Auricularia polytricha strain and application thereof

Abstract

The invention relates to the technical field of edible mushrooms, and discloses an auricularia polytricha strain and application thereof. The Auricularia polytricha Ji 5 disclosed by the invention is preserved in the China Center for Type Culture Collection on October 23, 2024, and the preservation number of the Auricularia polytricha Ji 5 is CCTCC (China Center for Type Culture Collection) NO: M 20242312. The auricularia polytricha Ji 5 sporocarp has excellent agronomic characters such as less fluff, regular auricular piece edge, small auricular base and high rehydration rate, can be used for screening breeding, cultivation planting and fermentation extraction of auricularia polytricha, and can also be used for deep processing of food or health care products.

Description

Technical Field

[0001] The invention relates to the technical field of edible fungi, and in particular to a new Auricularia auriculariae strain Ji 5 and application thereof. Background Art

[0002] Auricularia polytricha belongs to the Auriculariaceae family and the genus Auricularia. Auricularia polytricha has a certain advantage among many edible fungi products. Its unique flavor and crisp taste have earned it the reputation of "jellyfish skin on wood". According to the "Chinese Materia Medica", Auricularia polytricha has great medicinal value and has the effects of nourishing blood and activating blood circulation, clearing the lungs and replenishing qi, nourishing yin and strengthening yang, stopping bleeding and relieving pain, and improving immunity. Auricularia polytricha contains a variety of active ingredients, such as polysaccharides, proteins, vitamins, etc. Its main active ingredient is polysaccharides, which have antibacterial, anti-thrombotic, lipid-lowering, antioxidant, and anti-epileptic effects.

[0003] Different varieties of Auricularia auricula exhibit different agronomic traits during the planting and production process, such as the white Auricularia auricula AJB1501 strain with a preservation number of CGMCC NO.14555 and the pink Auricularia auricula ZJFME001 strain with a preservation number of CGMCC NO.40900. Screening new strains of Auricularia auricula with high-quality agronomic traits can not only promote the sustainable and healthy development of the edible fungus industry, but also serve as an important source for the creation of new germplasm and the breeding of new products. Summary of the invention

[0004] The invention aims to provide a fungus strain Ji 5 and application thereof, wherein the strain has excellent agronomic traits of less villi, regular auricle edges, small auricle base and high rehydration rate.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention provides a polytricha strain. The polytricha strain is polytricha (Auricularia polytricha) Ji 5, and the preservation number is CCTCC NO: M 20242312.

[0007] In the present invention, the wild Auricularia auricula Ji 5 was collected from Guniujiang National Nature Reserve, Huangshan City, Anhui Province, and has excellent agronomic characteristics. After sequencing, the ITS sequence of the black fungus strain of the present invention is shown in SEQ ID NO.1, which belongs to the Auricularia auricula variety.

[0008] The present invention also includes the following substances of the above-mentioned Auricularia auricularia strain:

[0009] (1) Basidiospore;

[0010] (2) mycelium;

[0011] (3) fruiting body;

[0012] (4) a mushroom stick containing a fungus strain;

[0013] (5) Fermentation broth of Auricularia auricularia strain.

[0014] The present invention studies the optimal culture conditions of the above-mentioned Auricularia auricula strain and provides a culture medium for culturing the above-mentioned Auricularia auricula strain, wherein per liter of the culture medium is added with: 200g of potato, 20.00g of sucrose, 3.00g of diammonium hydrogen phosphate, 75.00g of sawdust, 3.00g of potassium dihydrogen phosphate and 1.00g of magnesium sulfate.

[0015] The present invention also provides a method for culturing the above-mentioned Auricularia auricularia strain, which comprises inoculating the above-mentioned Auricularia auricularia strain into the above-mentioned culture medium of the present invention, adjusting the pH of the culture medium to 5-7, and culturing the culture medium at 25-27° C. in the dark.

[0016] Another object of the present invention is to provide the use of the above-mentioned Auricularia auricularia strain and the substances produced therefrom in any of the following:

[0017] (1) Screening and breeding of Auricularia auricularia;

[0018] (2) Cultivation of Auricularia auricularia;

[0019] (3) Extraction of Auricularia auricularia components;

[0020] (4) Processing of Auricularia auricularia food and health products.

[0021] Beneficial effects of the present invention:

[0022] The invention provides a fungus strain Ji 5, which was collected in Guniujiang National Nature Reserve, Huangshan City, Anhui Province, and is now preserved in China Center for Type Culture Collection, with a preservation number of CCTCC NO: M 20242312. The fungus Ji 5 fruiting body has the characteristics of excellent agronomic traits such as less villi, regular ear edge, small ear base, high rehydration rate, etc., and provides an important source for the creation of new germplasm of fungus and the breeding of new products.

[0023] The present invention uses the mycelium of Auricularia auricula Ji 5 as a test material to design single factor experiments, orthogonal experiments, etc., explores the optimal growth conditions suitable for wild Auricularia auricula strain Ji 5 from aspects such as carbon source, nitrogen source, sawdust, inorganic salts and their different levels, and explores the environmental conditions suitable for its growth through its growth conditions under different temperature and pH conditions. On this basis, a culture medium and a culture method for the above-mentioned Auricularia auricula strain are provided, which lays a foundation for the cultivation of wild Auricularia auricula Ji 5, promotes the development and utilization of new Auricularia auricula germplasm resources, and promotes the sustainable development of my country's Auricularia auricula industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Effects of different basal culture media on the mycelial growth rate of wild Auricularia auricularia strain Ji 5.

[0025] Figure 2 Effects of different carbon sources on the mycelial growth rate of wild Auricularia auricularia strain Ji 5.

[0026] Figure 3 Effects of different carbon sources on the colony morphology of wild Auricularia auricularia strain Ji 5.

[0027] Figure 4 Effects of different nitrogen sources on the mycelial growth rate of wild Auricularia auricularia strain Ji 5.

[0028] Figure 5 Effects of different nitrogen sources on the colony morphology of wild Auricularia auricularia strain Ji 5.

[0029] Figure 6 Effects of different sawdust contents on the mycelial growth rate of wild Auricularia auricularia auricularia strain Ji 5.

[0030] Figure 7 Effects of different sawdust contents on the colony morphology of wild Auricularia auricularia strain Ji 5.

[0031] Figure 8 Effects of different influencing factors at different levels on the colony morphology of wild Auricularia auricularia strain Ji 5.

[0032] Fig. 9 Effect of different pH on the mycelial growth rate of wild Auricularia auricularia strain Ji 5.

[0033] Fig.10 Effects of different pH values ​​on the colony morphology of wild Auricularia auricularia strain Ji 5.

[0034] Fig.11 Effects of different temperatures on the mycelial growth rate of wild Auricularia auricularia strain Ji 5.

[0035] Fig.12 Effects of different temperatures on the colony morphology of wild Auricularia auricularia strain Ji 5.

[0036] Fig.13 The fruiting body morphology of wild Auricularia auricularia JI 5.

[0037] Fig.14 Phylogenetic tree constructed based on the ITS sequence of wild Auricularia auricularia strain Ji5.

[0038] Fig.15 Picture of Ji 5 and commercial dried fruiting bodies of Auricularia auriculariae from different origins.

[0039] Fig.16 Images of the hair on the back of Ji-5 and commercial Auricularia auricula from different origins. The scale bars in the images are all 250 microns.

[0040] Fig.17 The picture of Ji 5 and commercial Auricularia auriculariae fruiting bodies from different origins after rehydration.

[0041] Fig.18 The rehydration rate of dried fruiting bodies of Ji-5 and commercial Auricularia auriculariae from different origins.

[0042] Biological deposit information

[0043] The Auricularia polytricha Ji 5 of the present invention was deposited in the China Center for Type Culture Collection on October 23, 2024, with the address being Wuhan University, Wuhan, China, and the deposit number being CCTCC NO: M 20242312. DETAILED DESCRIPTION

[0044] The invention provides a fungus strain, which is Auricularia polytricha Ji 5, which is deposited in China Center for Type Culture Collection with a deposit number of CCTCC NO: M 20242312. The strain was collected in Guniujiang National Nature Reserve, Huangshan City, Anhui Province, and has excellent agronomic traits. The dry product of wild fungus Ji 5 has small ear pieces, regular edges, few back hairs, high rehydration rate, regular and wrinkle-free ear pieces after rehydration, moderate ear piece thickness, significantly smaller ear pieces and ear bases than other varieties, and darker lightness than other varieties of fruiting bodies.

[0045] The present invention also includes the basidiospores, mycelium and fruiting bodies of the Auricularia auriculariae Ji 5, fungus sticks containing the Auricularia auriculariae strain, and fermentation liquid fermented with the Auricularia auriculariae strain.

[0046] The present invention takes Auricularia auricula Ji 5 as the research object, uses a single factor experiment to explore the effects of different carbon sources, nitrogen sources and different contents of sawdust on the mycelial growth rate and colony morphology of wild Auricularia auricula Ji 5, and screens out the optimal carbon source, optimal nitrogen source and optimal sawdust content suitable for the growth of wild Auricularia auricula Ji 5; through orthogonal experiments, explore the effects of different levels of different influencing factors on the colony growth of wild Auricularia auricula Ji 5, optimize the culture medium formula, and determine the optimal culture medium ratio suitable for the growth of wild Auricularia auricula Ji 5. Provided is a culture medium suitable for culturing Auricularia auricula Ji 5, wherein per liter of the culture medium is added: 200g of potato, 20.00g of sucrose, 3.00g of diammonium hydrogen phosphate, 75.00g of sawdust, 3.00g of potassium dihydrogen phosphate, and 1.00g of magnesium sulfate. Select a solid culture medium or a liquid culture medium according to the purpose of cultivation. As an embodiment, agar is added to the liquid culture medium to form a solid culture medium. The optional amount of agar added is 15.00-20.00g / L. As an embodiment, the size of the sawdust is 3 to 5 mm. The culture medium of the present invention has the greatest effect on promoting the growth rate of Auricularia auriculariae Ji 5 mycelium, and the mycelium is relatively long, white, dense and grows evenly.

[0047] The present invention uses the above-mentioned culture medium as a basis, and cultures the culture environments with different pH and different temperatures to screen out a growth environment suitable for the growth of Auricularia auricula Ji 5. A culture method for the above-mentioned Auricularia auricula strain Ji 5 is provided, wherein the Auricularia auricula strain Ji 5 is inoculated into the above-mentioned culture medium of the present invention, and the pH of the culture medium is adjusted to 5 to 7, and the optional pH is 5, 5.5, 6, 6.5, and 7. Culture is carried out at 25 to 27°C in the dark, and the optional temperatures are 25°C, 25.5°C, 26°C, 26.5°C, and 27°C. The above-mentioned culture conditions are suitable for the growth of Auricularia auricula Ji 5, and the mycelium grows densely and the colony morphology is relatively regular.

[0048] The invention cultivates Auricularia auricula Ji 5 in a cultivation material, wherein the cultivation material formula can be selected as follows: 50% sawdust, 30% cottonseed husk, 18% bran, 1% gypsum and 1% sucrose. The total fresh yield biological efficiency of the cultivated Auricularia auricula Ji 5 is 100.05%, and the total dry yield biological efficiency is 11.89%. The indicators of the cultivated and picked fresh ear slices are ear slice thickness of 2.08±0.17mm, ear base thickness of 7.28±1.05mm, ear slice length of 50.65±5.47mm, ear slice width of 80.91±9.96mm, ear slice length-width ratio of 0.63±0.06, ear slice belly color value L* value of 22.00±1.72, less tendons and no wrinkles, regular edges and single ear slices.

[0049] The ITS sequence of the black fungus strain of the present invention is shown in SEQ ID NO. 1. The phylogenetic tree constructed based on the ITS sequences of the wild Auricularia auricula strain Ji 5 and other Auricularia auricula varieties proves that Ji 5 belongs to the same branch as the Auricularia auricula strain, and it is determined to be a new Auricularia auricula strain, named Ji 5. Compared with the fruiting bodies of Auricularia auricula commercially available in different regions, the obtained new Auricularia auricula strain Ji 5 has excellent agronomic traits such as less villi, regular ear edge, small ear base, and high rehydration rate.

[0050] The new strain Ji5 of Auricularia auricula obtained by field collection, separation and purification of the present invention can be used in the screening, breeding and cultivation of Auricularia auricula, including but not limited to the basidiospores, mycelium and fruiting bodies of the wild Auricularia auricula strain Ji5, and the culture medium and culture method for cultivating Auricularia auricula Ji5 of the present invention. The new strain Ji5 of Auricularia auricula of the present invention can also be used in the extraction process of Auricularia auricula components, such as directly extracting melanin, polysaccharides and other substances from the mycelium or fruiting bodies of Auricularia auricula; or fermenting Auricularia auricula to extract active substances in the fermentation products. Those skilled in the art can perform deep processing on the new strain Ji5 of wild Auricularia auricula and the mycelium and fruiting bodies it produces, and add or not add other food materials or medicinal materials and other raw materials to make products such as food or health care products.

[0051] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0052] The Auricularia auricularia strain used in the following examples was isolated and purified from wild Auricularia auricularia collected from the Edible Fungi Research Laboratory of the Institute of Biology, Hebei Academy of Sciences in the Guniujiang National Nature Reserve, Huangshan City, Anhui Province.

[0053] Example 1

[0054] Collection and separation and purification of JI5

[0055] Choose a fungus that is intact in appearance and free of pests and diseases, and cut it with scissors. Try to cut the fungus intact to avoid breaking or damaging its mycelium. Wash the dirt and impurities on the surface of the fungus with clean water, transfer it to a clean bench, wash it with sterile distilled water, and then gently wipe it twice with 75% alcohol wipes to disinfect the surface of its fruiting body. After disinfection, transfer it to a sterile empty culture dish and place it in the clean bench to blow with sterile air until there is no water stain on the surface.

[0056] Take out the fruiting body of the fungus from the culture dish, cut its epidermis with a scalpel, take the tissue block under the surface with tweezers (the tissue block should not be too large), gently press with sterile filter paper to absorb the moisture of the tissue block, then clamp the tissue block with tweezers, dip a small amount of penicillin sodium salt evenly on the surface, place it on the PDA resistance medium with gentamicin, and culture it at 25℃ in the dark for 5 to 7 days. When obvious white hyphae grow around the tissue block, immediately use tweezers to pick up the bacterial block and transfer it to the normal PDA medium, and culture it at 25℃ in the dark for 5 to 7 days for purification.

[0057] Basic culture medium screening

[0058] Basic medium 1: 200.00 g potato, 20.00 g glucose, 15.00 g agar, 2.00 g yeast powder, 3.00 g potassium dihydrogen phosphate, 1.50 g magnesium sulfate;

[0059] Basic medium 2: 200.00 g potato, 20.00 g glucose, 20.00 g agar, 2.00 g peptone, 3.00 g potassium dihydrogen phosphate, 1.50 g magnesium sulfate;

[0060] Basic medium 3: 200.00 g potato, 20.00 g glucose, 20.00 g agar, 2.00 g peptone, 2.00 g potassium dihydrogen phosphate, 1.00 g magnesium sulfate, 0.01 g vitamin B1;

[0061] Basic culture medium 4: 200.00 g potato, 20.00 g glucose, 15.00 g agar, 3.00 g peptone, 1.00 g potassium dihydrogen phosphate, and 0.45 g magnesium sulfate.

[0062] Use a Φ=5 puncher to punch holes on the edge of the mycelium of the test strain JI 5 plate, inoculate it on 4 basic culture media, and perform 6 replicates for each treatment. Place it in a constant temperature incubator and culture it in the dark at 25℃ and calculate its growth rate ( Figure 1 ), there was no significant difference in the growth rate of the colonies inoculated on basic medium 1, 2, and 3 (P>0.05), and the growth rate of the colonies inoculated on basic medium 4 was significantly lower than that of the other three media (P<0.05). Among basic media 1, 2, and 3, the error of the growth rate of the colonies inoculated on basic medium 2 was the smallest, and its growth rate was the most stable.

[0063] Example 2

[0064] Effects of different single factor tests on the mycelial growth of wild Auricularia auriculariae strain Ji 5

[0065] The carbon source glucose in the basic medium 2 obtained by screening in Example 1 was replaced by sucrose, lactose, dextrin powder, mannose, maltose, fructose, and soluble starch, respectively, with the addition amount unchanged and the pH natural; the nitrogen source peptone was replaced by yeast powder, beef extract, yeast extract powder, ammonium chloride, diammonium phosphate, and urea, respectively, with the addition amount unchanged and the pH natural; 50.00g, 100.00g, 200.00g, 300.00g, and 400.00g of sawdust were added to the basic medium 2, respectively, and the pH was natural. With the basic medium 2 as the control, 6 replicates were used for each treatment, and cultured at 25°C in the dark.

[0066] like Figure 2 As shown in the figure, the mycelial growth rate of wild Auricularia auricula Ji 5 in the medium with sucrose as the carbon source was particularly prominent, which was 46.75% higher than that in the control medium. The colony morphology was dense and regular in edge compared with the control group ( Figure 3 );like Figure 4 As shown in the figure, the mycelial growth rate of wild Auricularia auricula Ji 5 in the medium with diammonium phosphate as the nitrogen source was particularly prominent, which was increased by 38.17% compared with the mycelial growth rate of wild Auricularia auricula Ji 5 in the control medium. The colony morphology was dense and the edges were regular compared with the control group ( Figure 5 ); Effects of different sawdust contents on the colony morphology of wild Auricularia auriculariae Ji5 Figure 6 As shown in the figure, when the sawdust content was 100.00g, the mycelium had the strongest growth potential and the growth rate was 39.05% higher than that of the control. The mycelium was white and dense, and the colony edges were regular ( Figure 7 ).

[0067] Example 3

[0068] Effects of different levels of influencing factors on the growth of wild Auricularia auriculariae Ji5

[0069] Orthogonal experimental design was used to explore the effects of five factors, including carbon source, nitrogen source, sawdust, potassium dihydrogen phosphate, and magnesium sulfate, and their four levels on the colony growth of wild Auricularia auricula-Ji 5. The optimal culture medium ratio suitable for the growth of wild Auricularia auricula-Ji 5 was optimized. The orthogonal experimental level table of each factor is shown in Table 1.

[0070] Table 1 Orthogonal test level table of each factor

[0071]

[0072] Table 2 Orthogonal test design table

[0073]

[0074]

[0075] By analyzing the range of Table 2, it can be seen that the order of influence of various factors on the growth rate of wild Auricularia auricula Ji 5 mycelium is potassium dihydrogen phosphate>carbon source>sawdust>nitrogen source>magnesium sulfate, and the best composite ratio is A2B3C1D4E2, that is, the culture medium ratio that has the greatest effect on promoting the growth rate of wild Auricularia auricula Ji 5 mycelium is 200g potato, 15g agar, 20.00g carbon source, 3.00g nitrogen source, 75.00g sawdust, 3.00g potassium dihydrogen phosphate, and 1.00g magnesium sulfate.

[0076] Effects of different levels of different influencing factors on the colony morphology of wild Auricularia auriculariae Ji5 Figure 8 As shown, compared with the control group, the hyphae in culture media No. 1, 5, 8, 9, 10, 11, and 13 (culture media ratio reference table 2) were longer, but the growth was uneven, with dense hyphae in the center and sparse hyphae in the edge; the hyphae in culture media No. 1, 3, 4, 6, 12, 14, 15, and 16 were white and dense, and grew evenly, but were relatively short; the hyphae in culture media No. 7 were longer, and the hyphae were white and dense, and grew evenly.

[0077] Example 4

[0078] Effects of different growth conditions on the growth of Auricularia auricularia

[0079] The best formula screened in Example 3 was used as the culture medium, and the culture was placed under different temperatures (25°C, 27°C, 30°C, 32°C, 35°C, natural pH) and different pH conditions (5, 6, 7, 8, 9, 25°C) for 15 days. The mycelial growth radius was measured and the growth condition of the Auricularia auricula was observed.

[0080] like Fig. 9 The results show that when the pH of the culture medium is 5, the mycelial growth rate of Auricularia auricula is the fastest, which is 5.51 mm / d. When the pH is 6, the growth rate of Auricularia auricula is not significantly different from that of pH 5 (P>0.05). Therefore, the pH of the culture medium is suitable for the growth of Auricularia auricula when it is 5-7, and the mycelial growth is dense and the colony morphology is relatively regular ( Fig.10 );like Fig.11 As shown in the figure, when the culture temperature was 25℃, the growth rate of Auricularia auriculariae was the fastest at 5.28 mm / d, which was significantly higher than that at other temperatures (P<0.05). The hyphae were denser and more regular than those at other temperatures ( Fig.12 ).

[0081] Example 5

[0082] Determination of the fruiting body yield and morphological indexes of wild Auricularia auriculariae strain Ji 5

[0083] The cultivation material formula was as follows: 50% sawdust, 30% cottonseed husk, 18% bran, 1% gypsum and 1% sucrose. An ear-forming test was conducted. 600g of dry material was used in each bag and 36 bags were inoculated. The ears were cultured in an outdoor greenhouse at room temperature. Sprinkling irrigation was carried out for 1 hour in the morning and at noon. The yield and morphological indicators of the fruiting bodies of Auricularia auricula were determined through the ear-forming test.

[0084] The random sampling method is used to measure the yield. Ten rods are randomly selected, the yield of each rod is counted, and the average yield of each rod is calculated:

[0085] The fresh yield of one crop of Auricularia auricula (per stick) = the fresh weight of 10 sticks of Auricularia auricula / 10;

[0086] The dry weight of one crop of Auricularia auricula (per stick) = dry weight of 10 sticks of Auricularia auricula / 10;

[0087] Total fresh yield biological efficiency = total fresh weight / number of mushroom sticks / dry weight of mushroom sticks 600g;

[0088] Total dry yield biological efficiency = total dry weight / number of mushroom sticks / weight of dry material of mushroom sticks 600g;

[0089] As shown in Table 3, according to actual measurements, it can be calculated that Ji 5 can produce 8 ears, each with a growth period of 3 to 4 days, a total fresh yield of 21610 g, a total dry yield of 2567.31 g, and fresh yield ratios of each crop are 18.92%, 12.40%, 19.07%, 14.58%, 4.49%, 10.18%, 15.50%, and 4.86%, and dry yield ratios are 16.96%, 13.84%, 15.93%, 13.12%, 5.36%, 13.33%, 13.56%, and 7.90%. The total fresh yield biological efficiency of Ji 5 is 100.05%, and the total dry yield biological efficiency is 11.89%.

[0090] Table 3 Production statistics of Auricularia auricula-Ji 5

[0091]

[0092] The morphology of the fruiting body ear pieces of the wild Auricularia auriculariae strain Ji 5 is as follows Fig.13 As shown, there are few tendons and no wrinkles, regular edges, single ear piece, large ear piece, and thick ear piece. As shown in Table 4, the ear piece thickness is 2.08±0.17mm, the ear base thickness is 7.28±1.05mm, the ear piece length is 50.65±5.47mm, the ear piece width is 80.91±9.96mm, the ear piece length-to-width ratio is 0.63±0.06, and the ear piece L is 2.08±0.17mm, the ear base thickness is 7.28±1.05mm, the ear piece length-to-width ratio is 2.08±0.17mm ... * The value is 22.00±1.72 (brightness L * 0 to 100 represents from black to white).

[0093] Table 4 Morphological indexes of fruiting bodies of Auricularia auriculariae Ji 5

[0094]

[0095]

[0096] Example 5

[0097] Identification of wild Auricularia auriculariae strain JI5ITS

[0098] Using ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) as primers, the ITS sequence of the collected wild Auricularia auricula Ji 5 was amplified to obtain the 5' to 3' end of the wild Auricularia auricula strain Ji 5 sequence: (SEQ ID NO.1), and the neighbor-joining (NJ) method of MAGA6 software was used to perform 1000 bootstrap tests to construct a phylogenetic tree. Fig.14 As shown, it is shown that the Auricularia auricula-Ji 5 collected in the wild is a hairy Auricularia auricula variety.

[0099] Example 6

[0100] Comparison of agronomic traits between wild Auricularia auriculariae strain Ji 5 and commercial Auricularia auriculariae

[0101] Compared with the commercial Auricularia auricula produced in Northeast China, Fujian, Yunnan and Sichuan, the dried products are Fig.15 As shown, Ji 5 has smaller ear pieces and regular ear edge compared with the other four varieties; Fig.16 As shown, Ji 5 has shorter and sparser hair on the back and a smoother texture compared to the other four varieties.

[0102] After soaking in warm water for 2 hours, different varieties of fungus have the following shapes: Fig.17 As shown in Table 5, the ear pieces of Ji 5 have regular edges and no wrinkles, the ear pieces of Fujian have relatively regular edges and wrinkles, and the ear pieces of Northeast China, Sichuan, and Yunnan have jagged edges and wrinkles. As shown in Table 5, the ear pieces of Ji 5 have moderate thickness after rehydration, and the ear base is significantly smaller than that of the other four varieties (P<0.05). * From 0 to 100, it represents from black to white. The fruiting body color of Ji 5 is darker than that of the other four varieties. Fig.18 As shown, after soaking in warm water for 2 hours, the rehydration rate of Ji 5 was significantly higher than that of the other four varieties (P<0.05), and the rehydration rate was 636.70%.

[0103] Table 5 Determination of indexes after rehydration of Ji5 and commercial Auricularia auriculariae from different origins

[0104]

[0105] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A fungus strain, characterized in that The Auricularia polytricha strain is Auricularia polytricha Ji 5, and its preservation number is CCTCC NO: M 20242312.

2. The Auricularia auricularia strain according to claim 1, characterized in that The ITS sequence of the Auricularia auricularia strain is shown as SEQ ID NO.

1.

3. The basidiospores of the Auricularia auricularia strain according to any one of claims 1 to 2.

4. The mycelium of the Auricularia auricularia strain according to any one of claims 1 to 2.

5. The fruiting body of the Auricularia auricularia strain according to any one of claims 1 to 2.

6. A mushroom stick containing the Auricularia auricularia strain according to any one of claims 1 to 2.

7. The fermentation broth of the Auricularia auricularia strain according to any one of claims 1 to 2.

8. A culture medium for culturing the Auricularia auricularia strain according to any one of claims 1 to 2, characterized in that: Per liter of the culture medium, the following are added: 200 g of potato, 20.00 g of sucrose, 3.00 g of diammonium hydrogen phosphate, 75.00 g of sawdust, 3.00 g of potassium dihydrogen phosphate, and 1.00 g of magnesium sulfate.

9. The method for culturing the Auricularia auricularia strain according to any one of claims 1 to 2, characterized in that: The Auricularia auricularia strain is inoculated into the culture medium according to claim 8, the pH of the culture medium is adjusted to 5-7, and the culture is cultured at 25-27° C. in the dark.

10. Use of the Auricularia auricularia strain according to any one of claims 1 to 2, the basidiospore according to claim 3, the mycelium according to claim 4, the fruiting body according to claim 5, the mushroom stick according to claim 6 or the fermentation liquid according to claim 7 in any of the following: (1) Screening and breeding of Auricularia auricularia; (2) Cultivation of Auricularia auricularia; (3) Extraction of Auricularia auricularia components; (4) Processing of Auricularia auricularia food and health products.

Images