamethoxam in increasing the control effect of thiamethoxam on citrus psyllids or in preparing products that increase the control effect of thiamethoxam on citrus psyllids.

Images