Establishment and application of triple PCR for detection of Mycoplasma ovis, Mccp and Mmc

Abstract

The application discloses a kind of sheep mycoplasma Mo, Mccp, Mmc triple PCR detection method establishment and application, by using high-throughput Mauve genome collinearity analysis the specific difference section between three kinds of sheep mycoplasma genomes each other, design and screen out the specific primer capable of differential diagnosis three kinds of sheep mycoplasma, by primer sequence amplification, sequencing, identify three new sheep mycoplasma differential diagnosis target molecule, respectively Mo differential diagnosis target molecule DprA, Mccp differential diagnosis target molecule MCCPF38_00240, Mmc differential diagnosis target molecule restriction endonuclease subunit S.Utilize new target specific section, establish the triple PCR method capable of simultaneous differential diagnosis three kinds of sheep mycoplasma (Mo, Mccp, Mmc).The PCR method of the application has the characteristics of clinical convenient, rapid diagnosis, can be widely used in the clinical diagnosis of sheep mycoplasma, with good market prospect and economic value.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of genetic engineering, and particularly relates to a multiple PCR rapid diagnosis method for mixed infection of mycoplasma pneumonia of sheep and application thereof. BACKGROUND

[0002] Mycoplasma pneumonia of sheep has become one of important diseases affecting the goat and sheep breeding industry in China. The disease causes fever, cough, weight loss of sheep, and the pregnant ewes may have serious symptoms such as abortion, which threatens the health of the sheep and brings economic losses to the breeding industry. The main pathogens causing mycoplasma pneumonia of sheep include Mycoplasma ovipneumoniae (Mo), Mycoplasma capricolum subsp. capripneumoniae (Mccp) and Mycoplasma mycoides subsp. capricolum (Mmc). At present, they are also the main pathogens causing sheep pneumonia.

[0003] Mycoplasma ovipneumoniae (Mo) can cause mycoplasma pneumonia of goats or sheep, and the morbidity of sheep infection is higher than that of goats. The clinical manifestations are characterized by cough, weight loss and interstitial, proliferative pleuropneumonia. After sheep are infected with Mo, long-term infection exists and cannot be eliminated. Mo mainly exists in the respiratory tract, lesion tissue and thoracic effusion of sick sheep, is mainly transmitted through air, and the sick sheep can also spread the pathogen, and the secretion can continuously discharge bacteria for several months or even years. In addition, the infected sheep is easy to be infected with other pathogenic bacteria, which is extremely harmful to the sheep and causes great economic losses to the sheep breeding industry.

[0004] Mycoplasma capricolum subsp. capripneumoniae (Mccp) mainly infects goats, and the main clinical symptoms of the infected sheep are fever, cough and dyspnea. The histopathological manifestations are interstitial pneumonia, pulmonary septum congestion and thickening with pulmonary edema, and the autopsy changes are characterized by fibrinous pneumonia and pleuritis. It is the main pathogen causing contagious caprine pleuropneumonia (CCPP) at present. CCPP has been listed as a class II animal epidemic disease in China, and has high morbidity and mortality, which is seriously harmful to the goat breeding industry.

[0005] Mycoplasmal pneumonia of goat (Mycoplasmal pneumonia of goat, Mmc) can naturally infect goats, sheep and cattle, and goats under 3 years old are most susceptible to infection. It causes pathological changes in the lungs similar to Mccp in goats, and also causes goat pneumonia, mastitis, arthritis, keratitis and septicemia. Although Mmc has a low mortality rate, the quality of semen or dairy products from infected sheep decreases, and the disease is transmitted through semen and milk, and even abortion occurs in severely infected sheep.

[0006] In the existing prevention and control technology of sheep mycoplasma disease, the following two problems mainly exist:

[0007] 1. In clinical practice, Mo, Mccp and Mmc are often mixed infections, because the three pathogens cause similar clinical diagnosis and pathological changes, and often cannot accurately diagnose the infection of the pathogen in gross autopsy or pathological analysis, which causes great trouble and trouble in the diagnosis and accurate treatment of sheep mycoplasma pneumonia in clinical practice.

[0008] 2. There is no effective technical means to accurately distinguish the three pathogens of sheep mycoplasma disease, and there is no diagnostic target for establishing differential diagnosis of mixed infection of the three pathogens of sheep mycoplasma. The existing ELISA and indirect hemagglutination and hemagglutination inhibition test can only detect Mo or Mccp, mainly to detect antibody levels, and cannot detect pathogens, and at the same time, whether there is cross between them cannot be evaluated, at the same time, its specificity and sensitivity cannot meet the needs of the clinic. The PCR technology of pathogen nucleic acid detection can quickly detect the corresponding mycoplasma from the culture medium or clinical sample, and is widely used in the detection of pathogens of sheep mycoplasma pneumonia.

[0009] The above key scientific problems of mixed infection of mycoplasma pathogens in sheep breeding industry, and the two bottleneck technical problems that cause this actual production scientific problem, cause the diagnosis of sheep mycoplasma disease to lag behind, leading to the widespread prevalence and incidence of sheep mycoplasma disease at the present stage, and the present diagnosis technology cannot meet the needs of the clinic, ultimately leading to the significant economic loss of sheep mycoplasma disease to the sheep industry at the present stage. SUMMARY

[0010] In view of the key problems and actual bottleneck technical difficulties of mixed infection of mycoplasma in sheep industry, taking Mo, Mccp and Mmc as the research object, the present application relates to screening and identifying new differential diagnosis targets of sheep mycoplasma pathogens, and on this basis, a triple PCR detection method for sheep mycoplasma is established, which can quickly and synchronously diagnose the mixed infection and single infection of Mo, Mccp and Mmc in clinical practice.

[0011] The application is realized by screening and identifying new Mycoplasma ovis pathogen Mo, Mccp and Mmc differential diagnosis targets, and establishing a Mo, Mccp and Mmc triple PCR detection method and application, including the following steps:

[0012] Step one, for screening Mo, Mccp and Mmc differential diagnosis new molecular markers, high-throughput Mauve genome collinearity analysis of specific difference segments between three kinds of mycoplasma genomes is adopted;

[0013] Step two, according to the genome high-throughput difference interval analysis results, specific primers capable of distinguishing three kinds of mycoplasma are designed and synthesized by using primer design software; 87 available PCR primer sequences are designed and synthesized, according to the specificity of PCR products, the primers (Mo.multP.p80 / Mo.multP.p81) capable of Mo differential diagnosis, the Mccp differential diagnosis primers (multP.p31 / Mccp.multP.p32) and the Mmc differential diagnosis primers (Mmc.multP.p9 / Mmc.multP.p10) are screened out, and after the PCR products amplified by the primers are amplified and sequenced, it is found that the target molecule of Mo differential diagnosis is DNA-processing protein (DprA), the target molecule of Mccp differential diagnosis is MCCPF38_00240, and the target molecule of Mmc differential diagnosis is restriction endonuclease subunit S. At the same time, it is found that the new target can amplify specific bands with mycoplasma strains, and no specific bands are produced with other different kinds of Mycoplasma ovis and other important bacterial pathogens of sheep, proving that the three new differential diagnosis targets of mycoplasma found in the application have good specificity and can be used for the establishment of mycoplasma differential diagnosis PCR method;

[0014] Step three, in order to verify the sensitivity of the three mycoplasma differential diagnosis targets in the application, the above target fragments are respectively constructed on PUC18-T vector to make plasmid standard, after the gene copy number is calculated, 10 times dilution is carried out, 1×10 7 、~1×10 0copies / μL of positive plasmid for subsequent experiments. The sensitivity of the three mycoplasma-specific primers was analyzed according to the PCR system and reaction conditions described in Step Two. The sensitivity of the detection primer (Mo.multP.p80 / Mo.multP.p81) designed for the DprA gene of Mo was 102copies / μL, the sensitivity of the detection primer (Mccp.multP.p3 / Mccp.multP.p32) designed for the MCCPF38_00240 gene of Mccp was 101copies / μL, and the sensitivity of the detection primer (Mmc.multP.p9 / Mmc.multP.p10) designed for the restriction endonuclease subunit S gene of Mmc was 102copies / μL. The results showed that the sensitivity of the identified mycoplasma new target and its specific primer was 10-100copies / μL, which had high sensitivity and could be used for the detection of mycoplasma pathogens.

[0015] Step Four, in order to establish a triple PCR method for mixed infection of mycoplasmas Mo, Mccp and Mmc, the effects of primer concentration, extension time and annealing temperature of three mycoplasma-specific identification primers on the triple PCR detection method were explored. In order to explore the effects of primer concentration, extension time and annealing temperature on the established triple PCR detection method, other conditions were relaxed, and the variables were only primer concentration, extension time and annealing temperature; the optimal PCR system of the triple PCR method for mixed infection of Mo, Mccp and Mmc optimized in the present application was determined as follows: total volume 20 μL (10 μL 2×PCRMix, primer mixture (Mccp:Mo:Mmc=4:3:2) 9 μL, template 1 μL), and the optimal PCR reaction program was as follows: 95℃, 3min; 95℃, 15s, 53℃, 30s, 72℃, 10s, 35 cycles; 72℃, 5min. The sequence of the primer mixture was as follows: Mo detection primer (Mo.multP.p80: 5'-GGATTCTTAAAGACCCGCCAT-3'; Mo.multP.p81: 5'-AATTTCCTTGCCAAGATCGAG-3'), Mccp detection primer (Mccp.multP.p31: 5'-CTTCCATAATCACTCCACGAT-3'Mccp.multP.p32: 5'-AGGACGTTGAATAACTCATGC-3'), and Mmc detection primer (Mmc.multP.p9: 5'-ACAATTCCCTCGTTATGTGT-3'Mmc.multP.p10: 5'-AAGTTCCGTTTGAAATACCTG-3'). The whole PCR reaction process was not more than 1 hour, which had good clinical detection practical value.

[0016] Step five, using the established mycoplasma mixed infection detection triple PCR method, the clinical material and sample (Mo and Mccp) positive for sheep mycoplasma infection were detected for compliance, which was consistent with the detection results of known positive samples, indicating that the new molecular target of mycoplasma screened by the application and the established triple detection PCR method have good detection effect.

[0017] In view of the problems existing in the prior art, some creative technical effects are brought after solving the problems. The specific description is as follows:

[0018] Firstly, the application performs collinearity analysis on Mo, Mccp and Mmc genomes, analyzes the difference intervals between the three sheep mycoplasma pathogen genomes, designs a large number of possible specific primers, defines the difference of the sizes of the amplified fragments of different mycoplasmas, and the specificity and sensitivity of PCR amplification. Creative screening of diagnostic primers for sheep mycoplasma mixed infection is carried out from a large number of primers, reverse amplification of corresponding three mycoplasma diagnostic targets, and specific and sensitive experiments prove that DprA is a new diagnostic marker molecule of Mo, MCCPF38_00240 is a new diagnostic marker molecule of Mccp, and restriction endonuclease subunit S is a new diagnostic marker molecule of Mmc. The three mycoplasma diagnostic markers have not been reported at home and abroad, which proves the creativity of the application.

[0019] In addition, the application uses the above-mentioned screened new mycoplasma diagnostic marker molecules, optimizes the reaction conditions such as primer concentration, extension time and annealing temperature, and for the first time establishes a triple PCR detection method for three mycoplasma pathogens at home and abroad, and carries out sensitivity, specificity and repeatability tests. The triple PCR detection method established in the present study has the advantages of strong specificity, high sensitivity and good timeliness in clinical use, and can be used for rapid differential diagnosis and epidemiological investigation of Mo, Mccp and Mmc infection, which has important significance.

[0020] Second, the expected income and business value of the technical scheme of the present application after transformation are: Mycoplasma ovis pneumonia caused by Mo, Mmc and Mccp is one of the important diseases affecting the sheep industry in various countries and regions of the world. The disease causes fever, cough, weight loss in sheep, and pregnant ewes may have miscarriage and other serious symptoms, which threatens the health of the sheep herd and brings economic losses to the breeding industry. At present, sheep mycoplasma disease has occurred in many sheep breeding provinces in China, and the infection is becoming more and more serious, which has caused great losses, and is also the most important disease of the sheep respiratory system in China at present, and there is no clinical rapid detection method for detecting the three kinds of sheep mycoplasma diseases at the same time, which fills the technical gap in the prevention and control of sheep mycoplasma pneumonia for a long time. According to the current demand, it has great market prospect, and the expected income and business value after transformation are great.

[0021] The technical scheme of the present application fills the technical gap in the industry at home and abroad: the present application first screens and identifies new molecular markers that can be used for the differential diagnosis of three pathogens of sheep mycoplasma disease at home and abroad, and establishes a triple PCR method for simultaneously identifying Mo, Mccp and Mmc, which fills the gap that there is no molecular marker and method for simultaneously identifying Mo, Mccp and Mmc of sheep mycoplasma at home and abroad.

[0022] The technical scheme of the present application solves the technical problems that people have been eager to solve but have always failed to succeed: clinically, mixed infection of Mo, Mccp, Mmc and other mycoplasmas is not uncommon. PCR technology can quickly detect the corresponding mycoplasma from culture medium or clinical samples and is widely used in the detection of pathogens of sheep mycoplasma pneumonia. The traditional PCR molecular detection method for detecting sheep mycoplasma pneumonia has low sensitivity, and each reaction can only detect one pathogen. The present application screens and identifies new markers for the differential diagnosis of three sheep mycoplasma pathogens, which can be used for the establishment of other nucleic acid differential detection methods for sheep mycoplasma disease, and the triple PCR method for simultaneously identifying Mo, Mccp and Mmc established by the present application provides technical support for the clinical diagnosis, epidemiological investigation and scientific prevention and control of the above pathogen infection. BRIEF DESCRIPTION OF DRAWINGS

[0023] The technical scheme of the present application will be further described below with reference to the drawings:

[0024] Figure 1 is the establishment and application flow chart of the triple PCR detection method for sheep mycoplasma Mo, Mccp and Mmc provided by the embodiment of the present application;

[0025] Figure 2 is the result graph of specific difference segment between three sheep mycoplasma genomes by high-throughput Mauve genome collinearity analysis; is the result graph of specific difference segment between three sheep mycoplasma genomes by high-throughput Mauve genome collinearity analysis;

[0026] Figure 3 is a result map of screening primer sequences available for differential diagnosis and diagnosing new targets by using collinearity analysis to obtain a primer library;

[0027] Figure 4 is a result map of specific identification of new diagnostic targets of Mycoplasma ovis Mo, Mccp and Mmc;

[0028] Figure 5 is a result map of sensitivity identification of new diagnostic targets of Mycoplasma ovis Mo, Mccp and Mmc;

[0029] Figure 6 is a result map of combination optimization of the triple-PCR detection method of Mycoplasma ovis Mo, Mccp and Mmc;

[0030] Figure 7 is a result map of clinical sample detection of the triple-PCR detection method of Mycoplasma ovis Mo, Mccp and Mmc. DETAILED DESCRIPTION

[0031] The technical solutions of the present application will be described below in conjunction with specific embodiments, but those skilled in the art should understand that the embodiments described below are only used to illustrate the present application and should not be regarded as limiting the scope of the present application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without making creative efforts fall within the scope of protection of the present application.

[0032] The Mycoplasma ovis (Mo) used in the present application is the standard strain Y98 strain (ATCC 29419), the Mycoplasma capricolum subsp. capripneumoniae (Mccp) is the standard strain F38 strain (NCTC 10192T), and the Mycoplasma filamentous subsp. capricolum (Mmc) is the standard strain PG3 strain.

[0033] The triple-PCR detection method of the Mycoplasma ovis pathogens Mycoplasma ovis, Mycoplasma capricolum subsp. capripneumoniae and Mycoplasma filamentous subsp. capricolum provided by the present application comprises the following steps:

[0034] Step one, using high-throughput Mauve genome collinearity analysis to analyze the specific difference segments of the three mycoplasma genomes. At present, there is no simultaneous detection PCR method for the three main pathogens (Mo, Mccp and Mmc) of the Mycoplasma ovis disease at home and abroad, so it is necessary to screen and identify new PCR molecular targets to meet the single or common detection of the three pathogens. According to the genomes Mo, Mccp and Mmc of the three Mycoplasma ovis on the NCBI (http: / / www.ncbi.nlm.nih.gov / ) website, https: / / www.ncbi.nlm.nih.gov / https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_028885435.1 / ), Mccp ​(http: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_000953375.1 / ), Mmc (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_018389705.1 / ), and the complete genome sequences were downloaded and saved. The genome sequences of the three pathogenic bacteria were analyzed for genome collinearity using Mauve (Ver20150226) software. According to the results of the collinearity analysis, it was found that the genome difference segments specific to Mmc in Mccp and Mo were (188k-201k, 355k-365k, 658k-664k, and 861k-867k), the genome difference segments specific to Mccp in Mmc and Mo were (253k-268k, 352k-383k, 431k-444k, and 883k-890k), and the genome difference segments specific to Mo in Mccp and Mmc were (110k-120k, 370k-380k, 610k-620k, and 850k-860k), as shown in the accompanying Figure 2

[0035] Step two, according to the results of the genome high-throughput difference interval analysis, specific primers capable of simultaneously distinguishing the three mycoplasmas were designed using primer design software and synthesized; a total of 87 usable PCR primer sequences were designed and synthesized, including Mmc (p1-p30), Mccp (p31-p58), and Mo (p59-p87); the primer information is shown in Table 1. The bacterial genome DNA extraction kit was used to extract the positive genomes of Mo, Mccp, and Mmc, which were diluted to 0.1 ng / μL and used as templates for single PCR amplification of Mo, Mccp, and Mmc, respectively. The PCR products were subjected to 1% agarose gel electrophoresis, and the specificity and sensitivity of each detection primer for ovine mycoplasma were observed. The primers with good sensitivity and clear expansion bands were preliminarily screened out, and then the specificity analysis between the three ovine mycoplasmas Mo, Mccp, and Mmc was performed (i.e., the detection primer of one kind of mycoplasma cannot amplify the gene fragments of the other two kinds of mycoplasma). The PCR amplification system was as follows: 1 μL template, 10 μL 2×PCR Mix, 7 μL ddH2O, 1 μL of each of the designed upstream and downstream primers (10 μL mol·L-1), and a total of 20 μL. The reaction conditions were as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 55°C annealing for 15 s, 72°C extension for 15 s, 35 cycles; and 72°C extension for 5 min. The amplification results are shown in the accompanying Figure 3 ​Mo.multP.p80: 5'-GGATTCTTAAAGACCCGCCAT-3' SEQ ID NO.1; Mo.multP.p81: 5'-AATTTCCTTGCCAAGATCGAG-3' SEQ ID NO.2); Mccp's detection primer (Mccp.multP.p31: 5'-CTTCCATAATCACTCCACGAT-3' SEQ ID NO.3 Mccp.multP.p32: 5'-AGGACGTTGAATAACTCATGC-3' SEQ ID NO.4). Mmc's detection primer (Mmc.multP.p9: 5'-ACAATTCCCTCGTTATGTGT-3' SEQ ID NO.5 Mmc.multP.p10: 5'-AAGTTCCGTTTGAAATACCTG-3' SEQ ID NO.6). By detecting primer amplification of Mo, Mccp and Mmc detection primer corresponding to the target gene molecule, using gel recovery kit to recover the amplification product and sequencing, we obtained a new Mo differential diagnosis of target molecules, DNA-processing protein (DprA), located in the Mo genome 851991 bp-852457 bp, the size of the differential fragment is 467 bp, GenBank (CP118522.1). DprA gene sequence is:

[0036] GGATTCTTAAAGACCCGCCATATGTGATATTTTATAGCGGCAATATCGAAGCTTTAAATGACCTGCATCCAAAAGCTTCACTAATTGGTGAAAATTACATCCCTCAAATTCAAAGTTTTTTTAATCGTTCACTTGATCAAATAATAAAAAGACACGTTTTAGTAACAAACGGCTACAAAGGAGTGGAACAAAAAGTAATGGAATTTTTCCGTTTACATGAAATACCAATTATTGGCGTCTCAGTAAATGGGGTTGAAAATCCTTGAATGTTTGAAAATTTTAAAGATTATGACAAATTATTGATAATTTCTGAATACCCTAAGGGGGCTAACATTAATAAAAAACGGCTAATCCAACGGAATCGATTAGTTGCTGCCCTTAGTAATTTTTTAGTGGTTTATTCACTCAGGCAAAAAGGTGGATCACAAAATCTAGTTAATTTTTTTCTCGATCTTGGCAAGGAAATT SEQ ID NO.7

[0037] A new target molecule for differential diagnosis of Mccp, MCCPF38_00240, is obtained, which is located at 258130bp-258797bp of Mccp genome, has a fragment size of 628bp, and is recorded in GenBank (LN515398.1). The sequence of the gene MCCPF38_00240 is as follows:

[0038] CTTCCATAATCACTCCACGATCTAAATCATTTTCATCATTATGAGGGGCAAATAATGTTTTAGTTCTTGGTGGTAAGTTTGTTATTTCATAGTATTTTTTTTCATCACCATAAATACTATTAATAATTCAAGGATTATGAGTATTAAAATCAAATCATATTAATTCTTTTTTAGTTCCAGTATTTGGATCTATTTTAGGATCATATTTAGGATTTTTAATAGGTTTTCCAGTTTTATCTCTTTTAGTTTTTCCTTTTTCATCTTTTTGAAATTCCTCTATTAATTCTCTTTGATGAGCATAAGTTTTAGGATCTCAAGCGTATCATTTAAAATCCATTTCAGATGATCTCGACTCAATAACTAATGTTTTTGTCCAAGTATATTCAATATCTTTATTACCTGTTTTAGGTTTGTATTTAGTTATTTCTATGTTATATTCATTTTTTAAATGAGAGTTCTTTTCATCTTTTTTTTTATTTTCTTTTGGTTGATAACCGTGATTAAACTCTCTTTCATTATCACTTGAGTTTTTACGATTATCATTTAGATTTGTTTCAAATCTTTGATTTAAAACATCAACTCTTTGTCCATTAATCTTTAAAACTTCAGTTTCATCTTTTAAGGCATTAAAACTTACTTTTAAAGGAGCATGAGTTATTCAACGTCCT SEQ IDNO.8

[0039] The target molecule for the differential diagnosis of the new Mmc is restriction endonuclease subunit S, located at 363418bp-363727bp in the Mmc genome, with a differential fragment size of 310bp, GenBank (CP065581.1). The sequence of the restriction endonuclease subunit S gene is as follows:

[0040] ACAATTCCCTCGTTATGTGTACAATTTATTTTAGCAATTGATGTTCTTCCTATAGTTAATTTAAAACTCATAAGCAATGTTTCTTTTTCTACAAGATAATTTTTAAAAATAACCTCTAATGCTTTGTGAGTTATAAACTGTGAAGATTGAAAAAGTTCTTTATTGTTTTTCATGTCAGCTATTGTTATTCATGGAATTTCACCATTTCAAAATATTTTATTTCCTCTTGGCGGTGTCTTTCCTAAATTAAAATTTAATATACTCTTAAGTCATACCCATACTCAATTATCAGGTATTTCAAACGGAACTT

[0041] SEQ ID NO. 9

[0042] Through the above research, the inventors obtained new molecular diagnostic targets and specific diagnostic gene fragments of Mo (DprA), Mccp (MCCPF38_00240) and Mmc (restriction endonuclease subunit S) that can be mutually diagnosed and differentiated three kinds of mycoplasma, which is the first time to mine and find these molecules as new findings of mycoplasma differential diagnosis markers. At the same time, the inventors further detected the specificity of the three new molecular markers and the primers designed by them, and found that the detection primers designed according to the DprA gene of Mo (Mo.multP.p80: 5'-GGATTCTTAAAGACCCGCCAT-3'; Mo.multP.p81: 5'-AATTTCCTTGCCAAGATCGAG-3') can only amplify Mo genomic samples, and cannot amplify specific bands for other sheep mycoplasma (Mccp and Mmc) and other important bacterial diseases of sheep. The detection primers designed according to the MCCPF38_00240 gene of Mccp (Mccp.multP.p31: 5'-CTTCCATAATCACTCCACGAT-3' Mccp.multP.p32: 5'-AGGACGTTGAATAACTCATGC-3') can only amplify Mccp genomic samples, and cannot amplify specific bands for other sheep mycoplasma (Mo and Mmc) and other important bacterial diseases of sheep. At the same time, the detection primers designed according to the restriction endonuclease subunit S gene of Mmc (Mmc.multP.p9: 5'-ACAATTCCCTCGTTATGTGT-3' Mmc.multP.p10: 5'-AAGTTCCGTTTGAAATACCTG-3') can only amplify Mmc genomic samples, and cannot amplify specific bands for other sheep mycoplasma (Mccp and Mo) and other important bacterial diseases of sheep. The above results show that the inventors screened and identified three sheep mycoplasma differential molecular targets and obtained effective specific primers, see the following table. Figure 4

[0043] ​Step three, sensitivity is the key link of PCR technology, in order to verify the screening and identified new target and its specific primer sensitivity, according to the DNA extraction kit, extraction Mo, Mccp, Mmc genome DNA respectively;With the extracted DNA as template, the target sequence is amplified using the designed primer respectively;The amplification product is recovered and purified, and then connected to T vector. The three kinds of connection products are transformed into DH5-alpha competent cells, and then coated on the plate. The positive clone bacteria are screened and expanded, and the target plasmid is extracted for amplification and sequencing identification. After successfully constructing the recombinant plasmid standard, according to the copy number calculation formula, the original copy number of the three kinds of recombinant plasmid standard can be obtained, and then diluted to 1×10 8 copies / μL, and then diluted by 10 times, and 1×10 7 , ~ 1×10 0 copies / μL of positive plasmid is used for subsequent test. According to the PCR system and reaction condition described in step two, the sensitivity of three mycoplasma specific primers is analyzed. It is found that the sensitivity of the detection primer (Mo.multP.p80 / Mo.multP.p81) designed for Mo DprA gene is 10 2 copies / μL, the sensitivity of the detection primer (Mccp.multP.p3 / Mccp.multP.p32) designed for Mccp MCCPF38_00240 gene is 10 1 copies / μL, the sensitivity of the detection primer (Mmc.multP.p9 / Mmc.multP.p10) designed for Mmc restriction endonuclease subunit S gene is 10 2 copies / μL, the above results show that the sensitivity of the screened mycoplasma new target and its specific primer is 10-100 copies / μL, which indicates that the PCR method established by the mycoplasma new target and its primer has high sensitivity and can be used for the detection of mycoplasma disease pathogen, see the attached Figure 5 .

[0044] Step four, the new target and its specific primer screened by the application are mainly used for synchronous rapid detection of mycoplasma mixed infection, therefore, in order to establish the triple PCR method for mycoplasma Mo, Mccp and Mmc mixed infection, the influence of primer concentration, extension time and annealing temperature on the triple PCR detection method is explored, and the specific scheme is implemented as follows:

[0045] 1. Optimal concentration of primer screening

[0046] pm_mix_1: p31, p32, p80, p81, p9, p10, 1 μL, 3 μL ddH2O

[0047] pm_mix_5: p31, p32 each 1.2 μL; p80, p81 each 1 μL; p9, p10 each 0.8 μL; 3 μL ddH2O

[0048] pm_mix_6: p31, p32 each 1 μL; p80, p81 each 0.8 μL; p9, p10 each 0.6 μL; 4.2 μL ddH2O

[0049] pm_mix_7: p31, p32 each 0.8 μL; p80, p81 each 0.6 μL; p9, p10 each 0.4 μL; 5.4 μL ddH2O

[0050] PCR amplification system: 10 μL 2x PCR Mix, 9 μL of the above primer mixture, 1 μL of the above sample 7 sample (three repeated holes). Reaction conditions: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 53°C annealing for 30 s, 72°C extension for 15 s, 35 cycles; 72°C extension for 5 min.

[0051] 2. Screening of PCR amplification extension time

[0052] PCR amplification system: 10 μL 2x PCR Mix, 9 μL of the above pm_mix_7 primer mixture, 1 μL of the above sample 1, sample 2, sample 3, sample 7 sample as template. Reaction conditions: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 53°C annealing for 30 s, 72°C extension for 30 s, 20 s, 10 s respectively, 35 cycles; 72°C extension for 5 min.

[0053] 3. Optimal annealing temperature of PCR amplification

[0054] PCR amplification system: 10 μL 2x PCR Mix, 9 μL of the above pm_mix_7 primer mixture, 1 μL of the above sample 1, sample 2, sample 3, sample 7 sample as template. Reaction conditions: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 53°C annealing for 30 s, 72°C extension for 30 s, 20 s, 10 s respectively, 35 cycles; 72°C extension for 5 min. 98°C pre-denaturation for 10 min; 98°C denaturation for 10 s, 60°C annealing for 30 s, 72°C extension for 1 min, a total of 30 cycles; 72°C extension for 10 min; BspE gene upstream homologous arm amplification system: 25 μL: Primer StarMax Premix: 12.5 μL; Template: 3 μL; BspE-up-F: 1 μL; BspE-down-R: 1 μL; ddH2O: 7.5 μL.

[0055] By optimizing the technical conditions of the present application through the above study, the optimal PCR system is determined as follows: total volume 20 μL (10 μL 2x PCR Mix, primer mixture (Mccp:Mo:Mmc = 4:3:2) 9 μL, template 1 μL), and the optimal PCR reaction program is as follows: 95°C, 3 min; 95°C, 15 s, 53°C, 30 s, 72°C, 10 s, 35 cycles; 72°C, 5 min. The whole PCR reaction process is not more than 1 hour, which has good clinical detection practical value. See the following figure: Figure 6

[0056] Step five, using the established mycoplasma triple PCR detection method, the positive clinical specimen and sample (Mo and Mccp) of sheep mycoplasma infection detection are detected for compliance, and from the detection results, it can be seen that 4 sheep mycoplasma Mccp infection samples (Mccp positive, Mo / Mmc negative) (sample numbers 1-4), 1 three kinds of sheep mycoplasma infection mixed sample (Mccp, Mo, Mmc are all positive) (sample number 5) and 2 two kinds of sheep mycoplasma Mo infection samples (Mo positive, Mccp / Mmc are all negative) (sample numbers 7-8) can be accurately detected, which is consistent with the expectation, which shows that the triple sheep mycoplasma PCR technology established by the present application can be used for clinical diagnosis and detection of sheep mycoplasma disease, and has good effect. See the following figure: Figure 7

[0057] Table 1 primer information

[0058]

[0059]

[0060]

[0061]

[0062] Finally, it should be noted that: the above only for the preferred embodiments of the present application, and not for limiting the present application, although the present application is described in detail with reference to the foregoing embodiments, for those skilled in the art, the technical solutions recorded in the foregoing embodiments can be modified, or some technical features can be replaced. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.​​

Claims

1. A triple PCR detection primer for Mycoplasma sheep Mo, Mccp, and Mmc, characterized in that, Primers for detecting Mo are shown in SEQ ID NO. 1-2, primers for detecting Mccp are shown in SEQ ID NO. 3-4, and primers for detecting Mmc are shown in SEQ ID NO. 5-6.

2. The application of the triple PCR detection primers of claim 1 in the preparation of products that simultaneously detect Mo, Mccp, and Mmc.

3. The use of the triple PCR detection primers of claim 1 in the preparation of products for diagnosing diseases caused by Mo, Mccp and / or Mmc infections.

4. The application according to claim 2 or claim 3, characterized in that, The product in question is a reagent kit.

5. A diagnostic target for differentiating and diagnosing Mycoplasma sheep Mo, Mccp, and Mmc, characterized in that, The nucleotide sequence of the diagnostic target DprA for Mo is shown in SEQ ID NO.7; The nucleotide sequence of the McCP differential diagnostic target MCPPF38_00240 is shown in SEQ ID NO.8; The nucleotide sequence of restriction endonuclease subunit S, the target for differential diagnosis of Mmc, is shown in SEQ ID NO. 9.

Images