Method for enhancing anti-tumor effect of oncolytic virus M1

Abstract

The invention belongs to the technical field of tumor treatment, discloses a method for enhancing the anti-tumor effect of an oncolytic virus M1, and particularly discloses application of albendazole in preparation of a product for enhancing the anti-tumor effect of the oncolytic virus M1. According to the invention, the treatment effect of OVM1 in tumor treatment is improved through ABZ for the first time, and the medicine is small in toxicity and low in price. Experiments prove that OVM1 and ABZ combined treatment obviously promotes activity inhibition of tumors in vitro, and the anti-tumor curative effect of combined treatment of immune-healthy mice is far greater than that of immunodeficient mice; further detection finds that the process depends on CD8 + T cells to play a synergistic anti-tumor role. Meanwhile, the combination of the ABZ and the OVM1 with the CTLA4 antibody not only can further enhance the anti-tumor effect, but also can overcome the drug resistance of ICB treatment based on CTLA4. The invention provides a new strategy for enhancing oncolytic virus treatment and overcoming ICB drug resistance.

Description

Technical Field

[0001] The present invention belongs to the technical field of tumor treatment, and specifically relates to a method for enhancing the anti-tumor effect of oncolytic virus M1. Background Art

[0002] In the field of tumor treatment, oncolytic viruses (OVs) have attracted much attention due to their unique anti-tumor mechanism. As an effective tumor treatment, oncolytic virus M1 (OVM1) selectively infects and destroys tumor cells while activating the host's immune system to enhance the immune response to tumors. However, the clinical application effect of OVM1 is affected by many factors, including the immunosuppressive properties of the tumor microenvironment and immune escape mechanisms. For example, while targeting and killing tumors, OVM1 also produces antiviral immunity in the body, resulting in a limited survival time of the virus in the body. In addition, during OVM1 treatment, the accumulation of MDSCs in tumor tissues and their tumor-promoting effects in tumor progression are promoted. More specifically, MDSCs can produce Arg-1, iNOS, IL-6, IL-10, TGF-β, and COX-2 to inhibit the proliferation and function of T cells. In addition to the immunosuppressive function, MDSCs also promote tumor progression by reshaping the TME. In addition, previous studies have found that OVM1 can safely and effectively kill tumors while promoting the expression of mRNA levels of vascular endothelial growth factor (VEGF) and PDL1 in tumor tissues at an early stage. The above factors will limit the therapeutic effect of tumors.

[0003] In recent years, immune checkpoint inhibitors have made significant progress in tumor treatment, among which the PD-1 / PD-L1 axis is an important immune regulatory target. High expression of PD-L1 is closely related to tumor immune escape, and blocking the PD-1 / PD-L1 axis can enhance the immune system's ability to attack tumors. However, monotherapy often faces low response rate and drug resistance problems, so combination therapy strategies have become an important way to improve treatment efficacy.

[0004] Albendazole (ABZ), the molecular structure is: It has been considered to be an effective apoptosis inducer and tumor growth inhibitor. However, due to its poor water solubility, albendazole limits its effective absorption locally or systemically in the body, thereby reducing its clinical efficacy. Currently available studies are all aimed at solving the solubility problem of albendazole or targeted delivery to improve its efficacy. Summary of the invention

[0005] The purpose of the first aspect of the present invention is to provide the use of albendazole in the preparation of a product that enhances the anti-tumor effect of oncolytic virus M1.

[0006] The second aspect of the present invention aims to provide a product.

[0007] The purpose of the third aspect of the present invention is to provide an application of the product of the second aspect of the present invention.

[0008] The purpose of the fourth aspect of the present invention is to provide the use of OVM1 and ABZ in the preparation of a product for eliminating CTLA4 antibody resistance.

[0009] In order to achieve the above object, the technical solution adopted by the present invention is:

[0010] The first aspect of the present invention provides the use of albendazole in the preparation of a product that enhances the anti-tumor effect of oncolytic virus M1.

[0011] In some embodiments of the present invention, the tumor comprises at least one of prostate cancer, glioma, melanoma, lung cancer, breast cancer, colorectal cancer and pancreatic cancer.

[0012] In some preferred embodiments of the present invention, the tumor is prostate cancer and / or glioma.

[0013] In some embodiments of the present invention, the tumor is a glioma.

[0014] In some embodiments of the present invention, the albendazole achieves the purpose of enhancing the anti-tumor effect of oncolytic virus M1 by inhibiting the upregulation of VEGF and / or PD-1 expression caused by oncolytic virus M1.

[0015] In some embodiments of the present invention, the albendazole enhances the anti-tumor effect of oncolytic virus M1 by increasing the intratumoral infiltration and tumoricidal toxicity of lymphocytes during OVM1 oncolytic virus therapy.

[0016] In some embodiments of the present invention, the sources of the lymphocytes include but are not limited to the spleen, tumor-draining lymph nodes, or intratumoral.

[0017] The second aspect of the present invention provides a product comprising albendazole and oncolytic virus M1.

[0018] In some embodiments of the present invention, the product comprises 0.1-3 μM albendazole and 0.01-10 MOI oncolytic virus M1.

[0019] In some preferred embodiments of the present invention, the product comprises 0.1-2 μM albendazole and 0.01-5 MOI oncolytic virus M1.

[0020] In some more preferred embodiments of the present invention, the product comprises 0.1-1 μM albendazole and 0.01-1 MOI oncolytic virus M1.

[0021] In some embodiments of the present invention, the product comprises 15 to 50 mg / kg albendazole and 0.5×10^8 to 1.5×10^8 pfu / kg oncolytic virus M1.

[0022] In some embodiments of the present invention, the product further comprises a CTLA4 antibody.

[0023] In some preferred embodiments of the present invention, the product further comprises 5 to 15 mg / kg CTLA4 antibody.

[0024] In some more preferred embodiments of the present invention, the product further comprises 5 to 10 mg / kg CTLA4 antibody.

[0025] The third aspect of the present invention provides the use of the product of the second aspect of the present invention in at least one of (1) to (10):

[0026] (1) Preparation of anti-tumor drugs;

[0027] (2) increasing the secretion capacity of granzyme B, IFN-γ and / or TNFα in lymphocytes;

[0028] (3) preparing products that enhance the secretion capacity of granzyme B, IFN-γ and / or TNFα in lymphocytes;

[0029] (4) Promote apoptosis of tumor cells;

[0030] (5) Preparation of products that promote apoptosis of tumor cells;

[0031] (6) Enhance the cleavage and activation of Caspase3;

[0032] (7) preparing products that enhance the cleavage and activation of Caspase 3;

[0033] (8) Promote CD8 + Proliferation of T cells;

[0034] (9) Preparation of CD8 + Products for T cell proliferation;

[0035] (10) Prepare products that promote T cell infiltration in tumors.

[0036] In some embodiments of the present invention, the tumors described in (1), (4), (5) and (10) include at least one of prostate cancer, glioma, melanoma, lung cancer, breast cancer, colorectal cancer and pancreatic cancer.

[0037] In some preferred embodiments of the present invention, the tumor is prostate cancer and / or glioma.

[0038] In some embodiments of the present invention, the source of the lymphocytes described in any one of (2) to (3) includes but is not limited to the spleen, tumor-draining lymph nodes, or intratumoral.

[0039] The fourth aspect of the present invention provides the use of albendazole and oncolytic virus M1 in the preparation of a product for eliminating CTLA4 antibody resistance.

[0040] The beneficial effects of the present invention are:

[0041] This invention proposes for the first time to increase the therapeutic effect of OVM1 in treating tumors through ABZ, which has low toxicity and low price. Experiments have shown that OVM1 combined with ABZ treatment significantly promotes tumor activity inhibition in vitro, and the anti-tumor efficacy of combined treatment in immune-competent mice is much greater than that in immunodeficient mice; further testing found that this process depends on CD8 + T cells exert synergistic anti-tumor effects. At the same time, the combination of ABZ and OVM1 with CTLA4 antibodies can not only further enhance the anti-tumor effect, but also overcome the drug resistance of CTLA4-based ICB therapy. The present invention provides a new strategy for enhancing oncolytic virus therapy and overcoming ICB resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 Figure 3 shows the inhibition of OVM1-induced VEGF expression by albendazole; A is the mRNA expression level of CD274 (PD-L1) in tumor tissue; B is the mRNA expression level of VEGF in tumor tissue; C is the protein expression detection results of VEGF and PD-L1; D is the gray analysis statistics in Figure C.

[0043] Figure 2 The activity of OVM1 combined with ABZ in synergistically inhibiting some tumors; among them, A is the activity of RM-1; B is the activity of GL261; C is the activity of B16F10; D is the activity of MC38; E is the activity of LLC; F is the activity of EMT6; G is the activity of KPC1199; and H is the activity of Pan02.

[0044] Figure 3OVM1 combined with albendazole promotes tumor cell apoptosis; wherein, A is the protein expression of Cleaved Caspase-3 after RM-1 cells were treated with 0.01 MOI of OVM1 and different concentrations (0.3 μM and 1 μM) of ABZ for 24 hours; B is the protein expression of Cleaved Caspase-3 after GL261 cells were treated with 0.1 MOI of OVM1 and different concentrations (0.3 μM and 1 μM) of ABZ for 24 hours; C is the grayscale statistical analysis of Figure A; D is the grayscale statistical analysis of Figure B; E is the flow cytometry detection of Annexin V and PI positivity; F to G are the data statistics of Figure E.

[0045] Figure 4 The combination of OVM1 and ABZ significantly inhibited the growth of tumors in immune-competent mice; wherein, A is the dosing pattern diagram of the subcutaneous model of RM-1 or GL261 immune-competent mice C57BL / 6; B is the tumor growth curve diagram of RM-1 tumor-bearing mice, ABZ group n=6, the other three groups n=7; C is the tumor growth curve diagram of GL261 tumor-bearing mice, n=7; D is the survival curve diagram of RM-1 tumor-bearing mice, ABZ group n=6, the other three groups n=7; E is the survival curve diagram of GL261 tumor-bearing mice, n=7; F is the tumor display diagram of RM-1 tumor-bearing mice, n=8; G is the tumor weight statistics diagram of RM-1 tumor-bearing mice, n=8; H is the tumor display diagram of GL261 tumor-bearing mice, n=5; I is the tumor weight statistics diagram of GL261 tumor-bearing mice, n=5.

[0046] Figure 5 The combination of OVM1 and ABZ has good anti-tumor activity; among them, A is the relative tumor proliferation rate (T / C%) of RM-1 tumor-bearing mice, n=6 in the ABZ group, and n=7 in the other three groups; B is the relative tumor proliferation rate (T / C%) of GL261 tumor-bearing mice, n=7.

[0047] Figure 6 OVM1 combined with ABZ has no damaging effect on the liver and kidneys of immune-competent mice. HE staining of mouse liver and kidney observed under a 4× microscope.

[0048] Figure 7 ABZ has no significant synergistic effect on OVM1 treatment in immunodeficient mice; A is the tumor volume curve of RM-1 tumor-bearing nude mice, n=6; B is the tumor volume curve of GL261 tumor-bearing nude mice, n=6; C is the survival curve of RM-1 tumor-bearing nude mice, n=6; D is the survival curve of GL261 tumor-bearing nude mice, n=6; E is the body weight curve of RM-1 tumor-bearing nude mice, n=; F is the body weight curve of GL261 tumor-bearing nude mice, n=6.

[0049] Figure 8The combination of OVM1 and ABZ enhances the tumor killing effect of lymphocytes; wherein, A is a schematic diagram of the co-culture of lymphocytes and tumor cells; B is the MTT method for detecting the tumor toxicity of lymphocytes in RM-1 tumor-bearing mice, n=6; C is the MTT method for detecting the tumor toxicity of lymphocytes in GL261 tumor-bearing mice, n=6.

[0050] Fig. 9 OVM1 combined with ABZ treatment enhanced the secretion of lymphocyte killing factors; A is ELISA detection of the secretion of cytotoxic factors IFN-γ, granzyme B and TNF-α in the supernatant of spleen-draining lymphocytes and tumor co-culture; B is ELISA detection of the secretion of cytotoxic factors IFN-γ and granzyme B in the supernatant of lymphocytes and tumor co-culture in tumor-draining lymph nodes; C is ELISA detection of the secretion of TNF-α in the supernatant of lymphocytes and tumor co-culture in tumor-draining lymph nodes.

[0051] Fig.10 ABZ promoted CD8 in tumors and spleen of OVM1-treated mice + T cell infiltration; A is CD45 in tumor cells + CD3 + T and CD8 + The proportion of T cells; B is the Ki67 + CD8 + The proportion of T cells; C is the CD8 + The average fluorescence intensity of CD44 and CD69, two indicators of T cell activation; D is the average fluorescence intensity of CD8 + The average fluorescence intensity of CTLA4 and PD1, two indicators related to T cell exhaustion; E is the average fluorescence intensity of CD45 in the spleen + CD3 + T and CD8 + The proportion of T cells; F is ki67 + CD8 + The ratio of T cells to spleen cells; G is CD8 + The mean fluorescence intensity of CD44 and CD69 on T cells is + Two indicators of T cell activation; H is CD8 in the spleen + Mean fluorescence intensity of CTLA4 and PD1, two indicators of T cell exhaustion.

[0052] Fig.11ABZ can regulate the expression of genes related to anti-tumor immunity in tumor tissues of C57BL / 6 mice treated with OVM1; wherein, A is the determination of the mRNA expression level of T cell-related chemokines; B is the detection of the mRNA expression level of T cell activation-related genes (including IL-12 or IFNG); C is the detection of the mRNA expression level of immunosuppression-related genes, including VEGF, Arg1 and IL-6.

[0053] Fig.12 OVM1 combined with ABZ treatment can alleviate the resistance of CTLA4 antibody treatment; A is the tumor growth curve of different groups of RM-1 tumor-bearing mice, n=7; B is the tumor survival curve of different groups of RM-1 tumor-bearing mice, n=7; C is the tumor growth curve of each mouse, n=7.

[0054] Fig.13 Schematic diagram of the mechanism of OVM1 combined with ABZ in treating tumors.

[0055] Fig.14 Albendazole can significantly downregulate CD8 + Expression of PD-1 on T cells; A is activated T cells treated with albenda without co-culture of tumor cells, CD8 + Fluorescence intensity of PD-1 on the surface of T cells; B is the activated T cells treated with albenda and co-cultured with tumor cells (E:T=2.5), and flow cytometry was used to detect CD8 + Fluorescence intensity of PD-1 on the surface of T cells. DETAILED DESCRIPTION

[0056] The present invention is further described in detail below through specific examples.

[0057] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0058] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0059] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0060] The cell lines used in the examples: RM-1 mouse prostate cancer cell line, B16F10 mouse melanoma cell line, LLC mouse non-small cell lung cancer cell line, EMT6 breast cancer cell line were purchased from Guangzhou Saiku Biotechnology Co., Ltd., MC38 mouse colorectal cancer cell line and Pan02 mouse pancreatic cancer cell line were purchased from Guangzhou Genio Biotechnology Co., Ltd. GL261 was from Tianjin Medical University, and KPC1199 was from Shanghai Jiaotong University.

[0061] The OVM1-GFP virus (denoted as M1-GFP) used in the cell experiment is a virus strain that expresses jellyfish green fluorescent protein (GFP) after genetic modification of the natural alpha virus M1 genome in our laboratory. The OVM1 used in the animal experiment was provided by Guangzhou Weirongte Pharmaceutical Technology Co., Ltd. Albendazole was purchased from MCE with the catalog number HY-B0223.

[0062] The antibodies used in the examples, Caspase3 Antibody, Cleaved Caspase3 Antibody, GAPDH (14C10) Rabbit mAb were all purchased from Cell Signaling Technology; Anti-VEGF Antibody, Goat Anti-Mouse IgG (H+L) were all purchased from Abcam, PDL1 / CD271 Monoclonal Antibody, HRP-conjugated Affinipure Goat Anti-Rabbit were all purchased from Proteintech; InVivoMAb anti-mouse CTLA-4 (CD152), InVivoMAb mouse IgG2b isotype control were all purchased from Bioxcell; CD45 Monoclonal Antibody (30-F11), FITC, eBioscience TM , CD4 Monoclonal Antibody(GK1.5),APC-eFluor TM 780,eBioscience TM ,CD11b Monoclonal Antibody(M1 / 70),APC-eFluor TM 780,eBioscience TM ,F4 / 80 Monoclonal Antibody(BM8),PE-Cyanine7,eBioscience TM, CD163Monoclonal Antibody(TNKUPJ),APC,eBioscience TM All purchased from Invitrogen; PerCP / Cyanine5.5anti-mouse CD3εAntibody, Brilliant Violet 650 TM anti-mouse CD80 Antibody, PE / Cyanine7 anti-mouse / human CD44 Antibody, APC anti-mouse CD69 Antibody, PE anti-mouse CD274(B7-H1,PD-L1)Antibody, Brilliant Violet 650 TM anti-mouse / human Ki-67Antibody、Brilliant Violet 421 TM Anti-mouse CD274 (B7-H1, PD-L1) were purchased from Biolegend; BD Horizon TM PE-CF594 Rat Anti-Mouse CD279(PD-1), BD Pharmingen TM PE Rat anti-Mouse Foxp3 Brilliant Violet 605 TM Anti-mouse CD152 Antibody and Purified Rat Anti-Mouse CD16 / CD32 (Mouse BD Fc BlockTM) were purchased from BD.

[0063] The 6- to 8-week-old immunocompetent mice C57BL / 6J used in the animal experiments were purchased from the Guangdong Medical Experimental Animal Center (Experimental Animal Production License SCXK (Guangdong) 2023-0067) and kept in the SPF barrier environment of Lai'an (Guangzhou) Technology Co., Ltd.

[0064] Primer sequences in the examples:

[0065] CD274-F / R(5'-3'): TGCTGCATAATCAGCTACGG(SEQ ID NO:1) / ATGCTCAGAAGTGGCTGGAT(SEQ ID NO:2);

[0066] VEGF-F / R(5′-3′):ATTACCATGTGCCCGAGAA(SEQ ID NO:3) / TCTTGCAAACTGCAGGAATG(SEQ ID NO:4);

[0067] GAPDH-F / R(5′-3′):CATCACTGCCACCCAGAAGACTG(SEQ ID NO:5) / ATGCCAGTGAGCTTCCCGTTCAG(SEQ ID NO:6);

[0068] Q3S1-F / R(5′-3′):GGGATTCACTACACCTGCTTAGAC(SEQ ID NO:7) / GCTGACTCTGTCTGCGTAACC(SEQ ID NO:8);

[0069] CXCL9-F / R(5'-3'):ACGGAGATCAAACCTGCCTA(SEQ ID NO:9) / TTTTCCCCCTCTTTTGCTTT(SEQ ID NO:10);

[0070] CXCL10-F / R(5′-3′):AAGTGCTGCCGTCATTTTCT(SEQ ID NO:11) / GTGGCAATGATCTCAACACG(SEQ ID NO:12);

[0071] CXCL11-F / R(5'-3'):AGCTGCTCAAGGCTTCCTTA(SEQ ID NO:13) / CTGCATTATGAGGCGAGCTT(SEQ ID NO:14);

[0072] IL-12-F / R(5'-3'):GCAGTAGCAGTTTCCCCTGAC(SEQ ID NO:15) / AGTCCCTTGGTCCAGTGTG(SEQ ID NO:16);

[0073] IL-6-F / R(5'-3'):CCGGAGAGGAGACTTCACAG(SEQ ID NO:17) / CAGAATTGCCATTGCACAAC(SEQ ID NO:18).

[0074] Thanks for the 1OVM1 mounting kit

[0075] Cell treatment: RM-1, GL261, B16F10, LLC, MC38, EMT6, KPC1199 and Pan02 cells in the logarithmic growth phase were selected and inoculated at 2000 cells / well in 48-well plates for overnight culture. On the second day, 0.01MOI of M1-GFP was added to RM-1, ETM6 and Pan02 cells, 0.1MOI of OVM1-GFP was added to GL261, LLC and KPC1199 cells, 10MOI of M1-GFP was added to MC38 cells, and 0.0001MOI of M1-GFP was added to B16F10 cells. All cells were treated with different concentrations of 0.1μM, 0.3μM and 1μM albendazole for 48h, and cell viability was detected using MTT.

[0076] MTT method to detect cell viability: After the cells were treated with OVM1 and albendazole for 48 hours, the supernatant was discarded, and the MTT mother solution (10×) was diluted with RPMI1640 medium or DMEM medium (depending on the medium used for the specific cells) to 1× MTT solution, and 200μL 1× MTT solution was added to each well, and incubated in a 37°C incubator for 2 hours. Since the succinate dehydrogenase in the living cells can oxidize MTT to formazan, blue-purple crystals can be observed on the bottom of the wells. Carefully aspirate the liquid in the wells, add 200μL DMSO to each well to dissolve the blue-purple crystals, place in a microporous oscillator and oscillate for 3 to 5 minutes to fully dissolve the crystals, and use a microplate reader to detect the OD value at 490nm.

[0077] Immunoblotting was used to detect the expression level of proteins in tumor cells: RM-1 and GL261 cells in the logarithmic growth phase were selected and 50×10 4 Cells / well were inoculated in a 6-well plate overnight. On the second day, 0.01MOI of M1-GFP was added to RM-1 and 0.1MOI of M1-GFP was added to GL261. At the same time, 0.3μM and 1μM albendazole were added for 24h. The supernatant was collected in a 2mL centrifuge tube, centrifuged at 1600rpm, 4℃ for 5min, and the supernatant was discarded. The cells in the 6-well plate were slowly washed twice with cold PBS, and 100μL of RIPA containing protease inhibitors was added to each well, and lysed at 4℃ for 2min. The collected samples were added to the centrifuge tubes of the corresponding wells, and 25μL of 5× loding buffer was added. After vortex mixing, centrifugation was performed, and the samples were heated in a metal bath at 100℃ for 5min and stored at -20℃.

[0078] Immunoblotting to detect protein expression: Add equal amounts of protein to precast gels for protein separation in electrophoresis buffer. After transfer, block with 5% milk for 1 hour, incubate the corresponding protein to be tested with the prepared primary antibody, incubate overnight at 4°C, and recover the primary antibody. Place the PVDF membrane on a shaker and wash it with TBST 5 times, 5 minutes each time. After incubating the corresponding secondary antibody at room temperature for 1 hour, place it on a shaker and wash it with TBST 5 times, 5 minutes each time. Add chemiluminescent solution on the PVDF membrane and detect the protein expression level in the developer.

[0079] Flow cytometry for apoptosis: RM-1 and GL261 cells in the logarithmic growth phase were selected and inoculated at 10,000 cells / well in a 12-well plate for overnight culture. On the second day, 0.01MOI of M1-GFP was added to RM-1 cells and 0.1MOI of M1-GFP was added to GL261 cells. At the same time, 0.3μM and 1μM albendazole were used for 48h. After trypsin digestion, the cells were collected in a flow tube, centrifuged at 500×g, 4℃ for 5min, the supernatant was discarded, and the cells were washed once with PBS and resuspended in 200μL PBS. The cells were stained with Annexin V-APC / PI Apoptosis Kit (Lianke Biotechnology). 5μL of Annexin V and 10μL of PI were added to each tube. After staining at room temperature and away from light for 5min, they were directly detected by flow cytometry.

[0080] qPCR: Real-time quantitative PCR kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.) was used according to its instructions.

[0081] result:

[0082] The experimental results showed that the mRNA expression levels of VEGF and PDL1 in tumor tissues were significantly upregulated in the early stage (day 3) of oncolytic virus M1 treatment ( Figure 1 A and B). We detected the in vitro OVM1 combined with ABZ treatment of RM-1 cells and found that OVM1 can indeed upregulate the expression of VEGF protein. ABZ alone significantly inhibited the expression of VEGF in tumor cells. The combination of ABZ and OVM1 significantly reduced the expression of VEGF upregulated by OVM1, but had no significant effect on the protein expression level of PDL1 ( Figure 1 C and D). This suggests that the combination of oncolytic virus and ABZ may enhance the anti-tumor efficacy. We further evaluated whether the combination of OVM1 and ABZ enhanced the inhibition of tumor cell viability in vitro. MTT experiments were performed on tumor cells treated with OVM1 or ABZ, and it was found that OVM1 or ABZ alone could effectively inhibit the activity of brain glioma GL261 or prostate cancer RM-1, especially ABZ alone showed dose-dependent inhibitory activity against both cell lines ( Figure 2ABZ combination further enhanced the inhibitory effect of OVM1 on both tumor cell lines in a dose-dependent manner ( Figure 2 For melanoma B16F10, colon cancer MC38, non-small cell lung cancer LLC, breast cancer EMT6, pancreatic cancer KPC1199 and pancreatic cancer Pano2, whether infected with OVM1 or treated with ABZ alone can significantly inhibit tumor activity, but the combination of the two is not more effective than single-drug treatment in inhibiting tumor activity ( Figure 2 C, D, E, F, G and H). This indicates that different tumor types have different sensitivities to the synergistic inhibitory activity of OVM1 combined with ABZ.

[0083] The effect of OVM1 combined with ABZ on tumor cell apoptosis was explored. Caspase-3 is the most critical effector protease in the pathway of apoptosis signal transduction. Caspase-3 cleavage and activation indicate that cells are beginning to undergo apoptosis. We detected the cleavage of Caspase3 protein in tumor cells by OVM1 combined with ABZ. The results showed that OVM1 or ABZ alone in treating RM-1 or GL261 tumor cells could significantly promote the protein expression of Cleaved Caspase3, and the combined treatment of the two further enhanced the protein expression level of Cleaved Caspase3 ( Figure 3 A, B, C and D in the figure). This indicates that OVM1 combined with ABZ treatment of tumor cells can indeed enhance the cleavage and activation of Caspase3. The expression of Annexin V in tumor cells was further detected. The results showed that after 48 hours of combined treatment of tumor cells with OVM1 and ABZ, the percentage of Annexin V-positive cells was significantly higher than that of OVM1 or ABZ alone, and was dose-dependent ( Figure 3 These results indicate that both OVM1 and ABZ alone can induce tumor cell apoptosis, and their combined treatment further enhances tumor cell apoptosis.

[0084] Example 2 OVM1 combined with ABZ treatment can significantly inhibit tumor growth in mice

[0085] Establishment of animal tumor models

[0086] Cell preparation: When the cells are in the logarithmic growth phase, digest the cells with trypsin for about 30 seconds, wait for the cells to partially fall off the bottom of the culture dish, and then terminate the digestion with the complete RPMI 1640 medium or complete DMEM medium used for the corresponding cell culture. Centrifuge at 500g for 5 minutes, discard the supernatant, and resuspend the cells with RPMI-1640 or DMEM medium without 10% FBS, 100μg / mL streptomycin, and 100U / mL penicillin. Count the cells with an automatic cell counter, and adjust the RM-1 mouse prostate cancer cell suspension to 3×10 with 1640 medium according to the counting results. 7 The GL261 mouse glioma cell suspension was adjusted to 1×10 cells / mL using DMEM medium. 7 cells / mL.

[0087] Subcutaneous tumor: First, the cell suspension was fully mixed and inoculated subcutaneously on the right back of C57 BL / 6 mice or nude mice of about 8 weeks old. Each mouse was injected with 100 μL of cell suspension, that is, the number of tumor cells per mouse of RM-1 mouse prostate cancer was 3×10 6 cells / mouse, GL261 mouse brain glioma tumor load per mouse was 1×10 6 cells / mouse.

[0088] Grouping and treatment of tumor-bearing mice: After tumor inoculation, the tumor formation of mice was observed. The tumor can be formed about 3 days after tumor inoculation. The length (A) and width (B) of the tumor were carefully measured with a vernier caliper. The tumor volume was calculated according to the following formula: Tumor volume = A × B 2 / 2. Wait for the average tumor volume of mice to grow to 50mm 3 ~100mm 3 The mice were randomly divided into the following groups: control group, OVM1 treatment group, ABZ treatment group and combination group. The control group did not receive any treatment. The OVM1 treatment group was injected with 300 μL of OVM1 (dosage: 3×10 6 pfu / mouse), once a day, and the tumor-bearing mice were kept after 5 consecutive days of treatment. The ABZ treatment group was intraperitoneally injected with 200 μL (dosage 50 mg / mL / mouse), once every two days until the tumor of the mice reached the humane endpoint (volume 2000mm 3 ) The combination group was injected with 300 μL of OVM1 (dosage: 3×10 6pfu / mouse), once a day for 5 consecutive days, and 200 μL ABZ (dosage 50 mg / mL / mouse) was injected intraperitoneally every other day until the mouse tumor reached the humane endpoint (volume 2000mm 3 ) The drug administration was stopped and the mice were killed by cervical dislocation. During this period, the tumor volume was measured every other day.

[0089] Relative tumor proliferation rate T / C ratio: Calculate the relative tumor volume (RTV) based on the measurement results. The calculation formula is: RTV = V t / V0. V0 is the tumor volume measured at the time of cage administration (i.e. D0), and Vt is the tumor volume at each measurement. The evaluation index of antitumor activity is the relative tumor proliferation rate T / C (%), and the calculation formula is: T / C = T RTV / C RTV ×100% (TRTV: treatment group RTV; CRTV: negative control group RTV). Evaluation criteria: T / C (%)>40% is ineffective; T / C (%)≤40%, and P<0.05 after statistical analysis is effective.

[0090] HE staining: On the 7th day after the mice were treated as described above, they were killed, and their liver and kidney tissues were removed and fixed in 4% paraformaldehyde. The samples were sent to Seville Company for paraffin embedding, sectioning, and HE staining and observation and photography under a microscope.

[0091] Statistical methods: All data were analyzed and plotted using Graphpad Prism 8.0 software. Quantitative data that met normal distribution and homogeneity of variance were expressed as mean ± standard deviation. The comparison between the two groups of data was performed using t test or one-way ANOVA. P < 0.05 was considered statistically significant, * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001.

[0092] result:

[0093] To verify whether OVM1 and ABZ have anti-tumor effects in mice, we evaluated their anti-tumor effects against RM-1 and GL261 using an immunocompetent mouse model. Figure 4 As shown in A. Drug administration began on the seventh day after tumor loading. The results showed that in both models tested, treatment of mouse tumors with OVM1 or ABZ alone could significantly inhibit tumor growth, and OVM1 combined with ABZ further slowed the growth rate of RM-1 or GL261 tumors ( Figure 4At the same time, we recorded the humane survival of RM-1 and GL261 mice after OVM1 combined with ABZ treatment, and found that OVM1 or ABZ alone could significantly prolong the half-life of RM-1 tumor-bearing mice, and the combination of the two further prolonged the half-life of mice ( Figure 4 D and E). Then, the tumor growth size and tumor weight after OVM1 combined with ABZ treatment were shown. It was found that the weight of RM-1 or GL261 tumors could be significantly reduced by using either OVM1 or ABZ alone. The combination of OVM1 and ABZ further reduced the weight of both tumors compared to using either drug alone ( Figure 4 This result is consistent with the above tumor volume curve results, indicating that the combined use of ABZ can indeed further enhance the anti-tumor efficacy of OVM1 in immune-competent mice.

[0094] The evaluation index of antitumor activity was the relative tumor proliferation rate T / C (%). The results showed that in RM-1 ( Figure 5 A) and GL261( Figure 5 In the model (B), the T / C ratio of mice treated with OVM1 or ABZ alone exceeded 40% on any day, and the T / C ratio after combined treatment with OVM1 and ABZ did not exceed 40%, which was significantly better than OVM1 or ABZ alone. This indicates that OVM1 combined with ABZ has good anti-tumor activity.

[0095] Since many chemotherapy drugs will more or less damage the liver or kidneys during the treatment of tumors. Whether the liver and kidneys are damaged is an evaluation indicator of whether the drug has serious side effects. Therefore, we further evaluated whether the liver and kidney tissues of immune-competent mice were obviously damaged after OVM1 and ABZ combined treatment. The liver and kidney tissues of each group of treated mice were HE stained. Compared with the Control group, the morphology and structure of the liver and kidney tissues of mice in the combined treatment group remained intact without lesions, whether they were treated with OVM1 alone or ABZ alone ( Figure 6 ). This indicates that OVM1 combined with ABZ in treating tumors has no obvious toxic side effects on mice.

[0096] To further evaluate whether the enhancement of the antitumor efficacy of OVM1 by ABZ depends on the enhancement of antitumor immunity, we used athymic nude mice inoculated with RM-1 or GL261 tumors. Figure 4 The results showed that OVM1 alone could significantly inhibit the growth of RM-1 or GL261 tumors in nude mice, and ABZ alone had no inhibitory effect on the tumors in RM-1 nude mice, but the tumors in GL261 nude mice were significantly inhibited ( Figure 7A and B). OVM1 combined with ABZ treatment showed a trend of enhanced tumor inhibition compared with the single-use group, but it was not statistically significant. Therefore, the combined use of ABZ and OVM1 did not significantly improve the tumor inhibition effect of RM-1 or GL261 tumor-bearing nude mice. At the same time, OVM1 combined with ABZ did not significantly prolong the half-life of RM-1 tumor-bearing nude mice compared with OVM1 alone ( Figure 7 C). Compared with the treatment effect of immune-competent RM-1 tumor-bearing mice, there was no significant combination treatment effect in the nude mouse model, indicating that anti-tumor immunity plays an important role in the RM-1 model. In the GL261 nude mouse model, OVM1 or ABZ alone did not significantly prolong the tumor half-life compared with the untreated group. However, compared with OVM1 or ABZ alone, the half-life after combination treatment was significantly prolonged ( Figure 7 D). However, its therapeutic effect is weaker than that of GL261 tumor-bearing mice with healthy immune system. This indicates that anti-tumor immunity may be involved in the treatment of GL261. The weight of mice with these two tumors remained stable during the treatment of OVM1 and ABZ, indicating that there was no obvious toxicity to mice during the treatment of OVM1 combined with ABZ, which is consistent with the phenomenon of no toxicity to the liver and kidney in immune-healthy mice ( Figure 7 E and F). The above research results show that the anti-tumor effect of OVM1 combined with ABZ varies in different tumors, with direct drug killing effect accompanied by the participation of anti-tumor immunity.

[0097] Example 3 ABZ enhances the tumoricidal toxicity of lymphocytes during OVM1 oncolytic virus therapy

[0098] In this example, a subcutaneous tumor-bearing model of immune-competent mice was established. After the combined treatment, lymphocytes were isolated and co-cultured with tumor cells to evaluate the killing effect of lymphocytes on tumor cells. The reasons for the enhanced killing function of lymphocytes were further verified by detecting the toxic killing factors secreted by lymphocytes. The specific experimental process is as follows:

[0099] The subculture of tumor cells, establishment of animal tumor model, grouping of tumor-bearing mice and treatment plan, and MTT detection of cell activity were the same as those in Examples 1-2.

[0100] Lymphocyte toxicity test of co-culture with tumor cells: RM-1 / GL261 tumor cells were inoculated at 5000 cells / well in a 48-well plate and cultured overnight. The separated lymphocytes (isolated from the above-mentioned experimental mice by conventional methods) were co-cultured with the same tumor cells at E:T=25:1, 20:1 or 10:1 overnight for 48 hours, and parallel wells without lymphocytes (only tumor cells) were set up as controls. After 48 hours of co-culture, the supernatant of the co-cultured cells in each group was collected, centrifuged at 500g for 5 minutes, and the supernatant after centrifugation was aspirated and stored at -80°C. After aspirating the supernatant in the co-culture wells, the cells on the plate were washed with PBS to wash away the lymphocytes and dead cells, and washed twice. After washing, double-free RPMI 1640 culture medium containing 10% MTT master solution (i.e., the MTT treatment concentration is 1 mg / mL) was added to the wells and incubated in a cell incubator for 2 hours. After incubation, it was placed in an enzyme-linked immunosorbent assay and measured at OD 490 The absorbance of each well was measured at nm. Lymphocyte toxicity = (A 肿瘤细胞 -A 肿瘤细胞 + lymphocytes) / (A 肿瘤细胞 )×100%

[0101] ELISA was used to detect the levels of toxic cytokines (IFN-γ, granzyme B and TNF-α) and tumor necrosis factor (TNF-α) in the co-culture supernatant.

[0102] Statistical methods: All data were analyzed and plotted using Graphpad Prism 8.0 software. One-way ANOVA was used to compare multiple groups of data in this study. P < 0.05 was considered to be statistically significant. * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001, and ns indicates no difference.

[0103] result:

[0104] To further investigate whether OVM1 combined with ABZ treatment of tumors enhances the ability of T cells to kill tumor cells in vivo. On the 10th day after tumor-bearing mice (implanted with RM-1 or GL261 cells) were treated with oncolytic virus combined with ABZ, we isolated lymphocytes from the spleen and tumor-draining lymph nodes (TDLN) and co-cultured them with the corresponding tumor cells in vitro for 48 h ( Figure 8 Subsequently, the activity of tumor cells was determined by MTT to evaluate the killing ability of lymphocytes. It was observed that the tumor toxicity of lymphocytes from the spleen and TDLN of mice was significantly enhanced after treatment with OVM1 alone and further significantly enhanced after combined treatment with ABZ ( Figure 8In B and C). Except for the lymphocytes in the spleen of RM-1 tumor-bearing mice, which showed no significant effect, the lymphocytes treated with ABZ alone also showed significantly enhanced tumor toxicity ( Figure 8 This result once again confirmed the activation effect of ABZ on lymphocytes. Moreover, after OVM1 combined with ABZ treatment, almost all lymphocyte samples showed further enhanced tumor killing toxicity compared with ABZ treatment alone, and the higher the E:T ratio, the stronger the killing rate ( Figure 8 B and C). This indicates that the anti-tumor effect of OVM1 combined with ABZ is to enhance the killing effect of T cells.

[0105] Interferon-γ and granzyme B are the most recognized immunotoxic factors used by lymphocytes to eliminate tumors. The secretion of these two factors in the co-culture supernatant of each group was detected by ELISA. The results showed that in the co-culture experiment, OVM1 treatment alone increased the secretion of granzyme B and IFN-γ in lymphocytes derived from spleen and TDLN of RM-1 tumor-bearing mice, and ABZ combined treatment further increased this secretion ( Fig. 9 Tumor necrosis factor (TNF-α) can also directly kill tumor cells by inducing apoptosis. Interestingly, although neither OVM1 treatment alone nor ABZ treatment alone affected TNFα levels in spleen-derived lymphocytes, their combined treatment significantly enhanced TNFα secretion ( Fig. 9 When TDLN-derived lymphocytes kill tumors, OVM1 treatment alone can significantly increase TNF-α secretion (E:T=100:1), and combined treatment with ABZ can further significantly enhance TNF-α secretion ( Fig. 9 Middle C).

[0106] Example 4 OVM1 combined with ABZ promotes the infiltration and proliferation of T cells in tumor and spleen tissues

[0107] In this example, a subcutaneous tumor-bearing model of immune-competent mice was established. The number and function of T cells in different tissues were detected to explore the effect of combined treatment on anti-tumor T cell immunity in vivo, so as to further find the potential mechanism of ABZ in enhancing OVM1 anti-tumor immunity in vivo, as follows:

[0108] The establishment of the mouse subcutaneous model is the same as the establishment of the animal tumor model in Example 2.

[0109] Grouping and treatment of tumor-bearing mice: After tumor inoculation, the tumor formation of mice was observed, and the length (A) and width (B) of the tumor were carefully measured with a vernier caliper. The tumor volume was calculated according to the following formula: Tumor volume = A × B 2 / 2. Wait for the average tumor volume of mice to grow to 50mm3 ~100mm 3 The mice were randomly divided into the following groups: control group, OVM1 treatment group, ABZ treatment group and combination group. The control group did not receive any treatment. The OVM1 treatment group was injected with 300 μL of OVM1 (dosage: 3×10 6 pfu / mouse), once a day, and the tumor-bearing mice were kept after 5 consecutive days of treatment. The ABZ treatment group was injected intraperitoneally with 200 μL (dosage: 50 mg / mL / mouse), once every two days. The combination group was injected with OVM1 300 μL (dosage: 3×10 6 pfu / mouse) once a day for 5 consecutive days, and 200μL ABZ (dosage 50mg / mL / mouse) was injected intraperitoneally once every two days. The first day of administration was regarded as Day 1, and samples were collected on Day 10 of treatment for flow cytometry detection of immune cell infiltration and phenotype.

[0110] Flow cytometry cells:

[0111] (1) Lysis of red blood cells: Place the separated tumor single cell suspension, spleen single cell suspension and blood in a flow tube and centrifuge at 500g for 5 minutes. After centrifugation, discard the supernatant, add 3 times the volume of red blood cell lysis buffer, mix thoroughly, incubate at room temperature for 5 minutes, and centrifuge at 500g for 5 minutes again. After centrifugation, discard the supernatant, add 3 mL of PBS, resuspend the cells, and centrifuge at 500g for 5 minutes. After centrifugation, discard the supernatant and proceed to the next step.

[0112] (2) Tumor suspension was stained with live or dead dye: 3 mL PBS was added, and the cells were centrifuged at 500 g for 5 min to wash the cells once; the cells were resuspended in PBS and the concentration of the cell suspension was adjusted to 1-10×10 6 cells / mL, add 1 μL of dead-live dye (1:1000) to each 1mL of cell suspension, mix well, incubate at room temperature for 15 min, wash twice with PBS containing 2% FBS, and then wash once with PBS without FBS. Centrifugation conditions are 500g for 5 min.

[0113] (3) Flow cytometry blocking antibody incubation: Dilute CD26 / CD32 blocking antibodies with PBS according to the dilution ratio recommended in the instructions, mix at 100 μL / tube, add to cells for blocking, mix well, incubate at 4°C for 15 min, and wash once with PBS.

[0114] (4) Cell surface flow cytometry antibody staining: Discard the supernatant, dilute CD45, CD3, CD8, CD4, CD11b, CD80, CD163, CD69, CD44, CD25, PDL1, PD1, CTLA4 flow cytometry antibodies with PBS according to the dilution ratio recommended in the instructions, mix at 100 μL / tube, add to the flow cytometry tube to resuspend the cells, incubate at 4°C in the dark for 30 minutes. Add 1 mL of PBS, centrifuge at 500 g, 4°C for 5 minutes, and repeat the wash twice.

[0115] (5) Flow cytometry gating strategy: CyExpert software provided with Beckman flow cytometer was used for flow cytometry gating analysis.

[0116] qPCR detection: same as Example 1.

[0117] Statistical method: Same as Example 2.

[0118] result:

[0119] To elucidate the immune mechanism by which ABZ improves the anti-tumor effect of OVM1, this example used flow cytometry to analyze immune cells in tumor tissues of mice subcutaneously inoculated with RM-1 tumors. The results showed that during OVM1 treatment, ABZ combined treatment significantly increased the number of T cells in the tumor, especially CD8 + T cells ( Fig.10 In line with this, ABZ increased CD8 + Ki67 in T cells + The proportion of cells ( Fig.10 These results suggest that ABZ may promote CD8 + Proliferation of T cells. CD8 + In T cells, the expression of CD44 and CD69 increased significantly ( Fig.10 C), while the expression of PD1 decreased significantly, and CTLA4 did not change ( Fig.10 This indicates that CD8 + The function of T cells was improved.

[0120] As the largest peripheral immune organ in the human body, the spleen plays a vital role in the human defense system, especially in anti-tumor immunity. Therefore, this example further studied the proportion of T cells in the spleen and found that during OVM1 treatment, ABZ combined treatment did not affect the proportion of T lymphocytes, CD8 + The proportion of T cells ( Fig.10 Middle E). However, after co-treatment with ABZ, CD8 + Ki67 in T cells +The proportion of cells increased significantly ( Fig.10 At the same time, the combined treatment also upregulated the expression of the immune checkpoint molecule CTLA4 ( Fig.10 (H). Similar to the situation in the tumor microenvironment, CD8 + The expression of PD1, an indicator of exhaustion in T cells, was significantly reduced ( Fig.10 However, the activation markers CD44 and CD69 did not show significant changes ( Fig.10 Middle G).

[0121] In conclusion, during OVM1 treatment, combined treatment with ABZ can stimulate the increase of T cell numbers in the tumor microenvironment, especially CD8 + The results of molecular marker detection showed that ABZ combined treatment could reduce CD8 + The spleen showed an increase in CTLA4, unchanged T cell proportions, and stable levels of activation markers such as CD44 and CD69. This suggests that there may be negative feedback regulation in the spleen secondary to excessive activation of immune cells.

[0122] OVM1 combined with ABZ significantly promoted T cell infiltration and enhanced anti-tumor efficacy. Chemokines and cytokines play a vital role in anti-tumor immunity. Therefore, this example analyzed the mRNA expression of these genes in tumors. The results showed that, except for the increase in CXCL10 expression level by ABZ treatment alone, neither OVM1 treatment alone nor ABZ treatment alone significantly affected the expression of T cell-related chemokines ( Fig.11 However, during OVM1 treatment, co-treatment with ABZ significantly enhanced the expression of CXCL11, which has been shown to be a more potent CXCR3 ligand than CXCL9 and CXCL10 ( Fig.11 A). IL-12 can exert anti-tumor effects by inducing T cells to produce IFN-γ. We further examined the mRNA expression of IL-12 and IFN-γ in tumor tissues and found that either OVM1 treatment alone or ABZ treatment alone could enhance IL-12 or IFN-γ expression. However, combined treatment did not further increase the expression levels of these genes ( Fig.11Many studies have reported that IL-6 is associated with the progression and drug resistance of various cancers. Therefore, this example evaluated the expression of IL-6 in tumor tissues and observed that OVM1 treatment alone tended to upregulate IL-6, a finding consistent with our studies in other tumors. Although IL-6 showed a trend toward decrease after 10 days of combined treatment with ABZ and OVM1, this decrease was not statistically significant compared with treatment with OVM1 alone ( Fig.11 Middle C).

[0123] In addition, this example also evaluated the mRNA expression of other immune-related genes in tumor tissues, such as arginase 1 (Arg1), PD-L1, and VEGF. Arg1 in tumors is usually produced by MDSCs, which can suppress T cell responses in tumor patients, thereby promoting tumor progression. The results showed that neither OVM1 treatment alone nor ABZ treatment alone affected the expression of Arg1, but their combination significantly reduced the expression level of Arg1 in tumor tissues ( Fig.11 (C). This result is consistent with the reduction in macrophage M2 polarization detected by flow cytometry, indicating enhanced antitumor immunity of tumor-associated myeloid cell populations. Previous studies have shown that OVM1 treatment can upregulate the expression of PDL1 and VEGF. VEGF has been shown to induce the proliferation of immunosuppressive cells, prevent T cell recruitment to tumors, and induce T cell exhaustion. PDL1 also induces T cell exhaustion, which will limit the antitumor efficacy of OVM1. Literature reports have shown that ABZ can inhibit PD-L1 and VEGF in tumor cells, thereby exerting antitumor effects. However, we found that ABZ combination therapy did not affect the expression of PD-L1, which is consistent with its expression in CD45- cells and tumor-associated macrophages detected by flow cytometry. However, during OVM1 treatment, ABZ combination therapy significantly inhibited the expression of VEGF in tumor tissue ( Fig.11 C), which is consistent with our previous in vitro cytological experimental results. Among the two anti-tumor targets of ABZ that have been reported, namely PD-L1 and VEGF, it can be inferred that ABZ may enhance the anti-tumor effect of OVM1 by downregulating the expression of VEGF rather than PD-L1.

[0124] Example 5 OVM1 combined with ABZ treatment can overcome CTLA4 resistance

[0125] Preliminary experiments have shown that OVM1 combined with ABZ treatment of tumor-bearing mice enhanced the expression of T cell-related chemokines in tumors and promoted the proliferation of CD8 + T cells mainly infiltrate the tumor and enhance the CD8 +The proliferation of T cells and the expression of activation indicators. The enhancement of the anti-tumor effect of ABZ on OVM1 depends on CD8 + In addition, although OVA combined with ABZ treatment downregulated CD8 + The expression of PD1 in T cells was upregulated, but the expression of CTLA4 was upregulated in the spleen. CTLA4 is also a CD8 + One of the indicators of T cell exhaustion, so this example wants to evaluate whether CTLA4 antibodies can further enhance the anti-tumor effect of OVM1 and ABZ. This example uses the RM-1 tumor-bearing immune-competent mouse model to test the therapeutic effect of this immune combination therapy, as follows:

[0126] Establishment of animal tumor model: Same as Example 2.

[0127] Grouping and treatment of tumor-bearing mice: After the RM-1 tumor was subcutaneously inoculated in mice, the tumor formation of the mice was observed. The length (A) and width (B) of the tumor were measured with a vernier caliper, and the tumor volume was calculated according to the following formula: Tumor volume = A × B 2 / 2. Wait for the average tumor volume of mice to grow to 50mm 3 ~100mm 3 The mice were randomly divided into 4 groups: Control+IgG2b group, Control+Anti-CTLA4 treatment group, OVM1+ABZ+IgG2b treatment group and OVM1+ABZ+CTLA4 treatment group. The administration method was to inject OVM1 300 μL into the tail vein (administration dose: 3×10 6 pfu / mouse), once a day, for 5 consecutive days. ABZ was injected intraperitoneally at 200 μL (dosage: 50 mg / mL / mouse) once every two days, and IgG2b was injected intraperitoneally at 200 μL (dosage: 200 μg / mouse) once every 3 days. Anti-CTLA4 antibody was injected intraperitoneally at 200 μL (dosage: 200 μg / mouse) once every 3 days. Isotype control IgG2b, Anti-CTLA4 antibody, OVM1 or ABZ were administered on the same day, and the day of administration was regarded as Day 1, and the tumor was measured once every two days. The statistical method was the same as Example 2.

[0128] result:

[0129] High expression of immune checkpoint molecules determines a good clinical response to ICB treatment. As mentioned above, the combination of OVM1 and ABZ did not affect the expression of CTLA4 on T cells in the TME, but significantly increased CTLA4 expression in the spleen. Therefore, we treated tumor-bearing mice with CTLA4 antibodies in combination with OVM1 and ABZ to evaluate whether the triple drug combination could further enhance the anti-tumor efficacy. The results showed that CTLA4 antibodies alone had almost no therapeutic effect on RM-1 tumor-bearing mice, and there was no significant difference in tumor size and median survival time, indicating that RM-1 tumors are insensitive to antibody treatment of CTLA4 ( Fig.12 A to C in the figure, similar to ICB resistance that frequently occurs in clinical practice. However, after combined treatment with CTLA4 antibody and OVM1+ABZ, the tumor size of RM-1 tumor-bearing mice was significantly smaller, and the survival time of the mice was significantly prolonged ( Fig.12 This suggests that OVM1 combined with ABZ can be used as a way to increase the sensitivity of resistant cancers to CTLA4 antibody therapy, providing a solution to overcome CTLA4 therapy resistance.

[0130] Example 6

[0131] Lymphocytes were isolated from mouse spleens and then activated by co-stimulation with CD3 and CD28 antibodies for 48 h. Activated T cells were treated with 0.3 μM and 1 μM albendazole for 24 h, and CD8 + Fluorescence intensity of PD1 on the surface of T cells. After activation with CD28 / CD3, T cells were co-cultured with tumor cells RM1 (E:T=2.5). After treatment with albendazole for 24 h, CD8 + Fluorescence intensity of PD1 on the surface of T cells. Statistical significance is indicated by asterisks, * indicates P < 0.05, ** indicates P < 0.01, and ns indicates no statistical significance.

[0132] result:

[0133] In the RM-1 tumor cell and T cell co-culture model, albendazole could significantly downregulate CD8 + In contrast, PD-1 expression on T cells not co-cultured with RM-1 tumor cells was not downregulated by albendazole ( Fig.14 This result suggests that the mechanism by which albendazole enhances T cell immunity in vivo may involve VEGF-dependent signal crosstalk between tumor cells and T cells, and promotes the improvement of T cell-related immune function by changing the expression of downstream effector molecules (such as PD-1).

[0134] In summary, the present invention explores the combined use of antiparasitic drugs albendazole and OVM1. In the present invention, albendazole and OVM1 were combined and applied to mouse prostate cancer (RM-1) or glioma (GL261) models, and it was found that the combined therapy significantly enhanced the anti-tumor effect of immune-competent mice, but the effect was not obvious in immunodeficient mice. This enhanced anti-tumor effect is not achieved by increasing the replication of OVM1, but by increasing the CD8 + T cell count, reducing CD8 + This is achieved by upregulating the expression of PD-1 on T cells, upregulating the expression of activation markers such as Ki67, CD44, and CD69, and promoting the secretion of cytotoxic factors such as interferon-γ (IFN-γ), granzyme B, and tumor necrosis factor-α (TNF-α). Fig.13 ). In addition, the combination therapy also enhanced the tumor-killing activity of lymphocytes in vitro.

[0135] In addition, the present invention also found that the combined treatment of albendazole and OVM1 can increase the expression of CTLA4 in the spleen, and the addition of CTLA4 antibody further enhances the anti-tumor effect in vivo. This indicates that albendazole can activate CD8 + T cells and OVM1 produce a synergistic effect, and albendazole / OVM1 combined therapy can overcome the drug resistance of CTLA4-based immune checkpoint blockade therapy. The present invention provides new strategies and possibilities for tumor treatment.

[0136] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. The application of albendazole in the preparation of products that enhance the anti-tumor effect of oncolytic virus M1.

2. The use according to claim 1, characterized in that: The tumor includes at least one of prostate cancer, brain glioma, melanoma, lung cancer, breast cancer, colorectal cancer and pancreatic cancer.

3. The use according to claim 1, characterized in that: The albendazole achieves the purpose of enhancing the anti-tumor effect of oncolytic virus M1 by inhibiting the upregulation of VEGF and / or PD-1 expression caused by oncolytic virus M1; and / or, the albendazole achieves the purpose of enhancing the anti-tumor effect of oncolytic virus M1 by increasing the intratumoral infiltration and tumoricidal toxicity of lymphocytes during OVM1 oncolytic virus treatment.

4. A product, characterized in that The products include albendazole and oncolytic virus M1.

5. The product according to claim 4, characterized in that The product includes 0.1-3 μM albendazole and 0.01-1 MOI oncolytic virus M1.

6. The product according to claim 4 or 5, characterized in that The products also include CTLA4 antibodies.

7. Use of the product according to any one of claims 4 to 6 in at least one of (1) to (10): (1) Preparation of anti-tumor drugs; (2) increasing the secretion capacity of granzyme B, IFN-γ and / or TNFα in lymphocytes; (3) preparing products that enhance the secretion capacity of granzyme B, IFN-γ and / or TNFα in lymphocytes; (4) Promote apoptosis of tumor cells; (5) Preparation of products that promote apoptosis of tumor cells; (6) Enhance the cleavage and activation of Caspase3; (7) preparing products that enhance the cleavage and activation of Caspase 3; (8) Promote CD8 + Proliferation of T cells; (9) Preparation of CD8 + Proliferation of T cells; (10) Preparing products for T cell infiltration in tumors.

8. The use according to claim 7, characterized in that: The tumors described in (1), (4), (5) and (10) include at least one of prostate cancer, brain glioma, melanoma, lung cancer, breast cancer, colorectal cancer and pancreatic cancer.

9. The use according to claim 7, characterized in that: The lymphocytes according to any one of (2) to (3) include spleen-derived lymphocytes or tumor-draining lymph node-derived lymphocytes.

10. Application of albendazole and oncolytic virus M1 in the preparation of products for eliminating CTLA4 antibody resistance.

Images