Preparation method of photo-activated CRISPR (clustered regularly interspaced short palindromic repeats) polymer nano-carrier for specific gene therapy

Abstract

The invention discloses a preparation method of a photo-activated CRISPR (clustered regularly interspaced short palindromic repeats) high-molecular nano-carrier for specific gene therapy, which comprises the following steps: preparing a CRISPR high-molecular nano-carrier, preparing a stable polymer-DNA (deoxyribonucleic acid) carrier, preparing a polymer-DNA-sgRNA (single guide ribonucleic acid), and verifying the performance of an organic high-molecular nano-carrier. And verifying the performance and curative effect of the organic polymer nano-carrier on the cellular level, and verifying the performance and curative effect of the organic polymer nano-carrier on the animal level. The preparation condition of the nano-carrier is mild, safe and reliable, accurate regulation and control of CRISPR / Cas9 delivery and activity can be realized by using the NIR photo-responsive nano-carrier, sgRNA release is realized, and the nano-carrier has a relatively good anti-tumor effect.

Description

Technical Field

[0001] The present invention belongs to the technical field of organic semiconductor nanomaterials, and in particular relates to a method for preparing a light-activated CRISPR polymer nanocarrier for specific gene therapy. Background Art

[0002] Genome editing based on the clustered regularly interspaced short palindromic repeats / CRISPR-associated protein (CRISPR / Cas) system has been shown to be promising for the treatment of cancer and genetic diseases. By disrupting or correcting genes related to cell growth, survival, and drug resistance, the need for frequent injections can be avoided and the chance of recurrence can be prevented, providing great advantages for cancer treatment. However, due to the poor delivery and selectivity of the CRISPR / Cas system to the target, resulting in low efficacy and a series of side effects, it has been challenging to use the CRISPR / Cas system as an in vivo therapeutic for cancer. Various methods have been developed for non-viral delivery of CRISPR / Cas mechanisms, such as lipid preparations, polymers, and inorganic nanoparticles, and non-viral CRISPR / Cas delivery systems have become an alternative to viral delivery methods. Efficient and precise delivery of CRISPR into the cell nucleus is a basic prerequisite for effectively exerting its gene editing effect and realizing clinical application. However, most of the current delivery systems will cause off-target effects, resulting in serious toxic side effects. In response to the key issue of clinical transformation, "how to achieve specific enrichment of CRISPR at the lesion site and avoid off-target effects", the development of responsive non-viral vectors is an effective strategy. Through regional selective release, responsive vectors can increase the relative concentration of CRISPR in the lesion site, and only turn on activity when gene editing is required, which is expected to avoid the off-target risk of CRISPR. At present, both endogenous biochemical signals and exogenous physical signals in living bodies have been used to develop responsive gene vectors. Since endogenous biochemical signals exist in both normal tissues and lesions, the selectivity and specificity of biochemical signal responsive vectors are still not high. Relatively speaking, exogenous physical signals can achieve better selectivity and specificity. Among them, optical signals that are both economical, safe and accurate, especially near-infrared light with stronger tissue penetration ability, are the best control signals for responsive non-viral vectors, but NIR light-responsive non-viral vectors for CRISPR delivery and activity regulation are still rarely reported. The selection of optical materials is crucial for the development of light-responsive non-viral vectors. Summary of the invention

[0003] Semiconducting polymers (SPs) are a new type of biomedical material with a pure organic structure and biological inertness. They can avoid the toxicity risks caused by heavy metal ions, have good biocompatibility, and have been widely used in disease diagnosis and treatment. Through the design of the chemical structure, SPs can have different optical properties. In addition, compared with small molecule dyes, SPs have higher molar absorption coefficients and photostability. Therefore, SPs can be used as a good optical material for the development of NIR light-responsive carriers. In view of this, the present invention intends to develop a light-activated CRISPR polymer nanocarrier for specific gene therapy based on semiconductor polymers for CRISPR activity regulation and precision cancer gene therapy.

[0004] The method for preparing a light-activated CRISPR polymer nanocarrier for specific gene therapy of the present invention comprises:

[0005] Step S1: 50 mg of monomer 1, 45 mg of monomer 2, 4 mg of bistriphenylphosphine palladium dichloride, and 4 mg of tri(o-methylphenyl)phosphine were weighed and dissolved in 5 mL of anhydrous chlorobenzene and vigorously stirred at 100° C. for 10 min. After completion, the mixture was filtered and purified by Soxhlet extraction with methanol to obtain SPBr;

[0006] Step S2: 12 mg of SPBr and 3 mg of sodium azide were weighed and dissolved in a mixed solution of 6 mL of tetrahydrofuran and 3 mL of N,N-dimethylformamide, and stirred at room temperature for 24 h; the crude product was dissolved in dichloromethane, washed with brine three times, then collected in a flask, and vacuum dried to obtain polymer SPN3;

[0007] Step S3: 8 mg of SPN3 and 40 mg of DNBS-PEG were weighed and dissolved in 4 mL of tetrahydrofuran, and argon was filled through three vacuum-argon cycles. The mixture was stirred for 12 h at room temperature in a dark argon environment; after removing THF under reduced pressure, the obtained crude product was dissolved in water, dialyzed and freeze-dried to obtain the final product SP NH ;

[0008] Step S4: Take 1 mg of SP NH 4OD single-stranded DNA was dissolved in 2mL ultrapure water, and the pH was adjusted to 6 with 10mmol hydrochloric acid solution. After stirring at room temperature for 24h, ultrafiltration was performed to obtain a control nanosystem, which was recorded as SP ND ;

[0009] Step S5: Add 4 OD of guide RNA to the solution obtained in step S4, heat it in a water bath at 95°C for 2 min, cool it down, and finally cool it down to 25°C. After 5 cycles, ultrafiltration and washing are performed to obtain a photoactivated CRISPR polymer nanocarrier for specific gene therapy, which is denoted as SP NDR(G) .

[0010] The present invention further confirms the application of the preparation of the above-mentioned light-activated CRISPR polymer nanocarrier for specific gene therapy in anti-tumor. The present invention is simple and easy to operate, and the prepared organic polymer nanomaterial has good water solubility, colloidal stability and biocompatibility. The results of in vitro and in vivo animal experiments show that the organic polymer nanomaterial has a good anti-tumor effect. The organic polymer nanomaterial prepared by this method has potential applications in the field of anti-tumor precision treatment.

[0011] The preparation method of the present invention has the following advantages compared with the prior art:

[0012] The photoactivated CRISPR polymer nanocarrier for specific gene therapy prepared by the present invention has good water solubility and biocompatibility. The results of in vitro and in vivo experiments show that the system has good gene therapy performance and can effectively induce gene damage in cancer cells. The photoactivated CRISPR polymer nanocarrier for specific gene therapy prepared by this method has potential applications in the field of precise activation of anticancer preparations and cancer treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Schematic diagram of monomer structure; wherein a is a schematic diagram of the structure of monomer 1, and b is a schematic diagram of the structure of monomer 2.

[0014] Figure 2 Preparation of SP for the present invention NH , SP ND and SP NDR Transmission electron microscope image (a) and particle size distribution diagram (b);

[0015] Figure 3 SP prepared for the present invention NH , SP ND and SP NDR UV spectrum of

[0016] Figure 4 SP prepared for the present invention NH , SP ND and SP NDR Fluorescence emission spectrum of

[0017] Figure 5 SP prepared for the present inventionNH , SP ND and SP NDR Infrared spectrum of

[0018] Figure 6 SP prepared for the present invention NH , SP ND and SP NDR The photothermal heating curve;

[0019] Figure 7 SP prepared for the present invention NDR Release efficiency of sgRNA under different illumination times;

[0020] Figure 8 The present invention is a CCK-8 method test of A549 cells after PBS buffer (control) and SP prepared by the present invention NH and SP ND Cell viability after 6 h of treatment;

[0021] Fig. 9 The present invention uses flow cytometry to analyze the A549 cells after PBS buffer (control) and SP prepared by the present invention. ND and SP NDR Fluorescence intensity after 6 h of treatment.

[0022] Fig.10 A549 cells carrying green fluorescent protein GFP captured by an inverted fluorescence microscope were subjected to PBS buffer (control) and SP prepared by the present invention. ND and SP NDRG Fluorescence signal after treatment and illumination.

[0023] Fig.11 The present invention is a CCK-8 method test of A549 cells after PBS buffer (control) and SP prepared by the present invention NH and SP NDR Cell viability after 6 h of treatment and illumination;

[0024] Fig.12 SP prepared for the present invention ND and SP NDRG After in situ injection into the subcutaneous tumor of mice, the fluorescence signals of the mice were recorded after 5 minutes of illumination using an 808nm laser emitter at 0, 1, 2, and 4 days.

[0025] Fig.13 SP prepared for the present invention ND and SP NDR After in situ injection into the subcutaneous tumor of mice, the mice were irradiated with 808nm laser emitter for 10 minutes, and the changes in tumor volume of the mice were recorded within 30 days. DETAILED DESCRIPTION

[0026] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.

[0027] A method for preparing a light-activated CRISPR polymer nanocarrier for specific gene therapy comprises the following steps:

[0028] Step S1: Weigh 50 mg of monomer 1, 45 mg of monomer 2, 4 mg of bis(triphenylphosphine)palladium dichloride (PdCl2(PPh3)2), and 4 mg of tri(o-methylphenyl)phosphine (Tri-o-tolylphosphine), dissolve them in 5 mL of anhydrous chlorobenzene, and stir vigorously at 100°C for 10 min. After completion, filter the mixture, and purify it by Soxhlet extraction with methanol to obtain SPBr.

[0029] Step S2: Weigh 12 mg of SPBr and 3 mg of sodium azide (NaN3) and dissolve them in a mixed solution of 6 mL of tetrahydrofuran (THF) and 3 mL of N,N-dimethylformamide (DMF), and stir at room temperature for 24 h. The crude product is dissolved in dichloromethane, washed with brine three times, and then collected in a flask and vacuum dried to obtain polymer SPN3.

[0030] Step S3: 8 mg of SPN3 and 40 mg of DNBS-PEG were weighed and dissolved in 4 mL of tetrahydrofuran (THF), and argon was filled through three vacuum-argon cycles. The mixture was stirred for 12 h at room temperature in a dark argon environment. After removing THF under reduced pressure, the obtained crude product was dissolved in water, dialyzed and freeze-dried to obtain the final product SP NH .

[0031] Step S4: Take 1 mg of SP NH 4OD single-stranded DNA (ssDNA) was dissolved in 2mL ultrapure water, and the pH was adjusted to 6 with 10mmol hydrochloric acid solution. After stirring at room temperature for 24h, ultrafiltration was performed to obtain a control nanosystem, which was recorded as SP ND .

[0032] Step S5: Add 4 OD of guide RNA (sgRNA) to the solution obtained in step S4, heat it in a water bath at 95°C for 2 min, cool it down, and finally cool it down to 25°C. After 5 cycles, ultrafiltration and washing are performed to obtain a photoactivated CRISPR polymer nanocarrier for specific gene therapy, which is denoted as SP NDR(G) .

[0033] Preferably, the molar ratio of monomer 1 to monomer 2 in step S1 of the present invention is 0.075 mmol:0.072 mmol,

[0034] Preferably, the feed mass ratio of SPBr and NaN3 in step S2 of the present invention is 12:3.

[0035] Preferably, the feeding mass ratio of DNBS-PEG of SPN3 in step S3 of the present invention is 1:5.

[0036] Preferably, in step S4 of the present invention, NDR The sequences of the ssDNA complementary to the guide RNA are: AGCACAATTTGCCGTAGGTA and SP NDRG The sequence of the ssDNA complementary to the guide RNA is CCGGTGTTCAAGTCGCACAG and the optimal pH of the reaction system is 6.

[0037] Preferably, in step S4 of the present invention, SP NDR The crRNA sequence of sgRNA in is: TACCTACGGCAAATTGTGCT, SP NDRG The crRNA sequence of sgRNA in is GGCCACAAGTTCAGCGTGTC.

[0038] Preferably, the ultrafiltration washing conditions in step S4 and step S5 of the present invention are 30 kilodaltons and a rotation speed of 800-1200 r / min.

[0039] The technical solution of the present invention is described in detail below in conjunction with embodiments:

[0040] Example 1

[0041] 50 mg of monomer 1, 45 mg of monomer 2, 4 mg (PdCl2(PPh3)2), and 4 mg of Tri-o-tolylphosphine were dissolved in 5 mL of anhydrous chlorobenzene, where the structures of monomer 1 and monomer 2 are as follows: Figure 1As shown. Stir vigorously at 100°C for 10 minutes, filter the mixture after completion, and perform Soxhlet extraction and purification with methanol to obtain SPBr. Weigh 12 mg SPBr and 3 mg NaN3 and dissolve them in a mixed solution of 6 mL THF and 3 mL DMF, and stir at room temperature for 24 hours. The crude product is dissolved in dichloromethane, washed three times with brine, and then collected in a flask and dried under vacuum to obtain polymer SPN3. Weigh 8 mg SPN3 and 40 mg DNBS-PEG and dissolve them in 4 mL tetrahydrofuran (THF), fill with argon through three vacuum-argon cycles, and stir the mixture for 12 hours at room temperature and in a dark argon environment. After removing THF under reduced pressure, the crude product is dissolved in water, dialyzed and freeze-dried to obtain SP NH Take 1mg SP NH and 4OD ssDNA were dissolved in 2mL ultrapure water, and the pH was adjusted to 6 with 10mmol hydrochloric acid solution. After stirring at room temperature for 24h, ultrafiltration was performed to obtain the control nanosystem SP ND 4OD of sgRNA was added, heated at 95℃ for 2min in a water bath, then cooled down to 25℃, and the cycle was repeated 5 times before ultrafiltration and washing to obtain SP NDR(G) .

[0042] Example 2

[0043] The SP prepared by the present invention was detected by dynamic light scattering (DLS) and transmission electron microscopy (TEM). NH , SP ND and SP NDR The hydrated particle size and morphology ( Figure 2 ), use ultrapure water to make SP NH 3000 μL of a solution with a concentration of 10 μg / mL was taken, and 5 μL of the nanoparticle suspension was dropped on the surface of the copper mesh. After it was naturally dried, it was photographed using a JEM-2100 transmission electron microscope. The TEM image showed that the SP prepared by the present invention NH , SP ND and SP NDR The particle size of the SP prepared by the present invention is measured by using a Malvern particle size analyzer. NH , SP ND and SP NDR The hydration force particle sizes are 26.4nm, 20.2nm, and 50.3nm respectively.

[0044] Example 3

[0045] The SP prepared by the present invention was measured by ultraviolet visible absorption spectrometer. NH , SP ND and SP NDR The UV-visible absorption spectrum of Figure 3 , use ultrapure water to make SP NH 3000 μL of a solution with a concentration of 10 μg / mL was used to measure the ultraviolet absorption of different materials at wavelengths between 200 and 900 nm using an ultraviolet spectrophotometer. It was found that the SP prepared by the present invention ND and SP NDR There is obvious absorption at 260nm, because the ultraviolet absorption of RNA and DNA is related to the base, and at the same concentration, SP ND The absorbance here is lower than SP NDR The maximum absorbance peak here is 260 nm, and the different absorbance at 260 nm indicates the effective load of ssDNA and sgRNA.

[0046] Example 4

[0047] By comparing the SP prepared by the present invention NH , SP ND and SP NDR The fluorescence absorption spectrum of the SP prepared by the present invention is shown in FIG. NH , SP ND and SP NDR There are similar absorption peaks at 850 nm, indicating that the loading of ssDNA and sgRNA has no significant effect on fluorescence absorption.

[0048] Example 5

[0049] SP prepared by the present invention NH , SP ND and SP NDR Nanoparticles were prepared into SP using ultrapure water NH 1000 μL of a solution with a concentration of 100 μg / mL was frozen in a -80°C refrigerator for 24 hours, dried using a freeze dryer, and tested using a Fourier transform infrared spectrometer using the potassium bromide test method. Figure 5 As shown, it can be seen that SP ND and SP NDR At 950cm -1 and 1650cm -1 A new absorption peak appeared at 950cm -1 The peak at 1652 cm is attributed to the OPO antisymmetric stretching vibration of the ribose-phosphate backbone. -1 It belongs to the stretching vibration of the C=O double bond in the DNA base. The hydrogen bond between the two bases is intermolecular, 3200cm -1 The absorption peak at proves the generation of hydrogen bonds. What the hybrid double-stranded chain needs is hydrogen bonds, which have low bond energy but can form an interaction force sufficient to maintain its structural stability.

[0050] Example 6

[0051] SP prepared by the present invention NH , SP ND and SP NDR Nanoparticles were prepared into SP using ultrapure water NH 50 μL of a solution with a concentration of 800 μg / mL was placed in a 1.5 mL conical centrifuge tube and irradiated with an 808 nm laser emitter. It can be seen that SP NH , SP ND and SP NDR All three nanoparticles can be heated to 79°C in a short time to release sgRNA, which also proves that the loading of nucleic acid has an effect on SP NH The heating performance is not affected.

[0052] Example 7

[0053] SP prepared by the present invention NH , SP ND and SP NDR Nanoparticles were prepared into SP using ultrapure water NH 50 μL of a solution with a concentration of 800 μg / mL was placed in a 1.5 mL conical centrifuge tube, irradiated with an 808 nm laser emitter, and diluted to 3000 μL with ultrapure water. After complete ultrafiltration, the lower layer of liquid was taken and the liquid volume was calculated. The fluorescence intensity of the lower supernatant was measured using a fluorescence spectrometer to calculate the release amount of sgRNA-Cy3, such as Figure 7 As shown, after 120s of illumination, the release amount of sgRNA can reach 42%.

[0054] Example 8

[0055] A549 cells were used as model cells to evaluate the SP prepared by the present invention. ND and SP NDR Effects of two nanoparticles on cell proliferation. Different concentrations of SP were prepared with sterile PBS. ND and SP NDR Nanoparticle solution was sterilized by UV irradiation overnight. ND and SP NDR Nanoparticles (SP ND and SP NDRThe concentrations of CCK-8 solution were 100, 200, 300, 400, 500, 600, 700, and 800 μg / mL. Five replicate wells were set up for each group, and a blank group was set up at the same time. The cells were cultured in a 37°C, 5% CO2 cell culture incubator for 6 hours. The culture medium containing 10% CCK-8 solution was prepared and added to the well plate. The culture plate with CCK-8 was placed in a 37°C, 5% CO2 incubator and continued to incubate for 1.5-2 hours. The 96-well plate was taken out, and the OD value of each well at a wavelength of 450nm was detected using an enzyme reader. The effects of different concentrations of materials on cell proliferation were compared with the buffer PBS as the control, and the cell viability (such as Figure 8 The final results showed that the cell survival rate was above 80%, which fully demonstrated that the synthesized SP ND and SP NDR It has good biosafety and can be used for in vivo treatment.

[0056] Example 9

[0057] Flow cytometry was used to evaluate the response of A549 cells to SP ND and SP NDR Intake. Fig. 9 As shown, A549 cells and SP prepared by the present invention ND and SP NDR (800 μg / mL) for 6 h, the cells were collected and washed with PBS, and the mean fluorescence intensity of the cells was measured by flow cytometry to measure the effect of A549 cells on SP ND and SP NDR As can be seen from the figure, compared with no SP ND and SP NDR For A549 cells, co-incubation with SP ND and SP NDR The co-incubated A549 cells showed a stronger fluorescence signal. This indicates that the SP prepared by the present invention ND and SP NDR Can be efficiently taken up by A549 cells.

[0058] Example 10

[0059] Fluorescence microscopy was used to observe the fluorescence signals of cells to evaluate the effective gene knockout of nanoparticles in cells. Fig.10 As shown, A549 cells carrying GFP green fluorescent protein were used as model cells to evaluate the SP prepared by the present invention. ND and SP NDRG (800 μg / mL) The gene knockout efficiency of the two nanoparticles in vitro. ND and SP NDRGThe cells were co-cultured with 1640RPMI medium (50 μL) and Cas9 active protein (50 μg / 100 mL) for 6 h. The cells were illuminated with an 808 nm laser emitter (1 W / cm 2 ) for 30 seconds, and then irradiate again for 30 seconds after an interval of 30 seconds. After five cycles, the cells were placed in a cell culture incubator and cultured for 2 hours. After the nanoparticles were discarded, the cells were cultured for another 72 hours and the fluorescence signal of the cells was measured using an inverted fluorescence microscope.

[0060] Embodiment 11

[0061] CCK-8 method was used to evaluate SP ND and SP NDR The therapeutic effect on A549 cells. Fig.11 As shown, A549 cells and SP prepared by the present invention ND and SP NDR (50 μL, 800 μg / mL) and 1640RPMI medium with Cas9 active protein (50 μg / 100 mL) were co-cultured for 6 h, and an 808 nm laser emitter (1 W / cm 2 ) for 30 seconds, and then irradiated for 30 seconds again after an interval of 30 seconds. This cycle was repeated 5 times and then cultured for 2 hours. After the nanoparticles were discarded and cultured for 72 hours, the survival rate of A549 cells was evaluated by CCK-8 method. As can be seen from the figure, compared with the other treatment groups, the SP treated with light NDR The cell viability was significantly lower (only 22.7% of A549 cells survived). NDR Laser irradiation can effectively cause the death of A549 cells.

[0062] Example 12

[0063] In vivo fluorescence imaging was used to evaluate the effective gene knockout of nanoparticles in mice. Fig.12 The volume was 75 μL and the number of cells was 8 × 10 6 A549 cell suspension carrying GFP was injected into the subcutaneous tissue to construct a subcutaneous lung cancer tumor model. One week later, the tumor-bearing mice were randomly divided into 3 groups and injected with PBS, SP ND and SP NDRG (30 μL, 1000 μg / mL, Cas9 active protein (10 μg / mL)), 1 h later, using an 808 nm laser emitter (1 W / cm 2) for 120 seconds. After five cycles, the mice were imaged in vivo with near-infrared fluorescence using an IVIS imaging system with excitation and emission wavelengths of 488 nm and 510 nm, which was recorded as day 0. The collected images were analyzed using Living Image software. Data were collected every 24 hours to observe the changes in fluorescence intensity at the tumor site. Fig.12 It can be seen that SP NDRG After in situ injection into the mouse tumor, the fluorescence intensity of the tumor area gradually weakened after four days. This result shows that after the sgRNA (GFP) is released in the cell, it can correctly enter the cell nucleus for gene editing under the guidance of the cas9 protein, causing the GFP gene carried by the genome to be destroyed and unable to be correctly expressed. It also proves that the nanocarrier has good gene editing efficiency in vivo after correctly loading the guide RNA.

[0064] Embodiment 13

[0065] The tumor volume of tumor-bearing mice was monitored to evaluate the therapeutic effects of different experimental groups ( Fig.13 ). The volume was 75 μL and the number of cells was 8×10 6 A549 cell suspension was injected into the subcutaneous tissue to construct a subcutaneous lung cancer tumor model. ND and SP NDR (30 μL, 1000 μg / mL, Cas9 active protein (10 μg / mL)), 1 h later, using an 808 nm laser emitter (1 W / cm 2 ) for 120 seconds, 5 cycles, and the tumor volume was recorded every other day. After 30 days of treatment, all mice were euthanized, and the tumors were removed and photographed. As can be seen from the figure, SP treated with light NDR The tumor volume of the light-treated SP NDR It can effectively kill A549 cancer cells.

[0066] A method for preparing a light-activated CRISPR polymer nanocarrier for specific gene therapy, including: preparation of CRISPR polymer nanocarrier, preparation of a stable polymer-DNA carrier, preparation of polymer-DNA-sgRNA, performance verification of organic polymer nanocarrier, performance and efficacy verification of organic polymer nanocarrier at the cellular level, and performance and efficacy verification of organic polymer nanocarrier at the animal level. The preparation conditions of this nanocarrier are mild, safe and reliable, and the NIR light-responsive nanocarrier can be used to achieve precise regulation of CRISPR / Cas9 delivery and activity, achieve the release of sgRNA, and have good anti-tumor effects.

Claims

1. A method for preparing a photoactivated CRISPR polymer nanocarrier for specific gene therapy, characterized in that: The steps include: Step S1: 50 mg of monomer 1, 45 mg of monomer 2, 4 mg of bistriphenylphosphine palladium dichloride, and 4 mg of tri(o-methylphenyl)phosphine were weighed and dissolved in 5 mL of anhydrous chlorobenzene and vigorously stirred at 100° C. for 10 min. After completion, the mixture was filtered and purified by Soxhlet extraction with methanol to obtain SPBr; Step S2: 12 mg of SPBr and 3 mg of sodium azide were weighed and dissolved in a mixed solution of 6 mL of tetrahydrofuran and 3 mL of N,N-dimethylformamide, and stirred at room temperature for 24 h; the crude product was dissolved in dichloromethane, washed with brine three times, then collected in a flask, and vacuum dried to obtain polymer SPN3; Step S3: 8 mg of SPN3 and 40 mg of DNBS-PEG were weighed and dissolved in 4 mL of tetrahydrofuran, and argon was filled through three vacuum-argon cycles. The mixture was stirred for 12 h at room temperature in a dark argon environment; after removing THF under reduced pressure, the obtained crude product was dissolved in water, dialyzed and freeze-dried to obtain the final product SP NH ; Step S4: Take 1 mg of SP NH and 4OD single-stranded DNA were dissolved in 2mL ultrapure water, and the pH was adjusted to 6 with 10mmol hydrochloric acid solution. After stirring at room temperature for 24h, ultrafiltration was performed to obtain a control nanosystem, which was recorded as SP ND ; Step S5: Add 4 OD of guide RNA to the solution obtained in step S4, heat it in a water bath at 95°C for 2 min, cool it down, and finally cool it down to 25°C. After 5 cycles, ultrafiltration and washing are performed to obtain a photoactivated CRISPR polymer nanocarrier for specific gene therapy, which is denoted as SP NDR(G) .

2. The method for preparing a light-activated CRISPR polymer nanocarrier for specific gene therapy according to claim 1, characterized in that: The molar ratio of monomer 1 to monomer 2 in step S1 is 0.075 mmol:0.072 mmol.

3. The method for preparing a light-activated CRISPR polymer nanocarrier for specific gene therapy according to claim 1, characterized in that: The feed mass ratio of SPBr and NaN3 in step S2 is 12:

3.

4. The method for preparing a light-activated CRISPR polymer nanocarrier for specific gene therapy according to claim 1, characterized in that: The feeding mass ratio of DNBS-PEG of SPN3 in step S3 is 1:

5.

5. The method for preparing a light-activated CRISPR polymer nanocarrier for specific gene therapy according to claim 1, characterized in that: In step S4, SP NDR The sequences of the ssDNA complementary to the guide RNA are: AGCACAATTTGCCGTAGGTA and SP NDRG The sequence of the ssDNA complementary to the guide RNA is CCGGTGTTCAAGTCGCACAG and the optimal pH of the reaction system is 6.

6. The method for preparing a light-activated CRISPR polymer nanocarrier for specific gene therapy according to claim 1, characterized in that: In step S4, SP NDR The crRNA sequence of sgRNA in is: TACCTACGGCAAATTGTGCT, SP NDRG The crRNA sequence of sgRNA in is GGCCACAAGTTCAGCGTGTC.

7. The method for preparing a light-activated CRISPR polymer nanocarrier for specific gene therapy according to claim 1, characterized in that: The ultrafiltration washing conditions in step S4 and step S5 are 30 kilodaltons and a rotation speed of 800-1200 r / min.

Images