Kit and method for detecting lyme disease spirochete

Abstract

The invention relates to a kit for detecting lyme disease spirochetes and a detection method of the lyme disease spirochetes. The kit comprises the following primers and probes: 5 to 23S-1F, GGTCAAATAATAAGAGTCTA5-23S-1R, another purpose of the invention is to provide application of the primer probe combination in preparation of a kit for detecting lyme disease spirochetes and / or genotypes. Another purpose of the invention is to provide a kit for lyme disease spirochete detection. The kit comprises the primer and probe combination.

Description

Technical Field

[0001] The invention belongs to the field of medicine and biology, and relates to a virus detection test, and in particular to a kit and a method for detecting Lyme disease spirochetes. Background Art

[0002] Lyme disease, caused by Borrelia burgdorferi, is a natural epidemic disease with ticks as the vector. Ticks often parasitize on rats in the wild. Lyme disease is mainly transmitted by ticks infected with Borrelia burgdorferi biting human or animal skin. Its natural epidemic foci are mainly located in the United States, Europe and Asia. It has been confirmed that Lyme disease is distributed in more than 30 provinces (autonomous regions and municipalities) in my country. In the north, it is mainly in Heilongjiang, Jilin, Xinjiang, Inner Mongolia, Henan Province (autonomous region), etc., and in the south, it is mainly in Sichuan, Guizhou, Jiangxi and Yunnan Province. In 1985, my country first discovered a case of Lyme disease in the forest area of ​​Heilongjiang Province. Neurological damage is the most common clinical manifestation of the disease. Meningitis, encephalitis, cranial neuritis, motor and sensory neuritis are the most common neurological damage. In the first stage of Lyme disease, antibiotics alone can be effective, but antibiotics are useless in the second and third stages, especially for neurological damage, which lacks specific treatment. The early stage is characterized by chronic migratory erythema of the skin, followed by neurological, cardiac or joint lesions. It usually occurs in summer and early autumn and can occur at any age, with slightly more cases in men than in women. The disease is more common in young and middle-aged people, and is closely related to occupation. Field workers and forestry workers have a higher infection rate. Lyme disease is closely related to rodents, ticks and humans, which easily forms a natural cycle of the disease.

[0003] The existing detection of Borrelia burgdorferi is mainly carried out from three aspects: pathogen isolation and culture, serological immunology, and nucleic acid detection. Isolation and culture to obtain pathogens is the "gold standard" for the diagnosis of Lyme disease. This method is time-consuming (14 days of culture), has harsh culture conditions (BSK complete medium), and has a low separation rate. It is gradually replaced by other methods in clinical testing. Commonly used serological tests include indirect immunofluorescence test (IFA), enzyme-linked immunosorbent assay (ELISA), immunoblot test (Western Blot, WB), etc., but due to the complex structure of Borrelia burgdorferi antigens, their sensitivity and sensitivity are not high. Molecular biological detection methods mainly include basic PCR, fluorescence quantitative PCR, and nested PCR. Compared with serological tests, molecular biological PCR methods are simple, fast, sensitive, and specific, but ordinary PCR methods can only perform qualitative detection, not quantitative detection; although the fluorescence quantitative PCR method can perform quantitative detection, its analysis results are heavily dependent on the cycle threshold (Ct value) and cannot accurately detect low-abundance samples. Summary of the invention

[0004] The object of the present invention is to provide a primer and probe combination for detecting Lyme disease spirochetes and / or genotyping.

[0005] The genotyping described in the present invention is for genes such as 16S rRNA, OspA, flaB, 5S-23S, etc.

[0006] The primer and probe combination for detecting Lyme disease spirochetes and / or genotyping of the present invention comprises the following primers and probes:

[0007]

[0008]

[0009] Preferably, the primer and probe combination for detecting Lyme disease spirochetes and / or genotyping of the present invention comprises the following primers and probes:

[0010] 5-23S-1F:GGTCAAAGTAATAAGAGTCTA

[0011] 5-23S-1R:TTGGGATCAATAAATGTTTG

[0012] 5-23S-1P:CGCAGCTTACCACGACCTTC

[0013] OspA-4F: ATATTTTATTGGGAATAGGTCTAATAT

[0014] OspA-4R: CTTTTGTCTTTTTCTTTRCTTACAAGOspA-4p: AAGCAAAATGTTAGCAGCCTTGA.

[0015] Another object of the present invention is to provide the use of the primer-probe combination in the preparation of a kit for detecting Lyme disease spirochetes and / or genotyping.

[0016] Another object of the present invention is to provide a kit for detecting Lyme disease spirochetes, comprising the primer and probe combination.

[0017] Another object of the present invention is to provide a PCR reagent for detecting Lyme disease spirochetes, wherein the PCR reagent comprises the primer and probe combination.

[0018] Specifically, the PCR reagent of the present invention comprises the following components:

[0019]

[0020] in:

[0021] Please avoid unclear statements to avoid ambiguity regarding whether the following ingredients are known products and whether they can be purchased on the market. The principle is that a person skilled in the art should be able to reproduce the reagent.

[0022] PerfeCTa Multiplex qPCR ToughMix refers to: a multiplex qPCR reaction premix. Fluorescein sodium salt refers to: reference fluorescent sodium salt.

[0023] OspA primer probe premix refers to: a primer probe premix for detecting the OspA gene of Borrelia burgdorferi.

[0024] The 5-23S primer-probe premix refers to a primer-probe mixture for detecting the 5S-23SrRNA gene spacer region of Borrelia burgdorferi.

[0025] β_actin primer probe premix refers to: primer probe mixture for animal-derived gene β-actin detection.

[0026] DNA refers to: nucleic acid of the sample to be tested.

[0027] The PCR reagent of the present invention has the following working conditions:

[0028]

[0029] In this study, a digital PCR typing detection technology for Borrelia burgdorferi was established, which is divided into four steps: first, the design of primer probes for Lyme disease spirochetes, specific primers for genes such as 16S rRNA, OspA, flaB, 5S-23S, and multiple sets of primers for each target gene were designed, and the specificity was verified by dye-based qPCR to select primers for subsequent experiments; then, the corresponding probes were designed based on the selected primers, and the primer-probe combination specificity was verified and the conditions were optimized, and the specificity was tested using known positive and negative samples; then the digital PCR method system was designed, including triple probe combination verification and condition optimization such as single, double and triple combination interference verification, copy number concentration comparison verification; finally, about 50 unknown samples were tested.

[0030] Another object of the present invention is to provide a method for detecting and / or genotyping Lyme disease spirochetes, which is used for non-disease diagnosis purposes, comprising the following steps:

[0031] (1) Extracting DNA from the sample to be tested. The extraction method belongs to the prior art. A commercial extraction kit is used to extract DNA from tissues, cells or blood samples and the DNA is stored at -80°C for future use.

[0032] (2) The specific primers and fluorescent probe sequences used for detection are as follows:

[0033]

[0034]

[0035] The composition and preparation method of the reaction system are as follows:

[0036] Reagent name Add volume (μL) 1× PerfeCTa Multiplex qPCR ToughMix 5 Fluorescein sodium salt 2.5 OspA Primer Probe Premix 1 5-23S Primer Probe Premix 1 β_actin primer probe premix 1 <![CDATA[DNA sample to be tested and H2O]]> 14.5 Total volume 25

[0037] (3) After the above system is prepared, add 25 μL to each well of the Sapphire Chip and place the chip in the Crystal Digital PCR System for PCR amplification. The reaction conditions are as follows:

[0038]

[0039] (4) After the PCR reaction is completed, the chip is taken out and placed in the NaicaTM prism droplet reading and analysis system to scan the chip and analyze the data.

[0040] What are the beneficial effects of the detection method or kit of the present invention compared with the existing methods:

[0041] The digital PCR technology used in the present invention does not rely on standard curves and amplification cycle thresholds, can directly detect nucleic acids quantitatively, and is an endpoint detection. To a certain extent, amplification will not cause quantitative bias, and is more tolerant to PCR inhibitors, which has great advantages in improving the accuracy and variability of quantitative analysis; for samples with extremely low nucleic acid content, the detection sensitivity is higher; and through droplet reading and data analysis software, droplet quality control can be visualized. Compared with the RT-PCR method, it is easier to judge and eliminate false positives, thereby improving the accuracy of detection.

[0042] Further explanation of the terms appearing in the manual:

[0043] Sapphire Chip: Sapphire chip, a digital PCR chip with built-in oil phase

[0044] Crystal Digital PCR System: Fully automated microdroplet chip digital PCR system

[0045] NaicaTM prism: droplet reading and analysis system

[0046] CFX96 TM Real-Time System: CFX96 Fluorescence Quantitative PCR System

[0047] iQTM Green Supermix: A dye-based qPCR master mix. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 : Detection chart of positive samples of primer pair BS16S-1F / R (the blue curve is SFH-19, the green curve is SFH-42)

[0049] Remark: Figure 1-Figure 21 , the left figure A is the amplification curve, and the right figure B is the melting curve.

[0050] Figure 2 : Detection graph of primer pair BS16S-1F / R negative samples (blue curve is DLT1, green curve is DLT2)

[0051] Figure 3 : Detection chart of positive samples of primer pair BS16S-2F / R (blue curve is SFH-19, green curve is SFH-42, black is NTC)

[0052] Figure 4 : Detection chart of negative samples of primer pair BS16S-2F / R (blue curve is DLT1, green curve is DLT2, black is NTC)

[0053] Figure 5 : Detection chart of positive samples of primer pair BS16S-3F / R (blue curve is SFH-19, green curve is SFH-42, black is NTC)

[0054] Figure 6 : Detection graph of primer pair BS16S-3F / R negative sample (blue curve is DLT1, green curve is DLT2, black is NTC)

[0055] Figure 7 :Detection chart of primer pair BS16S-4F / 4R (positive DNA (SFH-19) sample)

[0056] Figure 8 :Detection graph of primer pair 16S-5F / R (blue curve is SFH-19, green curve is DLT1, black curve is NTC)

[0057] Fig. 9 : Primer pair 16S-6F / R detection diagram (blue curve is SFH-19, green curve is DLT1, black is NTC)

[0058] Fig.10 : Primer pair MospA-F / R detection diagram (blue curve is SFH-19 and SFH-42, green curve is DLT1, black is NTC)

[0059] Fig.11 : Primer pair BSOspA-1F / R detection diagram (blue curve is SFH-19, green curve is SFH-42, black is NTC)

[0060] Fig.12 : Primer pair BSOspA-1F / R detection diagram (blue curve is DLT1, green curve is DLT2, black is NTC)

[0061] Fig.13 : Primer pair BSOspA-3F / R detection diagram (blue curve is SFH-19, green curve is SFH-42, black is NTC)

[0062] Fig.14 : Primer pair BSOspA-3F / R detection diagram (blue curve is DLT1, green curve is DLT2, black is NTC)

[0063] Fig.15 : Primer pair ospA4F / R detection diagram (blue curves are SFH-19 and SFH-42, green curves are DLT2 / 3 / 4, and black is NTC)

[0064] Fig.16 :Detection diagram of primer pair BSflaB-1F / R (blue curve is SFH-19)

[0065] Fig.17 :Detection graph of primer pair BSflaB-2F / R (blue curve is SFH-19)

[0066] Fig.18 :Detection graph of primer pair BSflaB-3F / 3R (blue curve is SFH-19)

[0067] Fig.19 :Detection graph of primer pair BSflaB-4F / R (blue curve is SFH-19, green curve is DLT1, black is NTC)

[0068] Fig. 20 :Detection graph of primer pair 5-23S-1F / R (blue curves are SFH-19 and SFH-42, green curves are DLT2 / 3 / 4, and black is NTC)

[0069] Fig.21 :Detection graph of primer pair 5-23S-2F / R (blue curve is SFH-19, green curve is DLT1, black is NTC)

[0070] Fig. 22 :Amplification curve of ospA4F / R / p-probe method

[0071] Fig.23 :5-23S-1F / R p-probe method amplification curve

[0072] Fig.24 :One-dimensional diagram of the sample SFH-19 detected by the combination of Burkholderia sparse probes (AC: OspA, 5-23S and animal source)

[0073] Fig.25 :One-dimensional diagram of the sample SFH-42 detected by the combination of Burkholderia sparse probes (AC: OspA, 5-23S and animal source)

[0074] Fig.26 :One-dimensional diagram of DLT1 sample detected by combination of Burkholderia sparse probes (AC: OspA, 5-23S and animal source) DETAILED DESCRIPTION

[0075] The present invention is further described by the following specific examples, but is not intended to be limiting of the present invention.

[0076] Example 1: Lyme disease Borrelia burgdorferi primer probe validation

[0077] 1. Purpose

[0078] Validation of primer sets for the Lyme spirochetes involved.

[0079] (II) Materials, reagents and instruments

[0080] 1. Main instruments and equipment

[0081] Instrument Name factory <![CDATA[CFX96 TM Real-Time System]]> Bio-Rad

[0082] 2. Main Reagents

[0083]

[0084]

[0085] 3. Experimental Materials

[0086] name Virus Type Nucleic acid type A260 A260 / A280 Concentration (ng / μL) SFH19 Lyme disease spirochetes DNA 7.88 2.05 393.87 SFH42 Lyme disease spirochetes DNA 1.09 1.92 54.61 DLT1 Negative DNA 0.94 2.1 47.15 DLT2 Negative DNA 0.91 2.09 45.66 DLT3 Negative DNA 0.68 2.15 34.05 DLT4 Negative DNA 0.38 2.02 19.19

[0087] 4. Primer Synthesis

[0088]

[0089]

[0090] (III) Experimental process

[0091] 1. Reaction system

[0092]

[0093] 2. Reaction Procedure

[0094]

[0095] 3. Test results

[0096] (1) 16S rRNA test results

[0097] Ct value

[0098]

[0099] Amplification curve

[0100] Note 1: The left figure is the amplification curve, and the right figure is the melting curve. Figure 1-9 .

[0101] (2) Results of OspA gene primer detection

[0102] Ct value

[0103]

[0104] Amplification curve

[0105] Note 1: The left figure is the amplification curve, and the right figure is the melting curve. Figure 10-15 .

[0106] (3) Detection results of primers for flaB gene

[0107] Ct value

[0108]

[0109] Amplification curve

[0110] Note 1: The left figure is the amplification curve, and the right figure is the melting curve. Figure 16-19 .

[0111] (4) Detection results of 23S gene primers

[0112] Ct value

[0113]

[0114] Amplification curve

[0115] Note 1: The left figure is the amplification curve, and the right figure is the melting curve. Figure 20-21 .4. Conclusion

[0116] (1) For primers ospA-4F / R, positive samples SFH-19 and 42 were detected, and the melting curves were consistent, and the concentration of SFH-19 was low. Although negative samples DLT2, DLT3, and DLT4 were detected, their ct values ​​were all after 37, and the melting curves were forward, which may be primer dimers or nonspecific.

[0117] (2) For primers 16S-6F / R, both positive and negative samples were detected, and there was no difference in ct values ​​and melting curves.

[0118] (3) For primers 5-23S-1F / R, positive samples SFH-19 and 42 were detected, and the melting curves were consistent, and the concentration of SFH-19 was low; although negative samples DLT2, DLT3, and DLT4 were detected, the ct values ​​were all above 40, and the melting curves were abnormal.

[0119] Based on the above results, it can be seen that primers ospA-4F / R and 5-23S-1F / R are specific and can be used for subsequent research.

[0120]

[0121] Example 2: Lyme disease spirochete probe specificity verification and condition optimization purpose

[0122] Validation of probe specificity and optimization of conditions for Lyme disease spirochetes.

[0123] Materials, reagents and instruments

[0124] 1. Main instruments and equipment

[0125] Instrument Name factory <![CDATA[CFX96 TM Real-Time System]]> Bio-Rad

[0126] 2. Main Reagents

[0127] Reagent name Part Number factory PerfeCTa qPCR ToughMix,UNG(2×) 95138 Quantabio

[0128] 3. Experimental Materials

[0129] name Virus Type Nucleic acid type A260 A260 / A280 Concentration (ng / μL) SFH19 Lyme disease spirochetes DNA 7.88 2.05 393.87 SFH42 Lyme disease spirochetes DNA 1.09 1.92 54.61 DLT1 Negative DNA 0.94 2.1 47.15 DLT2 Negative DNA 0.91 2.09 45.66 DLT3 Negative DNA 0.68 2.15 34.05 DLT4 Negative DNA 0.38 2.02 19.19

[0130] 4. Primer Synthesis

[0131]

[0132] (I) Experimental process

[0133] 1. Reaction system

[0134]

[0135]

[0136] 2. Reaction Procedure

[0137]

[0138] (II) Test results

[0139] 1. Ct value test results

[0140]

[0141] 2. Amplification curve

[0142] Note: The blue curve is the positive sample 19, the green curve is the positive sample 42, and the black curve is the negative sample DLT1 / 2 / 3 / 4 and NTC. Figure 22-23 .

[0143] result:

[0144] 1. For the primer probe combination ospA-4F / R / P, positive samples SFH-19 and 42 were detected, and the ct values ​​were: 38.16

[0145] and 34.32, with lower concentrations and no amplification in the four negative samples and NTC;

[0146] 2. For the primer-probe combination 5-23S-1F / R / P, positive samples SFH-19 and 42 were detected, and the ct values ​​were:

[0147] 337.07 and 34.98, with lower concentrations, were not amplified in the four negative samples and NTC.

[0148] (III) Conclusion and plan

[0149] From the above test results, it can be seen that the primer-probe combination ospA-4F / R / P and 5-23S-1F / R / P is specific and can be used for the next experiment.

[0150] Example 3: Validation of digital PCR method for Lyme disease spirochetes (I) Purpose

[0151] Validation of a digital PCR method for Lyme disease spirochetes.

[0152] (II) Materials, reagents and instruments

[0153] 1. Main instruments and equipment

[0154] Instrument Name factory <![CDATA[Naica TM Crystal Digital PCR System]]> Stilla

[0155] 2. Main Reagents

[0156] Reagent name Part Number factory PerfeCTa Multiplex qPCR ToughMix(5×) 95147 Quantabio Fluorescein sodium salt(10μM) AK200000 Apexbio

[0157] 3. Experimental Materials

[0158] name Virus Type Nucleic acid type A260 A260 / A280 Concentration (ng / μL) SFH19 Lyme disease spirochetes DNA 7.88 2.05 393.87 SFH42 Lyme disease spirochetes DNA 1.09 1.92 54.61 DLT1 Negative DNA 0.94 2.1 47.15

[0159] 4. Primer Probe Synthesis

[0160] name concentration Remark OspA Primer Probe Premix (FAM) 25× OspA gene 5-23S Primer Probe Premix (HEX) 25× 5-23S gene β_actin primer probe premix (CY5) 25× Rat

[0161] (III) Experimental process

[0162] 1. Reaction system

[0163] Reaction system Final Conc. Volume(μL) PerfeCTa Multiplex qPCR ToughMix 1X 5 Fluorescein sodium salt (1μM) 100nM 2.5 OspA Primer Probe Premix (FAM) 1X 2 5-23S Primer Probe Premix (HEX) 1X 2 β_actin primer probe premix (CY5) 1X 2 <![CDATA[H2O]]> / 9.5 DNA / 2 Total volume / 25

[0164] 2. Reaction Procedure

[0165]

[0166] (IV) Test results

[0167] 1. Digital PCR test results:

[0168]

[0169] 2. One-dimensional graph display of digital PCR detection:

[0170] Note 1: The droplets above the threshold line are positive droplets, i.e., droplets containing the target gene; the droplets below the threshold line are negative droplets, i.e., droplets without the target gene.

[0171] Note 2: Blue channel is OspA, labeled with FAM; Greene channel is 5-23S, labeled with HEX;

[0172] The red channel is animal-derived β-actin, labeled with CY5; see Figure 24-26 .

[0173] (V) Results description and conclusion

[0174] From the above test results, we can see that the ospA and 5-23S genes of Borrelia burgdorferi can be detected in the positive sample SFH-42, with a low copy number concentration. However, they were not detected in the negative sample DLT1, indicating that this combination is specific and can be used for digital PCR detection of Borrelia burgdorferi.

[0175] It can be seen from the one-dimensional graph that there is no cross-interference between the combinations, and triple detection of Lyme disease spirochetes OspA, 5-23S gene, and host gene β_actin can be achieved.

[0176] In summary, the detection method of Lyme disease spirochetes based on digital PCR technology is feasible and can be used for the detection of Lyme disease spirochetes in unknown samples.

[0177] Example 4: Lyme disease spirochetes digital PCR method for unknown sample detection (I) Purpose

[0178] The digital PCR method for Lyme disease spirochetes was used for unknown sample detection.

[0179] (II) Materials, reagents and instruments

[0180] 1. Main instruments and equipment

[0181] Instrument Name factory <![CDATA[Naica TM Crystal Digital PCR System]]> Stilla

[0182] 2. Main Reagents

[0183] Reagent name Part Number factory PerfeCTa Multiplex qPCR ToughMix(5×) 95147 Quantabio Fluorescein sodium salt(10μM) AK200000 Apexbio

[0184] 3. Experimental Materials

[0185] Sample No. 1-50.

[0186] 4. Primer Probe Synthesis

[0187] name concentration Remark OspA Primer Probe Premix (FAM) 25× OspA gene 5-23S Primer Probe Premix (HEX) 25× 5-23S gene β_actin primer probe premix (CY5) 25× Rat

[0188] (III) Experimental process

[0189] 1. Reaction system

[0190] Reaction system Final Conc. Volume(μL) PerfeCTa Multiplex qPCR ToughMix 1X 5 Fluorescein sodium salt (1μM) 100nM 2.5 OspA Primer Probe Premix (FAM) 1X 2 5-23S Primer Probe Premix (HEX) 1X 2 β_actin primer probe premix (CY5) 1X 2 <![CDATA[H2O]]> / 9.5 DNA / 2 Total volume / 25

[0191] 2. Reaction Procedure

[0192]

[0193]

[0194] (IV) Test results

[0195]

[0196]

[0197] In summary, the detection method of Lyme disease spirochetes based on digital PCR technology can be used to detect Lyme disease spirochetes in unknown samples.

Claims

1. A primer and probe combination for detecting Lyme disease spirochetes, characterized in that: The following primers and probes are included: 5-23S-1F:GGTCAAAGTAATAAGAGTCTA 5-23S-1R:TTGGGATCAATAAATGTTTG 5-23S-1P:CGCAGCTTACCACGACCTTC OspA-4F: ATATTTTATTGGGAATAGGTCTAATAT OspA-4R: CTTTGTCTTTTTCTTTRCTTACAAG OspA-4p:AAGCAAAATGTTAGCAGCCTTGA.

2. Use of the primer-probe combination according to claim 1 in preparing a kit for detecting Lyme disease spirochetes and / or genotyping.

3. A kit for detecting Lyme disease spirochetes, characterized in that: Comprising the primer and probe combination of claim 1.

4. A PCR reagent for detecting Lyme disease spirochetes, characterized in that: The PCR reagents include the primer and probe combination as described in claim 1.

5. The PCR reagent according to claim 4, characterized in that Includes the following ingredients:

6. The PCR reagent according to claim 4, characterized in that PCR reaction conditions:

7. A method for detecting and / or genotyping Lyme disease spirochetes, characterized in that The method is used for non-disease diagnosis purposes and comprises the following steps: (1) Extract the DNA of the sample to be tested and store it at -80°C for future use; (2) The specific primers and fluorescent probe sequences used for detection are as follows: The composition and preparation method of the reaction system are as follows: (3) After the above system is prepared, add 25 μL to each well of the Sapphire Chip and place the chip into the Crystal Digital PCR System for PCR amplification. The reaction conditions are as follows: (4) After the PCR reaction is completed, the chip is taken out and placed in the NaicaTM prism droplet reading and analysis system to scan the chip and analyze the data.

Images