Specific marker closely related to regeneration efficiency of dental pulp and dentin complex and application of specific marker

Abstract

The invention provides a specific marker closely related to regeneration efficiency of a dental pulp and dentin complex and application of the specific marker. The specific marker comprises an NKD1 gene and / or an expression product of the NKD1 gene. According to the invention, single cell transcriptome sequencing is combined with a bioinformatics analysis method to analyze the differentiation process of the Wnt3a-treated mesenchymal stem cells, and the result shows that the specificity of the NKD1 gene in a subgroup with a tooth generation function is up-regulated, and the subgroup is named as an NKD1 + subgroup. Further experiments prove that the NKD1 < + > subgroup has obvious dental differentiation capability, that is, the NKD1 gene can be used as a specific marker of the subgroup with high regeneration efficiency in DPSCs, and has important application value in detection of the regeneration efficiency of the dental pulp and dentin complex.

Description

Technical Field

[0001] The present invention relates to the field of stem cell therapy, and in particular, to a specific marker closely related to the regeneration efficiency of dental pulp dentin complex and an application thereof. Background Art

[0002] The pulp-dentin complex maintains tooth vitality through reparative dentin formation, stress response, and homeostatic regulation. Loss of the complex's function (such as irreversible pulpitis) often leads to tooth fracture after root canal treatment, which requires extraction. Therefore, functional regeneration of the pulp-dentin complex is a key strategy for long-term tooth preservation. As the core functional cell of the complex, odontoblasts directly determine the efficiency of reparative dentinogenesis, and the mechanism of odontogenic differentiation has become an important focus of dental regenerative medicine.

[0003] In the past decade, a variety of mesenchymal stem cells have been reported to differentiate into odontoblasts, including dental pulp stem cells (DPSCs), stem cells from human exfoliated deciduous teeth (SHEDs), and stem cells from the apical papilla (SCAPs) for regeneration of the dental pulp-dentin complex. However, new evidence suggests that transplanted stem cells primarily generate disorganized bone-like tissue lacking polarized odontoblast layers and tubular dentin structures. These findings underscore the inadequacy of stem cell transplantation alone and highlight the need for targeted signal activation to drive DPSC differentiation and functional regeneration.

[0004] CN105228557A proposed to use Wnt3a protein to activate DPSCs to promote dentin regeneration. It injected alginate hydrogel material containing 10ng / ml Wnt3a into the dental pulp cavity, which stimulated pulp and dentin regeneration after 4 weeks, but did not distinguish stem cell subpopulations, resulting in fluctuations in regeneration efficiency and the lack of typical tubular structures in the regenerated tissue. CN115161272A proposed to use 50ng / ml Wnt10a to promote DPSCs alkaline phosphatase and alizarin red staining enhancement, but did not perform Western Blotting experiments to detect changes in the expression of odontogenic differentiation-related proteins or other sequencing methods to verify the activation of odontogenic differentiation-related signals, so it is impossible to clarify the fate of stem cells to initiate odontogenic differentiation.

[0005] The Wnt / β-catenin pathway plays a key regulatory role in the initiation, morphogenesis, and dentinogenesis of odontogenesis. Our previous studies have shown that local delivery of Wnt3a in the root canals of piglets can activate canonical Wnt signaling, promote the homing of endogenous SCAPs and functional regeneration of the pulp-dentin complex, characterized by a polarized odontoblast layer, tubular dentin, and remodeling of the neurovascular network. Although these findings establish the indispensability of canonical Wnt signaling in dental pulp regeneration, the mechanisms of how different stem cell subsets recognize, transduce Wnt signals, and execute reparative dentinogenesis remain unresolved. Accumulating evidence suggests that only a small subset of stem cells drives tissue regeneration. For example, a recent study identified Krt14, a stem cell with dual epithelial-mesenchymal properties. + Ctsk + Osteogenic precursor cell population as a determinant of induced bone formation in maxillary sinus floor augmentation.

[0006] Therefore, there is an urgent need in this field to address issues such as fluctuations in efficacy and structural abnormalities caused by failure to identify subpopulations with high regenerative potential. Summary of the invention

[0007] In view of the shortcomings of the prior art, the purpose of the present invention is to provide a specific marker closely related to the regeneration of the dental pulp-dentin complex and its application. The specific marker is a specific gene in mesenchymal stem cells, which can identify and screen out dental pulp stem cell subpopulations that can efficiently form reparative dentin, thereby solving the fluctuations in efficacy caused by cell heterogeneity in the prior art.

[0008] To achieve this object, the present invention adopts the following technical solutions: In a first aspect, the present invention provides a specific marker closely related to the regeneration efficiency of the dental pulp-dentin complex, wherein the specific marker includes the NKD1 gene and / or the expression product of the NKD1 gene in mesenchymal stem cells, wherein the mesenchymal stem cells are the core cells that promote the regeneration of the dental pulp-dentin complex.

[0009] The NKD1 gene is a specific gene expressed during the regeneration process of mesenchymal stem cells.

[0010] The present invention combines bioinformatics methods to analyze the highly odontogenic differentiation subpopulations of mesenchymal stem cells after odontogenic induction. Taking dental pulp stem cells (DPSCs) as an example, after differential expression analysis, it was found that a previously uncharacterized Nkd1 gene was identified in DPSCs induced by the Wnt3a group. + On this basis, it can be further inferred that NKD1 may be expressed in other odontoblast-derived mesenchymal stem cells that can differentiate into odontoblasts, such as stem cells from human deciduous teeth or stem cells from the apical papilla.+ Stem cell subpopulations with high expression also have good regenerative ability.

[0011] Therefore, NKD1 gene can be used as a specific marker of mesenchymal stem cell subpopulation with the function of differentiating into odontoblasts.

[0012] In a second aspect, the present invention provides the use of NKD1 gene as a specific marker in detecting the regeneration efficiency of dental pulp-dentin complex, and the use does not involve the diagnosis and treatment of diseases.

[0013] In the present invention, the NKD1 gene is a specific gene in mesenchymal stem cells, and the mesenchymal stem cells can be used to prepare or regenerate dental pulp-dentin complex.

[0014] As a preferred technical solution of the present invention, the mesenchymal stem cells include any one of dental pulp stem cells, stem cells from human deciduous teeth, or stem cells from apical papilla, or a combination of at least two of them.

[0015] As a preferred technical solution of the present invention, the application includes preparing a kit for detecting the regeneration efficiency of dental pulp-dentin complex.

[0016] As a preferred technical solution of the present invention, the kit includes a detection reagent for the NKD1 gene.

[0017] As a preferred technical solution of the present invention, the specific marker used in the application also includes any one or a combination of at least two of the LEPR gene and / or the expression product of the LEPR gene, the DSPP gene, the DMP1 gene, the Ki67 gene or the MSX1 transcription factor.

[0018] In the present invention, in addition to discovering that the NKD1 gene can be used as a specific marker, multiple immunofluorescence analysis of human dental pulp tissue showed that LEPR is also a marker of NKD1. + The specific markers of the subpopulations and the characteristic gene display of the single-cell transcriptome samples also showed that the distribution of LEPR and NKD1 was similar. Therefore, the present invention also includes the use of NKD1 and LEPR co-marking for screening mesenchymal stem cells with high regenerative ability.

[0019] In a third aspect, the present invention also provides a method for preparing a dental pulp-dentin complex with high regeneration efficiency, the method comprising screening a cell subpopulation that specifically expresses the NKD1 gene.

[0020] As a preferred technical solution of the present invention, the method comprises: treating dental mesenchymal stem cells with an odontogenic induction agent, detecting them with an NKD1 gene detection reagent, screening out a cell subpopulation that specifically expresses the NKD1 gene, and then efficiently regenerating the dental pulp-dentin complex.

[0021] The high efficiency mentioned in the present invention means that after screening out the cell subpopulation that specifically expresses the NKD1 gene, odontoblasts can be efficiently formed. The formation of odontoblasts plays a core role in the regeneration process of the pulp-dentin complex. Therefore, detecting the NKD1 gene can help prepare a pulp-dentin complex with high regeneration efficiency.

[0022] As a preferred technical solution of the present invention, the method also includes a cell subpopulation that specifically expresses the LEPR gene at the same time.

[0023] Preferably, the odontogenesis inducing agent comprises Wnt3a or a small molecule activator of Wnt signaling.

[0024] Preferably, the small molecule activator of Wnt signaling includes CHIR99021, LiCl, R-spondin, BIO or AZD2858.

[0025] The present invention utilizes Wnt3a, Wnt5a and Wnt10a groups to induce DPSCs respectively, and the comparison results confirm the strong tooth-forming induction ability of Wnt3a.

[0026] Preferably, the odontogenesis inducing agent is Wnt3a.

[0027] In a fourth aspect, the present invention also includes a dental pulp-dentin complex prepared by the method described in the third aspect.

[0028] Compared with the prior art, the present invention has the following beneficial effects: The present invention first discovered that the NKD1 gene can be used as a specific marker for the high regeneration subpopulation of mesenchymal stem cells, and the target cell ratio can reach more than 50%. In other words, the NKD1 gene can play a screening role in the process of preparing the pulp-dentin complex, screening out mesenchymal stem cells with high regeneration efficiency, and then regenerating the pulp-dentin complex with better functions, so as to achieve the purpose of long-term preservation of teeth.

[0029] Meanwhile, Wnt3a-induced Nkd1 + Odontoblasts, as key drivers of functional pulp dentin regeneration, provide mechanistic insights and therapeutic targets for clinical translation. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 These are the results of ALP staining and ARS staining of DPSCs in each group.

[0031] Figure 2 This is a comparison chart of the expression levels of DSPP and DMP-1 in each group in the Western blotting experiment.

[0032] Figure 3Diagram of the sample processing and bioinformatics analysis steps.

[0033] Figure 4 This is the overall Umap diagram of single-cell transcriptome data of the control, Wnt3a, Wnt5a and Wnt10a groups.

[0034] Figure 5 This is the result of GO enrichment analysis of differentially expressed genes in the Wnt3a, Wnt5a and Wnt10a groups.

[0035] Figure 6 Umap diagram of cell transcriptome data clustering for control, Wnt3a, Wnt5a and Wnt10a groups.

[0036] Figure 7 This is the result of GO enrichment analysis of up-regulated genes in subgroup 3.

[0037] Figure 8 This is the characteristic diagram of the differentially expressed gene NKD1 in subgroup 3.

[0038] Fig. 9 NKD1 + Heat map of transcription factor regulatory network between subgroups and control group.

[0039] Fig.10 Immunofluorescence analysis of NKD1 in fully developed human molar sections + Subpopulation distribution results.

[0040] Fig.11 NKD1 in the Wnt3a group and the control group in Example 4 + Immunofluorescence results of subpopulation distribution.

[0041] Fig.12 Flow cytometry analysis of NKD1 in the Wnt3a group and the control group + Subgroup comparison chart.

[0042] Fig.13 Immunofluorescence analysis of NKD1 in developing human molar sections + Subpopulation distribution results.

[0043] Fig.14 The results of in situ hybridization analysis of NKD1 and DSPP mRNA signals in fully developed human molar sections. DETAILED DESCRIPTION

[0044] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and through specific implementation methods. However, the following examples are only simple examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0045] In the following examples, unless otherwise specified, all reagents and consumables used were purchased from conventional reagent manufacturers in the field; unless otherwise specified, all experimental methods and technical means used were conventional methods and means in the field.

[0046] Example 1 Cell culture Human dental pulp stem cells (hDPSCs) were isolated from wisdom teeth of healthy donors aged 18 to 25 years, following a protocol approved by the Ethics Committee of Capital Medical University. Cells were cultured in α-MEM (Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco), 100 U / mL penicillin, and 100 mg / mL streptomycin (Gibco) at 37°C and 5% CO2. To induce odontogenesis, cells were cultured in odontogenic differentiation medium (ODM: complete growth medium supplemented with 50 mg / L ascorbic acid, 10 mmol / L β-glycerophosphate, and 100 nmol / L dexamethasone).

[0047] The experimental groups used ODM supplemented with 50 ng / mL recombinant human Wnt3a (R&D Systems, 5036-WN-010), Wnt5a (Abcam, ab204627), or Wnt10a (Abcam, ab289784).

[0048] The blank control group was treated with odontogenesis induction medium only.

[0049] The cells in the experimental and control groups were subjected to staining experiments, Western blotting experiments and bioinformatics analysis.

[0050] Example 2 Staining experiment and Western blotting experiment This example includes staining experiments of induced DPSCs using alkaline phosphatase (ALP) and Alizarin Red S (ARS) and Western blotting experiments.

[0051] (1) Dyeing To evaluate odontoblastic differentiation, ALP activity and calcium deposition were analyzed using an alkaline phosphatase assay kit (Beyotime) and Alizarin Red S solution (Cyagen), respectively. DPSCs treated for 7 and 21 days were subjected to ALP staining and ARS staining.

[0052] like Figure 1 The results showed that ALP activity and calcium nodule formation were significantly enhanced in the Wnt3a group. ALP staining was slightly increased in the Wnt5a and Wnt10a groups compared with the control group, while ARS staining showed no significant difference.

[0053] (2) Western blotting Total cell proteins were extracted using RIPA lysis buffer with protease inhibitors (Beyotime) and 1 mM PMSF. Protein samples (10 μg) were separated on 4-20% SurePAGE™ precast gels (GenScript) and transferred to PVDF membranes (Millipore). The membranes were blocked with QuickBlock™ Western blocking buffer for 15 minutes at room temperature and then incubated at 4°C with specific markers DSPP (sc-73632, 1:200, Santa Cruz), DMP-1 (sc-73633, 1:200, SantaCruz).

[0054] Subsequently, the membrane was incubated with HRP-labeled secondary antibodies (goat anti-rabbit IgG, HA1001, 1:50,000, HUABIO; goat anti-mouse IgG, HA1006, 1:20,000, HUABIO) for 1 h and visualized using an ECL chemiluminescence kit (Beyotime).

[0055] like Figure 2 As shown, the expression levels of odontocyte differentiation-related proteins (such as DSPP and DMP1) were significantly increased in Wnt3a-treated cells.

[0056] Example 3 Bioinformatics Analysis This example combines bioinformatics methods to analyze differentially expressed genes related to odontogenic differentiation after DPSC induction. Figure 3 As shown, the steps of this embodiment include: step S1, sample preparation and single-cell RNA sequencing; step S2, data processing; step S3, bioinformatics analysis; specifically including: step S31, dimensionality reduction and clustering; step S32, differential expression analysis; step S33, data visualization; step S34, regulatory network analysis.

[0057] The specific steps are as follows: S1. Sample preparation and single-cell RNA sequencing (scRNA-seq) At approximately 40-50% confluence, DPSCs were treated with ODM supplemented with Wnt ligands for 7 days (medium was refreshed every 48 h). Single-cell suspensions were prepared by enzymatic dissociation, and cell viability exceeded 85% (confirmed using Countstar automated cell counter). scRNA-seq libraries were constructed and sequenced using the 10x Genomics Chromium system.

[0058] S2. Data Processing The raw FASTQ files were aligned to the GRCh38 human reference genome (10xGenomics, refdata-gex-GRCh38-2020-A) using Cell Ranger v6.1.2. Gene expression matrices were generated using DNBC4tools and subsequently filtered for quality control (detected genes: 1,000-9,000; UMI counts: 600-80,000; mitochondrial gene proportion ≤10%; hemoglobin gene proportion ≤25%).

[0059] The final cell numbers in each group were: control group (11,363), Wnt3a group (10,938), Wnt5a group (8,875), and Wnt10a group (9,149).

[0060] S3. Bioinformatics analysis S31, Dimensionality reduction and clustering: Seurat v3.2 was used for data integration, PCA-based dimensionality reduction, and graph-based clustering (resolution = 0.6), optimized using the shared nearest neighbor (SNN) module. Cell clusters were visualized using UMAP.

[0061] The overall analysis of single-cell transcriptome data showed that Figure 4 As shown, the UMAP distribution in the Wnt3a group changed significantly.

[0062] S32. Differential expression analysis: Seurat's FindMarkers function was used to identify differentially expressed genes (DEGs) between clusters (Wilcoxon rank sum test; threshold: expressed in ≥25% of cells, |log2FC|>0.25). Gene Ontology (GO) enrichment analysis was performed using clusterProfiler (adjusted p<0.05).

[0063] S33. Data visualization: Visualizing gene expression patterns using FeaturePlot (UMAP embedding).

[0064] like Figure 5 As shown in Figure 2, GO enrichment analysis of differentially expressed genes between the Wnt3a group and other samples revealed that upregulated genes were associated with key biological processes, such as the Wnt signaling pathway, extracellular matrix organization, mesenchymal cell differentiation, and tooth formation. In contrast, GO enrichment analysis of the Wnt5a and Wnt10a groups did not reveal biological processes associated with odontogenic differentiation.

[0065] In this example, 10 major cell clusters were identified from four samples, and statistical analysis showed that a unique subpopulation 3 was significantly induced by wnt3a, accounting for 44% ( Figure 6). GO enrichment analysis of up-regulated genes in subgroup 3 highlighted processes such as extracellular matrix organization and tooth formation, indicating that this subgroup has a tooth-forming function ( Figure 7 ).

[0066] In order to describe the unique characteristics of this subgroup, this example plotted a characteristic map of differentially expressed genes and found that NKD1 was specifically upregulated in subgroup 3, thus naming this subgroup NKD1. + Subgroups ( Figure 8 ).

[0067] S34. Regulatory network analysis: Analysis of NKD1 using SCENIC v1.3.1 + Transcription factor regulatory networks of cell populations during odontogenesis.

[0068] SCENIC analysis results show that MSX1 plays a key role in NKD1 + The most active transcription factor in the subpopulation ( Fig. 9 ), suggesting that it plays a key role in odontogenic function. This finding was further confirmed by immunohistochemical analysis of human molar sections, showing that NKD1 + MSX1 is specifically expressed in subpopulations ( Fig.10 ).

[0069] Example 4 Fluorescent immunostaining This example further verified the NKD1 by fluorescent immunostaining. + Distribution of subpopulations in human teeth.

[0070] 1. Organizational preparation All animal experimental procedures were approved by the Animal Ethics Committee of Capital Medical University. Samples were fixed with 4% paraformaldehyde (PFA) at 4°C for 24 h. Decalcification was performed in 10% ethylenediaminetetraacetic acid (EDTA, pH 7.4) for 60 days for human tooth samples. After dehydration through an ethanol gradient, tissues were embedded in paraffin and sectioned longitudinally (5 μm thickness).

[0071] 2. Immunofluorescence Deparaffinized sections were antigen retrieved and treated with 3% H2O2 in methanol for 15 min to inhibit endogenous peroxidase activity. Then, sections were blocked with goat serum for 1 h at room temperature.

[0072] Primary antibodies were incubated overnight at 4°C and included DSPP (sc-73632, 1:50, Santa Cruz), NKD1 (orb577992, 1:50, Biorbyt), and Ki67 (ab15580, 1:200, Abcam).

[0073] Secondary antibodies, including FITC-labeled antibodies (HA1004, HA1126, 1:500, HUABIO), iFluor™ 594-labeled antibodies (HA1122, HA1003, 1:500, HUABIO), and iFluor™ 647-labeled antibodies (HA1123, HA1127, 1:500, HUABIO), were incubated for 1 h.

[0074] Sections were mounted using Fluoroshield™ blocking medium (Sigma) containing DAPI, and colocalization analysis of fluorescent signals was performed using a Nikon microscope equipped with NIS-Element imaging software.

[0075] 3. In situ hybridization Fresh third molars were fixed in a dedicated animal in situ hybridization fixative at 4°C overnight. The samples were decalcified, dehydrated, and embedded in paraffin.

[0076] 5 μm thick sections were prepared for in situ hybridization. Sections were treated with proteinase K (20 μg / ml) at 40°C to enhance probe penetration. Prehybridization was performed at 40°C for 1 hour to ensure optimal probe binding. Afterwards, hybridization with primary probe was performed at 40°C overnight.

[0077] To amplify the signal, sections were hybridized for 45 min at 40°C for branching probes and 3 h at 1:200 dilution for signaling probes. Stringent washing was performed using an SSC buffer gradient (2× SSC to 0.1× SSC) at 40°C to minimize nonspecific binding. Counterstaining with DAPI for 8 min was followed by mounting with antifading medium to preserve fluorescence.

[0078] The probe modification group used by DSPP is Cyanine3, and the specific sequence (SEQ ID NO.1) is: CATGCACCAGGACACCACTTTCTTTGCATCGGAATTATCCAGGCCAGCATCTTTGGCTCTTCCCAACAGCATGTGTCTTCTCCTCGGCTACTGCTGTTATTGTCGTGGTTACTGTCACTGCCTTCACTGT The probe modification group used for NKD1 is Alexa Fluor 488, and the specific sequence (SEQ ID NO. 2) is: GTGACCTTGCCGTTGTTGTCAAAGTCCTTTACCCGCAGCATCTTGCTGGATGTTTCTCCTCTCGATGTTCTCATCTACGCGTTGCTGGAGCTCTGAGACCTTGG.

[0079] Multiple immunofluorescence results of cell samples showed (e.g. Fig.11 ), which was significantly enriched in the Wnt3a group and highly expressed NKD1 + The cells highly expressed both DSPP and DMP1. Only a small amount of NKD1 was detected in the control group. + cells, the expression levels of DSPP and DMP1 were low.

[0080] In addition, flow cytometry analysis was used to confirm the existence and proportion of this subpopulation, showing that 51.13%±2.45% of the cells in the Wnt3a group were NKD1 + and DSPP + , which was significantly higher than that of the control group (7.92%±1.54%) (P<0.001). A similar trend was also observed in the flow cytometry co-labeling experiment of NKD1 and DMP1 ( Fig.12 ).

[0081] Furthermore, multiplex immunofluorescence imaging of human molar sections revealed that NKD1 is expressed in fully developed teeth. + The subpopulations had a conserved spatial distribution across anatomical regions (apex / neck / root) within the odontoblast layer and these cells showed co-expression of dentin markers: DSPP and Ki67 ( Fig.13 ), defining their secretory activity status. In situ hybridization further confirmed the spatial consistency of NKD1 and DSPP mRNA signals along the odontogenic layer ( Fig.14 ).

[0082] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention are within the protection scope and disclosure scope of the present invention.

Claims

1. The use of NKD1 gene as a specific marker in detecting the regeneration efficiency of dental pulp-dentin complex, characterized in that: The NKD1 gene is a specific gene in mesenchymal stem cells, and the mesenchymal stem cells are used to prepare the dental pulp-dentin complex.

2. The use according to claim 1, characterized in that: The mesenchymal stem cells include any one of dental pulp stem cells, stem cells from human deciduous teeth, or stem cells from apical papilla, or a combination of at least two of them.

3. The use according to claim 1, characterized in that: The application includes preparing a kit for detecting the regeneration efficiency of dental pulp-dentin complex.

4. The use according to claim 3, characterized in that: The kit comprises a detection reagent for the NKD1 gene.

5. The use according to claim 1, characterized in that: The specific markers used in the application also include any one or a combination of at least two of the DSPP gene, the DMP1 gene, the Ki67 gene, the MSX1 transcription factor, the LEPR gene or the expression products of the LEPR gene.

6. A method for preparing a dental pulp-dentin complex with high regeneration efficiency, characterized in that: The method comprises screening a cell subpopulation that specifically expresses the NKD1 gene.

7. The method according to claim 6, characterized in that The method comprises: After the mesenchymal stem cells used in the regeneration of the pulp-dentin complex were treated with an odontogenic induction agent, the NKD1 gene detection reagent was used to screen out the cell subpopulation that specifically expressed the NKD1 gene, thereby regenerating the pulp-dentin complex.

8. The method according to claim 7, characterized in that The odontogenic inducing agent includes Wnt3a or a Wnt signaling small molecule activator; The Wnt signaling small molecule activator includes CHIR99021, LiCl, R-spondin, BIO or AZD2858.

9. A dental pulp-dentin complex prepared by the method according to any one of claims 6 to 8.

Images