Application of miR-320 cluster analogue in preparation of medicine for preventing or treating non-alcoholic fatty liver disease

Abstract

The invention belongs to the field of biological medicines, and particularly relates to application of miR-320 cluster analogues in preparation of medicines for preventing or treating non-alcoholic fatty liver diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular, relates to the use of analogs of a microRNA-320 cluster in the preparation of a drug for preventing or treating non-alcoholic fatty liver disease. Background Art

[0002] Nonalcoholic fatty liver disease (NAFLD) is a broad-spectrum chronic liver disease characterized by fatty degeneration of the liver, accompanied by inflammation or fibrosis, including simple fatty liver, fatty liver hepatitis (NASH), NASH-related cirrhosis and hepatocellular carcinoma. Currently, the incidence of NAFLD is about 30% worldwide, and the disease prevalence in the general population in Asia is 28%-32.4% (Journal of Hepatology, August 2023.vol.79: 516-537). Moreover, NAFLD has become the main cause of chronic liver disease in the world, a risk factor for end-stage liver disease, cardiovascular disease, and primary liver cancer, and an important indication for liver transplantation. The all-cause mortality caused by NAFLD has also increased year by year, thus causing a huge medical and financial burden (Nature Reviews Gastroenterology & Hepatology, 2023). The pathogenesis of NAFLD is complex and diverse. Lifestyle, genetic factors, metabolic disorders, tissue inflammation and intestinal flora are all involved in the occurrence and development of NAFLD (Cell 2021; 184: 2537-2564). Although some drugs targeting metabolism have shown the effect of improving liver lesions in clinical trials (such as GLP-1R agonist Semaglutide, FXR agonist Obeticholic Acid, THR-β agonist Resmetirom), there is still no safe and effective clinical drug approved for the treatment of NAFLD (Nature Medicine 2023; 29: 562-573).

[0003] MicroRNA (miRNA) is an endogenously expressed non-coding RNA of about 22 nucleotides in length. It degrades mRNA or prevents gene translation by complementary pairing with the 3'-UTR region of the target gene messenger RNA, thereby participating in the post-transcriptional regulation of genes. In recent years, a large number of studies have confirmed that microRNA plays an important regulatory role in the occurrence and development of NAFLD (Gut 2021; 70: 784-795). MiR-320 is a 22-nucleotide, highly conserved and widely expressed miRNA. In humans, the miR-320 family consists of miR-320a, miR-320b, miR-320c, miR-320d and miR-320e, of which miR-320a is present in all primates. In mice, the coding sequence of miR-320 is located on chromosome 14. The precursor miR-320 sequence (miRBase Accession: MI0000704, see SEQ ID NO: 1 for details) is cleaved in vivo to form mature miR-320-3p (miRBase Accession: MIMAT0000666, see SEQ ID NO: 2 for details) and miR-320-5p (miRBase Accession: MIMAT0017057, see SEQ ID NO: 3 for details). Studies have reported that miR-320-3p is highly conserved and is abundantly expressed in various tissues of mice, such as heart, liver, kidney and pancreas (Int J Biol Sci 2021; 17: 402-416). However, there are no relevant research reports on the role and mechanism of miR-320 in the occurrence and development of NAFLD.

[0004] There are currently no reports on the application of miR-320 cluster analogs in the field of liver diseases. Summary of the invention

[0005] The present invention provides the use of microRNA of miR-320 cluster or its precursor sequence, derivative sequence, or their expression vector, or their agonist in preparing medicine for preventing or treating non-alcoholic fatty liver disease.

[0006] In the present invention, the microRNA of the miR-320 cluster refers to the miRNA of the miR-320 family produced by its precursor sequence (preferably as shown in SEQ ID NO: 1), examples of which include but are not limited to miR-320a, miR-320b, miR-320c, miR-320d, miR-320e, miR-320-3p, miR-320-5p, and the like.

[0007] In some embodiments, the microRNA of the miR-320 cluster may be miR-320-3p or miR-320a, which is shown in SEQ ID NO: 2. Alternatively, in other embodiments, the microRNA of the miR-320 cluster may also be miR-320-5p, which is shown in SEQ ID NO: 3.

[0008] In some embodiments, the precursor sequence of the microRNA of the miR-320 cluster may be as shown in SEQ ID NO:1.

[0009] In some embodiments, the derived sequence may refer to a sequence formed by deletion, insertion and / or substitution of a single base from a microRNA of the miR-320 cluster or a precursor sequence thereof.

[0010] In some embodiments, the derived sequence may include a double-stranded RNA of a microRNA containing the miR-320 cluster. In some embodiments, the double-stranded RNA may be further modified.

[0011] In some embodiments, the derivative sequence may include a microRNA of the miR-320 cluster or a modified derivative of its precursor sequence.

[0012] In some embodiments, the microRNA of the miR-320 cluster or its precursor sequence or derivative sequence comprises at least one modified nucleotide.

[0013] The above modifications include, but are not limited to, sugar modifications of nucleotides, modifications of the connection mode between nucleotides, cholesterol modifications, locked nucleotide modifications, peptide modifications, lipid modifications, halogen modifications, hydrocarbon modifications, nucleic acid modifications, and the like. In some embodiments, sugar modifications of nucleotides may include 2-O-methyl sugar modifications, 2-O-methoxyethyl sugar modifications, 2-fluoro sugar modifications, sugar ring modifications, and the like. In some embodiments, modifications of the connection mode between nucleotides may include thiosulfate modifications and phosphoric acid alkylation modifications. In some embodiments, the modifications may include "TT" modifications. Modifications suitable for use in the miRNA of the present invention may include all types of modifications disclosed herein or known in the art.

[0014] In some embodiments, the expression vector may refer to a recombinant vector containing a deoxyribonucleotide sequence encoding the microRNA of the miR-320 cluster or its precursor sequence, or a derivative sequence. In some embodiments, the expression vector may include a viral vector and a non-viral vector.

[0015] In some embodiments, the viral vector can be constructed using adenovirus or adeno-associated virus, so as to achieve the effect of targeted liver overexpression. In some embodiments, the adeno-associated virus can be a serotype adeno-associated virus, and examples of the serotype adeno-associated virus include, but are not limited to, AAV2, AAV5, AAV8, AAV9, and AAV-DJ. In some embodiments, the expression vector can be obtained by the following method: constructing a recombinant vector containing a microRNA encoding the miR-320 cluster or its precursor sequence, a deoxyribonucleotide sequence of a derived sequence, and a liver-specific promoter, such as ALB, TBG, and ApoEHCR-hAAT, etc., which can be better targeted to the liver to increase the level of miR-320 after packaging with adenovirus or adeno-associated virus.

[0016] In some embodiments, the non-viral vector can be a plasmid or a vector-free nucleic acid, such as an antisense oligonucleotide. Preferably, in some embodiments, miR-320 can be overexpressed in the liver by lipid nanoparticle encapsulation, surface modification of galactosyl amine in the delivery system, and exosomes targeting the liver.

[0017] In some embodiments, the agonist of the miR-320 cluster microRNA or its precursor sequence may refer to a substance that can promote the expression of the miR-320 cluster microRNA or its precursor sequence, and / or a substance that can promote the activity of the miR-320 cluster microRNA or its precursor sequence.

[0018] In some embodiments, the non-alcoholic fatty liver disease can include simple fatty liver, steatohepatitis (NASH), NASH-related cirrhosis, and hepatocellular carcinoma.

[0019] The present invention uses AAV8-miR-320 to increase the level of miR-320 in the liver in a targeted manner. In the NAFLD mouse models of C57 / BL6J mice induced by HFHC diet and Ldlr KO mice induced by HF60 diet, it is confirmed that overexpression of miR-320 in the liver can significantly improve liver lipid accumulation and lipid peroxidation, reduce liver inflammatory cell infiltration and fibrosis, and effectively inhibit the progression of fatty liver disease. Overexpression of miR-320 at the hepatocyte level can significantly inhibit the lipid accumulation of hepatocytes induced by high fat and high sugar. Therefore, the miR-320 analog can be used to treat non-alcoholic fatty liver disease and is a potential drug for treating non-alcoholic fatty liver disease. Overexpression of miR-320 in the liver may also have similar effects in other diet-induced NAFLD animal models, such as methionine choline-deficient diet, Western diet, choline-deficient L-amino defined (CDAA) diet, high cholesterol diet (HC), etc. These diets alone or in combination of one or more provide induced mouse NAFLD models; in addition to diet-induced NAFLD mouse models, some gene knockout mice also show NAFLD symptoms in the liver under normal diet or special diet induction, such as leptin-deficient ob / ob mice, leptin receptor-deficient db / db mice, ALMS1 protein mutant foz / foz mice, ApoE protein-deficient ApoE- / - mice, etc.

[0020] In addition, since the precursor sequence and mature sequence of mouse miR-320-3p are completely consistent with those of human miR-320, the therapeutic effect of liver overexpression of miR-320-3p in the NAFLD mouse model may also be applicable to the treatment of human NAFLD. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 :Overexpression of miR-320 in the liver reduces serum ALT, AST, and cholesterol levels in mice induced by HFHC diet. A: Levels of miR-320 in the liver; B: Liver-to-body ratio of mice; C: Serum ALT and AST levels; D: Serum TC, LDL-C levels, and HDL-C levels. Data were analyzed by t-test, Mean ± SEM, * indicates p < 0.05, ** indicates p < 0.01 compared with the AAV8-Control group.

[0022] Figure 2: Overexpression of miR-320 in the liver significantly reduced lipid accumulation in mice induced by HFHC diet. A: H&E and Oil Red O staining of the liver, the adjacent bar graphs are statistical graphs of the positive area of ​​Oil Red O staining; B: Immunohistochemical staining of 4-HNE and MDA in the liver, the adjacent bar graphs are statistics of the positive areas of 4-HNE and MDA, respectively; data were analyzed by t-test, Mean ± SEM, compared with the AAV8-Control group, * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001.

[0023] Figure 3 :Overexpression of miR-320 in the liver significantly reduced liver inflammation and fibrosis in mice induced by HFHC diet. A: Immunohistochemical staining of F4 / 80 and Ly6G in the liver, and the adjacent bar graphs are the statistics of F4 / 80 positive area and Ly6G positive cell number; B: Immunohistochemical staining of α-SMA and Sirius red staining in the liver, and the adjacent bar graphs are the statistical graphs of positive area; Data were analyzed by t-test, Mean ± SEM, compared with the AAV8-Control group, * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001.

[0024] Figure 4 : Overexpression of miR-320 in the liver reduces serum ALT and AST in Ldlr knockout mice induced by HF60 diet. Data were analyzed by t-test, Mean ± SEM, * indicates p < 0.05 compared with the AAV8-Control group.

[0025] Figure 5 :Overexpression of miR-320 in the liver inhibits lipid accumulation in the liver of Ldlr knockout mice induced by HF60 diet. A: H&E and Oil Red O staining of the liver, the adjacent bar graphs are statistical graphs of the positive area of ​​Oil Red O staining; B: Immunohistochemical staining of 4-HNE and MDA in the liver, the adjacent bar graphs are statistics of the positive areas of 4-HNE and MDA, respectively; data were analyzed by t-test, Mean ± SEM, compared with the AAV8-Control group, * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001.

[0026] Figure 6:Overexpression of miR-320 in the liver improves liver inflammation and fibrosis in Ldlr knockout mice induced by HF60 diet. A: Immunohistochemical staining of F4 / 80 and Ly6G in the liver, and the adjacent bars are the statistics of F4 / 80 positive area and Ly6G positive cell number; B: Immunohistochemical staining of α-SMA and Sirius red staining in the liver, and the adjacent bars are the statistical graphs of positive area; Data were analyzed by t-test, Mean ± SEM, compared with the AAV8-Control group, * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001.

[0027] Figure 7 :Overexpression of miR-320 inhibits lipid accumulation in hepatocytes. A: qPCR results of AML-12 cells overexpressing miR-320-3p, data were analyzed by t-test, Mean±SEM, *** indicates p<0.001 compared with the NC mimics group; B: Oil Red O staining of AML-12 cells overexpressing miR-320-3p. DETAILED DESCRIPTION

[0028] Hereinafter, the present invention will be described in detail by way of examples. However, the examples provided herein are only for illustrative purposes and are not intended to limit the present invention.

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0030] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0031] Preparation Example 1: Construction of AAV8-miR-320 and AAV8-Control

[0032] The coding sequence of mouse miR-320 is located on chromosome 14. The precursor of miR-320 and fragments of about 100 bases before and after its sequence were synthesized by chemical synthesis. The specific sequence information is shown in SEQ ID NO: 4. The sequence was constructed on the expression vector of pHBAAV-CMV-MCS-T2A-ZsGreen (Hanheng Biotechnology Co., Ltd.) to form the HBAAV2 / 8-mmu-miR-320-ZsGreen overexpression plasmid; the corresponding blank control plasmid is the expression vector of pHBAAV-CMV-MCS-T2A-ZsGreen without the target gene fragment.

[0033] Virus packaging: A three-plasmid co-transfection system was used. 293T cells were cultured (DMEM culture medium containing 10% fetal bovine serum) in a 100mm culture dish, and transfection could be performed after the cell density reached 80-90% confluence. Plasmids and transfection reagents were pre-formed into liposome transfection complexes in Opti MEM culture medium (10μg pAAV-RC packaging plasmid, 20μg pHelper auxiliary plasmid, 10μg plasmid carrying the target gene, and 120μl transfection reagent LipofiterTM). Fresh complete culture medium containing 10% fetal bovine serum FBS was replaced 6h after transfection. 72h after transfection, the cells containing AAV particles were gently scraped off with a cell scraper, collected in a 15mL centrifuge tube, and centrifuged at 150xg for 3min to collect the cells, the culture supernatant was removed, and the cells were washed once with PBS, and finally resuspended with 300μL PBS. The cells were then broken by repeated freezing and thawing three times in liquid nitrogen and a 37°C water bath, centrifuged at 2000×g for 5 min at 4°C to remove cell debris, and the lysis supernatant containing AAV particles was collected.

[0034] Virus purification: Add 0.1 μL Benonase enzyme to each 1 mL of crude virus extract, and incubate in a 37°C water bath for 1 hour to remove the cell genome and residual plasmid DNA in the virus solution. Then centrifuge at 4°C, 600xg for 10 minutes, and take the supernatant. The collected supernatant was purified according to the steps of Biomiga Adeno-associated Virus Purification Kit V1469-01. The AAV virus sample liquid obtained by column purification was added to the ultrafiltration tube and centrifuged at 1400xg for 30 minutes to obtain about 1 mL of AAV. Collect the purified AAV8-miR-320 adeno-associated virus, divide it into appropriate volumes, and store it at -80°C. Take a small amount of virus liquid for sterility testing and virus titer testing.

[0035] Similarly, the viral packaging and purification of AAV8-Control were consistent with AAV8-miR-320.

[0036] The AAV8-miR-320 and AAV8-Control viruses used in the examples were packaged and purified by Hanheng Biotechnology Co., Ltd.

[0037] Example 1: Observe the effect of tail vein injection of AAV8-miR-320 on liver lesions induced by HFHC diet in mice.

[0038] Seven-week-old C57BL / 6J mice (bred from The Jackson Laboratory and bred in the SPF animal room of Shanghai Institute of Materia Medica, Chinese Academy of Sciences, IACUC: 2022-07-HY-03) were fed and watered freely. After one week of adaptive feeding under a standard light cycle (12 hours of light and 12 hours of darkness), they were fed a high-fat, high-fructose, high-cholesterol diet (HFHC, Research Diets, D09100310). After 10 weeks, the mice were randomly divided into two groups (control group AAV8-Control and miR-320 overexpression group AAV8-miR-320), with 8 mice in each group. The liver overexpression miR-320 group was injected with 100 μl AAV8-miR-320 (virus titer 1.2×10 12 ), and the control group was injected with an equal volume of AAV8-Control virus through the tail vein, and continued to be fed with HFHC diet. Six weeks after the injection, the mice were dissected for samples. After the mice were anesthetized with isoflurane, blood samples were collected from the eye sockets. After the mice were killed by cervical dislocation, the abdominal cavity was opened to separate the complete liver and weigh it, and the liver / body weight ratio was calculated. After the mouse blood was allowed to stand for 30 minutes, it was centrifuged at 8000rpm / min at 4℃ for 5min, the supernatant was taken, frozen at -80℃, and set aside for subsequent detection of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) and other indicators. Part of the tissue was fixed in 10% formalin for tissue embedding and pathological staining, and the other part was frozen in liquid nitrogen for subsequent genetic testing. The effect of overexpression of miR-320 in hepatocytes on HFHC diet-induced liver lesions in mice was evaluated by liver section pathological staining and RT-qPCR.

[0039] 1.1 Experimental methods:

[0040] 1) Detection of miR-320 levels in liver tissue: Total RNA was extracted from frozen liver tissue using Trizol reagent (Nanjing Novozyme Biotechnology Co., Ltd., Cat: R401-01-AA). The total RNA was reverse transcribed using miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) (Nanjing Novozyme Biotechnology Co., Ltd., Cat: MR101-02) on a C1000 Touch TMReverse transcription was performed using a PCR instrument, and then the SYBR Green method was used to perform experiments on a QuantStudio 5 real-time fluorescence quantitative PCR instrument (Thermo Applied Biosystems) according to the miRNA Universal SYBR qPCR Master Mix Kit (Nanjing Novogene Biotechnology Co., Ltd., Cat: MQ101-02). The relative expression of miR-320 in different samples was determined according to the ΔΔCT method and the SnoRNA202 normalization method. The sequences of PCR primers and related primers (all synthesized by Shanghai Biotech) are as follows:

[0041]

[0042]

[0043] 2) Serum index detection: The mouse serum obtained by centrifugation was used to determine serum indexes such as ALT, AST, and cholesterol. The kits used were purchased from Nanjing Jiancheng Biotechnology Co., Ltd., namely, alanine aminotransferase test kit (Cat: C009-3-1), aspartate aminotransferase test kit (Cat: C010-3-1), triglyceride (TG) assay kit (Cat: A110-1-1), total cholesterol (T-CHO) assay kit (Cat: A111-1-1), high-density lipoprotein cholesterol (HDL-C) assay kit (Cat: A112-1-1), and low-density lipoprotein cholesterol (LDL-C) assay kit (Cat: A113-1-1). Serum index determinations were performed according to the instructions of the corresponding kits and detected using a Multiskan FC microplate reader (Thermo).

[0044] 3) Liver H&E staining: Part of the liver tissue fixed in 10% formalin was placed in an embedding frame, rinsed with running water, dehydrated with 70%, 80%, 90%, and 100% ethanol, transparentized with xylene, immersed in paraffin, embedded into wax blocks, and then sliced. The prepared liver tissue sections were soaked in xylene I, II, and III (Sinopharm Chemical Reagent Co., Ltd.) for 5 minutes, xylene: ethanol 1:1, anhydrous ethanol I (Sinopharm Chemical Reagent Co., Ltd.), II, 90%, 80%, and 70% ethanol for 3 minutes, rinsed with running water, and stained with hematoxylin stain (Wuhan Saiweier Biotechnology Co., Ltd., Cat: G1005-1) for 10 seconds, washed with tap water, and then stained with eosin stain (Wuhan Saiweier Biotechnology Co., Ltd., Cat: G1005-1) for 2 minutes, and quickly rinsed with 90% ethanol. Incubate in anhydrous ethanol I and II for 2 min each, in xylene I, II and III for 5 min each, seal with neutral gum and examine under a microscope.

[0045] 4) Liver Oil Red O staining: Cryopreserved liver tissue was embedded in OCT (SAKURA, Cat: 4583), and sliced ​​on a cryostat (Thermo) to obtain liver frozen sections. Dissolve 0.25g of oil red powder (Sigma-Aldrich, Cat: O0625-100G) in 100mL of isopropanol (Sigma-Aldrich, Cat: I9030-500ML), dissolve in a 56°C water bath for 1h, and filter after cooling to obtain a 0.25% oil red storage solution. Dilute the oil red storage solution to 60% with ddH2O and let stand for 10min. Dry the frozen section tissue in a fume hood, then place it in the oil red O staining solution for about 45min, discard the oil red, and wash twice with 60% isopropanol. Then stain with hematoxylin for 10s, rinse with running water for about 3min, seal with 70% glycerol, and finally examine under a microscope.

[0046] 5) Sirius red staining of liver: Paraffin sections were dewaxed to water in a fume hood, rinsed with running water for 3-5 minutes, rinsed with distilled water, and immersed in Sirius red staining solution at room temperature for 1 hour. After the immersion, wash with 0.5% acetic acid solution 3 times, 5 minutes each time. Dehydrated from 90% ethanol solution, after routine dehydration, sealed with neutral resin, and finally examined under a microscope.

[0047] 6) Liver immunohistochemical staining: Liver paraffin sections were dewaxed by soaking in xylene I, II and III for 5 min each, then soaked in xylene:ethanol 1:1, anhydrous ethanol I, II, 90%, 80%, 70% ethanol for 3 min each, rinsed with running water for 3 min, and then repaired with citrate buffer (pH 6.0, Invitrogen, Cat: 005000) for 10 min. After naturally drying to room temperature, they were washed twice with ddH2O and PBS, and endogenous peroxidase was blocked with 3% hydrogen peroxide solution at room temperature in the dark for 15 min. Then, they were washed with PBS for 3 min, incubated with 3% goat serum (Abison, Cat: abs933-50ml) at room temperature for 1 h, and then incubated with diluted primary antibodies at 4°C overnight. The primary antibodies used and the corresponding ratios are shown in the table below. On the second day, the slides incubated with primary antibodies were returned to room temperature, washed with PBS for 3 times, and two drops of secondary antibodies (CST, SignalStain Boost IHC Detection Reagent (HRP, Mouse) Cat: 8125S, SignalStain Boost IHC Detection Reagent (HRP, Rabbit) Cat: 8114S) were added and incubated at room temperature for 45 min, then washed with PBS for 3 times, and then developed with DAB color development kit (Shanghai Xinaosheng Biotechnology Co., Ltd., Cat: SK-4105,). The specific development time was determined according to the results of microscopic observation. After the color development, the slides were immersed in water to terminate, and then stained with hematoxylin for 5-10s, rinsed with running water to return to blue for 10min, and then the slides were placed in 70%, 80%, 90% ethanol and anhydrous ethanol I, II, xylene: ethanol 1:1 for 2min each, and immersed in xylene I, II and III for 5min each, sealed with neutral resin, and finally examined under a microscope.

[0048]

[0049] 1.2 Experimental Results

[0050] 1) Overexpression of miR-320 in mouse liver reduced the liver-to-body weight, serum ALT and AST levels, and serum TC and LDL-C levels ( Figure 1 Injection of AAV8-miR-320 into the tail vein of mice successfully increased the level of miR-320 in the liver ( Figure 1 In addition, liver overexpression of miR-320 significantly reduced the liver-to-body weight ratio of mice ( Figure 1(B). Serum ALT and AST are important indicators of liver function. Increased levels of ALT and AST indicate damage to liver cell membranes and organelles. In the mouse NAFLD model, liver function was impaired and serum ALT and AST levels were elevated. The results of this study showed that overexpression of miR-320 in the liver significantly reduced the levels of serum ALT and AST in NAFLD mice ( Figure 1 C). Serum total cholesterol (TC) content and low-density lipoprotein (LDL-C) levels are also clinical indicators that characterize the severity and development tendency of liver disease. In the diet-induced mouse NAFLD model, serum TC and LDL-C levels are often elevated. The results of this study showed that overexpression of miR-320 in the liver can reduce serum TC and LDL-C levels in NAFLD mice, and has an increasing trend on HDL-C levels ( Figure 1 (middle D).

[0051] 2) Overexpression of miR-320 in mouse liver significantly improved lipid accumulation and lipid peroxidation in the liver of NAFLD mice ( Figure 2 H&E staining and oil red staining were used to evaluate the lipid accumulation in the liver of mice. The experimental results showed that the HFHC diet induced severe lipid degeneration in the liver of mice, while the lipid accumulation in the liver of mice overexpressing miR-320 was significantly improved ( Figure 2 A in the figure). Lipid peroxidation is the peroxidation reaction between oxygen free radicals (such as ROS) and unsaturated fatty acids through free radical action to form lipid peroxides, which damage cell function. The final products of lipid peroxidation include malondialdehyde (MDA) and 4-hydroxynonenal (4-HNE), which are the main bioactive markers of lipid peroxidation. The results of immunohistochemical staining of lipid peroxidation products 4-HNE and MDA showed that mice overexpressing miR-320 in the liver significantly reduced the levels of 4-HNE and MDA in the liver of mice induced by HFHC diet ( Figure 2 (middle B).

[0052] 3) Overexpression of miR-320 in mouse liver significantly improved HFHC diet-induced liver inflammatory cell infiltration and fibrosis in mice ( Figure 3 F4 / 80 is a marker molecule for macrophages, and Ly6G is a marker molecule for neutrophils. Studies have shown that in the liver of NAFLD mice, the infiltration of these two types of immune cells increases. Increased infiltration of inflammatory cells is a key feature of the progression of the disease from simple fatty liver to fatty liver hepatitis (NASH). In this study, the results of F4 / 80 and Ly6G immunohistochemical staining showed that HFHC diet-induced overexpression of miR-320 in the liver of mice significantly reduced the number of F4 / 80-positive cells and Ly6G-positive cells in the liver ( Figure 3(A). The development of the disease to fatty liver hepatitis is accompanied by a certain degree of fibrosis, and continued development will progress to cirrhosis. The core event in the development of liver fibrosis is the activation of hepatic stellate cells, and α-SMA is a marker molecule for activated hepatic stellate cells. The results of immunohistochemical staining of α-SMA showed that liver overexpression of miR-320 significantly reduced the number of activated hepatic stellate cells in the liver of mice induced by HFHC diet. Sirius red staining was used to evaluate the deposition of liver collagen fibers, and the results showed that the liver of mice induced by HFHC diet had red collagen fibers extending outward from around the blood vessels, while the deposition of collagen fibers in the liver of mice overexpressing miR-320 in the liver was significantly reduced ( Figure 3 (middle B).

[0053] Example 2: Observe the effect of tail vein injection of AAV8-miR-320 on liver lesions induced by HF60 diet in Ldlr knockout mice.

[0054] Ldlr knockout mice (Ldlr KO) are gene knockout mice with systemic knockout of the low-density lipoprotein receptor LDLR. LDLR is a key receptor protein responsible for the binding, endocytosis and degradation of low-density lipoprotein. The loss of the Ldlr gene results in the inability to effectively clear low-density lipoprotein in plasma, leading to a significant increase in the level of LDL-C in the serum. LDL-C is a risk factor for the progression of NAFLD. Therefore, under the induction of a high-fat diet, Ldlr KO mice are more likely to develop NASH in the short term. Seven-week-old Ldlr KO mice (bred from The Jackson Laboratory and bred in the SPF animal room of the Shanghai Institute of Materia Medica, Chinese Academy of Sciences, IACUC: 2022-07-HY-03) were given free access to food and water. After one week of adaptive feeding under a standard light cycle, they began to be fed a 60% high-fat diet (HF60, Research Diets, D12492). After 8 weeks, the mice were randomly divided into two groups (control group AAV8-Control and miR-320 overexpression group AAV8-miR-320), with 8 mice in each group. The liver overexpression miR-320 group was injected with 100 μl AAV8-miR-320 (virus titer 1.2×10 12), and the control group was injected with an equal volume of AAV8-Control virus through the tail vein, and continued to be fed with the HF60 diet. Four weeks after the injection, the mice were dissected for samples. After the mice were anesthetized with isoflurane, blood was collected from the eye sockets, and the mice were killed by cervical dislocation, the abdominal cavity was opened, the complete liver was separated and weighed, and the liver / body weight ratio was calculated. After the mouse blood was allowed to stand for 2 hours, it was centrifuged at 8000rpm / min at 4℃ for 5 minutes, the supernatant was taken, and frozen at -80℃ for later use until the serum ALT and AST and other indicators were tested. Part of the tissue was fixed in 10% formalin for tissue embedding and pathological staining, and the other part was frozen in liquid nitrogen for subsequent genetic testing. The effect of overexpression of miR-320 in hepatocytes on the liver lesions induced by the HF60 diet in mice was evaluated by liver section pathological staining and RT-qPCR.

[0055] 2.1 Experimental methods

[0056] The experimental method involved in this embodiment is the same as that in Example 1.

[0057] 2.2 Experimental Results

[0058] 1) Overexpression of miR-320 in mouse liver reduces serum ALT and AST levels in mice induced by HF60 diet ( Figure 4 Serum ALT and AST were tested to evaluate the liver function of mice. The results showed that tail vein injection of AAV8-miR-320 significantly reduced the serum ALT and AST levels of Ldlr KO mice ( Figure 4 ).

[0059] 2) H&E staining and oil red staining were used to evaluate lipid accumulation in the liver of mice. The results showed that compared with the HF60 diet-induced Ldlr KO mice in the control group, liver overexpression of miR-320 significantly reduced lipid accumulation in the liver of HF60 diet-induced Ldlr KO mice, and the ballooning of the liver was significantly reduced ( Figure 5 Similarly, immunohistochemical staining of lipid peroxidation products 4-HNE and MDA was used to evaluate lipid peroxidation in the liver of mice. The results showed that the levels of lipid peroxidation products 4-HNE and MDA in the liver of Ldlr KO mice induced by HF60 diet with overexpression of miR-320 were significantly decreased ( Figure 5 (middle B).

[0060] 3) Overexpression of miR-320 in the liver of Ldlr KO mice induced by HF60 diet significantly improved inflammatory cell infiltration and fibrosis in the liver of mice ( Figure 6AB). Similar to the results of Example 1 (3), F4 / 80 and Ly6G immunohistochemical staining were used to evaluate the infiltration of inflammatory cells in the liver of mice. The results showed that overexpression of miR-320 in the liver of Ldlr KO mice induced by HF60 diet significantly reduced the infiltration of F4 / 80-positive cells and Ly6G-positive cells in the liver ( Figure 6 Similarly, immunohistochemical staining of α-SMA and Sirius red staining were used to assess the degree of liver fibrosis, and the results showed that overexpression of miR-320 in the liver significantly reduced the number of activated hepatic stellate cells and the deposition of collagen fibers in the liver of Ldlr KO mice induced by HF60 diet ( Figure 6 (middle B).

[0061] Example 3: Observation of the effect of overexpression of miR-320-3p in hepatocytes on lipid accumulation in hepatocytes

[0062] AML-12 mouse normal liver cell line was cultured in F12 / DMEM (Corning, 10-092-CV) culture medium containing 10% FBS (Gibco, Cat: 2132096p), 1% PS (Gibco, Cat: 15140122), 1% ITS (Gibco, Cat: 41400045) and dexamethasone (Sigma, Cat: D4902) at 37°C and 5% CO2 in a thermostatic cell culture incubator (Thermo). When the cells grew to 90% confluence, they were digested with 0.25% trypsin (containing EDTA, Gibco, Cat: 25200072) for 2 min, and then the culture medium was added to resuspend the cells by blowing. The cells were cultured at 10x10 4 / ml density for plating, and allow to adhere overnight before subsequent experimental operations.

[0063] 3.1 Experimental methods

[0064] 1) AML-12 cells overexpressing miR-320-3p: After cells were plated in 48-well plates overnight, cells were transfected when they grew to about 70% confluence. 50nM miR-320-3p mimics (double-stranded RNA, sense strand as shown in SEQ ID NO:2, antisense strand as shown in SEQ ID NO:5, synthesized by Shanghai Biotech) and transfection reagent (Hanheng Biotech, Cat: HB-RF-1000) were mixed in a serum-reduced Opti-MEM culture medium (Gbico, Cat: 31985070) at a volume ratio of 1:3, and after standing at room temperature for 15 minutes, they were added to the corresponding wells and incubated in a cell culture incubator at 37°C and 5% CO2 for 24 hours. The control group was transfected with a mixture of negative control mimics (abbreviated as NCmimics, sense strand as shown in SEQ ID NO:6, antisense strand as shown in SEQ ID NO:7, synthesized by Shanghai Biotech) and transfection reagent, and incubated for 24 hours.

[0065] 2) Detection of miR-320-3p levels in AML-12 cells: The incubated cells were washed with PBS, lysed with Trizol, and total cell RNA was extracted according to the Trizol method. RT-qPCR experiments were performed using the miRNA reverse transcription kit miRNA 1stStrand cDNA Synthesis Kit (by stem-loop) and the miRNA Universal SYBR qPCR Master Mix kit, and the relative expression of miR-320-3p in different samples was determined according to the ΔΔCT method and the SnoRNA202 normalization method.

[0066] 3) Oil Red O staining to detect lipid accumulation in AML-12 cells induced by high glucose and high fat: AML-12 cells were cultured at 5×10 4 / ml density Nunc TM Lab-Tek TMChamber slides (Thermo, Cat: 177402) were transfected with miR-320-3p mimics overnight according to the experimental method 1). 24 hours after cell transfection, 0.15 mM palmitic acid and 30 mM glucose (abbreviated as PA+Glu, PA from Sigma Cat: P0500-10G; Glu from Sinopharm Chemical Reagent Co., Ltd., Cat: 63005518) were used to induce lipid accumulation in hepatocytes and divided into 4 groups: NC mimics-Vehicle, NC mimics-PA+Glu, miR-320-3pmimics-Vehicle, miR-320-3p mimics-PA+Glu. PA+Glu or corresponding solvents were added and incubated in a cell culture incubator at 37°C and 5% CO2 for 24 hours. After incubation, the cells were washed once with PBS (Corning, Cat: 21-040-CV), then fixed with 4% paraformaldehyde at room temperature for 20 minutes, washed twice with PBS, and dried naturally to remove moisture from the surface of the cells. The slides were then immersed in the prepared oil red working solution for staining for 40 minutes, and washed twice with 60% isopropanol after staining. Then, hematoxylin staining was performed for 10 seconds, rinsed with running water for about 3 minutes, and sealed with 70% glycerol, and finally examined under a microscope.

[0067] 3.2 Experimental Results

[0068] Overexpression of miR-320-3p in AML-12 cells inhibits lipid accumulation induced by PA+Glu ( Figure 7 AB in the middle). The results of RT-qPCR detection of miR-320-3p showed that miR-320-3p was successfully overexpressed in AML-12 cells, and the overexpression fold increased by about 400 times ( Figure 7 Oil red O staining results showed that PA+Glu could significantly induce lipid accumulation in AML-12 cells. The lipid accumulation of overexpressed miR-320-3p in the absence of PA+Glu induction was similar to that of the negative control without PA+Glu induction. However, overexpression of miR-320-3p could significantly inhibit the lipid accumulation induced by PA+Glu under the condition of PA+Glu induction ( Figure 7 (middle B).

[0069] Sequence information:

[0070] Precursor sequence: SEQ ID NO: 1: gccucgccgcccuccGCCUUCUCUUCCCGGUUCUUCCCggagucgggAAAAGCUGGGUUGAGAGGGCGAaaaaggauguggg

[0071] miR-320-3p: SEQ ID NO:2: AAAAGCTGGGTTGAGAGGGCG

[0072] miR-320-5p: SEQ ID NO:3: GCCUUCUCUUCCCGGUUCUUCCC

[0073] SEQ ID NO:4:

[0074] ACAACCTCACCTCCGACTAGAGCAACCACGGGCCGCGGGTCTCCGGGCAAGGCGGAAGTCTGCGTGGCAAGGACCGGGCGCTGCCATCTTACCCTGGGGCGGAAGTGACATCAAGGGGGCGTGACCTGACCATAGTATTTATCCGACGGTGCCTCGCCGCCCTCCGCCTTCTCTTCCCGGTTCTTCCCGGAGTCGGGAAAAGCTGGGTTGAGAGGGCGAAAAAGGATGTGGGAGGTGGACTGTAAGCTGTGCCGGGGTGTGACTCGTGGGGGCGTGTCTCGGCCCCTGGCAGGGAGTAGAGGTGCGGTCCTCGGGGTCGGAGGTGGAGGGGCTCCAAGGTCGCCTACCTGCTGTATGTGGAGTCCACACTGCGCAGCCTCTG

[0075] miR-320-3p mimics:

[0076] Sense strand (5'-3') AAAAGCTGGGTTGAGAGGGCG (SEQ ID NO:2)

[0077] Antisense strand (5'-3') GCCCUCUCAACCCAGCUUUUUU (SEQ ID NO:5)

[0078] NC mimics:

[0079] Sense strand (5'-3') UUGUACUACACAAAAGUACUG (SEQ ID NO:6)

[0080] Antisense strand (5'-3') GUACUUUUGUGUAGUACAAUU (SEQ ID NO:7)

Claims

1. Use of microRNA of the miR-320 cluster or its precursor sequence, derivative sequence, or their expression vector, or their agonist in the preparation of a drug for preventing or treating non-alcoholic fatty liver disease.

2. The use according to claim 1, wherein The microRNAs of the miR-320 cluster include miR-320a, miR-320b, miR-320c, miR-320d, miR-320e, miR-320-3p, and miR-320-5p.

3. The use according to claim 1, wherein The microRNA of the miR-320 cluster is miR-320-3p or miR-320a, and its sequence is shown in SEQ ID NO:2; or the microRNA of the miR-320 cluster is miR-320-5p, and its sequence is shown in SEQ ID NO:

3.

4. The use according to claim 1, wherein The precursor sequence of the microRNA of the miR-320 cluster is shown in SEQ ID NO:

1.

5. The use according to claim 1, wherein The derived sequence refers to a sequence formed by deletion, insertion and / or substitution of a single base from the microRNA of the miR-320 cluster or its precursor sequence, and / or The derived sequence comprises a double-stranded RNA of a microRNA containing the miR-320 cluster, preferably, the double-stranded RNA is further modified, and / or The derivative sequence includes a microRNA of the miR-320 cluster or a modified derivative of its precursor sequence, and / or The microRNA of the miR-320 cluster or its precursor sequence or derivative sequence contains at least one modified nucleotide.

6. The use according to claim 5, wherein The modifications include sugar modification of nucleotides, modification of the connection mode between nucleotides, cholesterol modification, locked nucleotide modification, peptide modification, lipid modification, halogen modification, hydrocarbon modification, nucleic acid modification, Preferably, the sugar modification of the nucleotide includes 2-O-methyl sugar modification, 2-O-methoxyethyl sugar modification, 2-fluoro sugar modification, sugar ring modification, Preferably, the modification of the connection mode between nucleotides includes thiosulfate modification, phosphoroalkylation modification, and / or Such modifications include a "TT" modification.

7. The use according to claim 1, wherein The expression vector is a recombinant vector containing a deoxyribonucleotide sequence encoding the microRNA of the miR-320 cluster or its precursor sequence and derivative sequence. Preferably, the expression vector includes a viral vector and a non-viral vector.

8. The use according to claim 7, wherein The viral vector is constructed using adenovirus or adeno-associated virus. Preferably, the adeno-associated virus is a serotype adeno-associated virus. Preferably, the serotype adeno-associated virus includes AAV2, AAV5, AAV8, AAV9 and AAV-DJ. Preferably, the viral vector uses a liver-specific promoter, such as ALB, TBG and ApoEHCR-hAAT. The non-viral vector achieves overexpression of miR-320 in the liver by a method selected from lipid nanoparticle encapsulation, surface modification of galactosamine in the delivery system, and exosomes targeting the liver.

9. The use according to claim 1, wherein The agonist of the microRNA of the miR-320 cluster or its precursor sequence includes a substance that can promote the expression of the microRNA of the miR-320 cluster or its precursor sequence, and / or a substance that can promote the activity of the microRNA of the miR-320 cluster or its precursor sequence.

10. The use according to claim 1, wherein The non-alcoholic fatty liver disease includes simple fatty liver, steatohepatitis (NASH), NASH-related cirrhosis and hepatocellular carcinoma.

Images