Trichoderma atroviride strain and application thereof in plant disease control

Abstract

The invention provides a trichoderma atroviride strain and application thereof in plant disease control, the trichoderma atroviride strain is JB-1, the preservation name of the trichoderma atroviride strain is Trichoderma atroviride, the trichoderma atroviride strain is preserved in China General Microbiological Culture Collection Center (CGMCC), and the preservation number of the trichoderma atroviride strain is CGMCC No.41740. Compared with the prior art, the endophytic trichoderma atroviride JB-1 has the advantages that the endophytic trichoderma atroviride JB-1 has a broad-spectrum plant pathogenic fungus antagonism effect and can be used for preventing and treating crop diseases; meanwhile, the strain is relatively safe to the growth and development of corn and the like and has a promoting effect on the growth and development of the corn within a certain concentration range, so that the strain is expected to be used as a bacterial fertilizer to play a good role in the growth and development of crops, a series of problems caused by excessive application of chemical pesticides are solved, and the strain has a wide application prospect in agricultural production.

Description

Technical Field

[0001] The present application relates to the technical field of microbial application, and in particular to a dark green Trichoderma strain and its application in plant disease prevention and control. Background Art

[0002] Corn stalk rot is a fungal soil-borne disease that occurs in a wide range, causes serious damage, and is difficult to control. In general years, the disease rate in the field is between 5% and 10%, and in severe cases, it can reach 30%, and in some highly susceptible varieties, the disease rate can be as high as 80% in local areas. According to literature reports, the pathogens that can cause corn stalk rot mainly include Fusarium spp. ( Fusarium sp.) fungi and Pythium spp. Pythium sp.) fungi. Breeding and planting disease-resistant varieties, combined with seed coating and field cultivation management are the main measures to prevent and control corn stalk rot. Soil treatment and seed coating can effectively prevent and control the occurrence and harm of corn stalk rot to a certain extent, but with the extensive use of chemical pesticides, the number of resistant strains is increasing year by year, resulting in a decrease in prevention efficiency, and also causing a series of problems such as environmental pollution and imbalance in the proportion of soil microbial populations. Biological control is increasingly favored in agricultural production and disease control due to its advantages such as low environmental pollution and high safety factor.

[0003] The biocontrol fungi reported to have control effects on Fusarium include Sphaerotheca saddleii ( Sphaerodermellahelvellae )、Glime Cordyceps sinensis( Glioecladiumroseum )、Pink Trichothecene( Trichotheciumtoseum ), Pythium spicata ( Pythiumacanthicum )、Exobasiliaceous bacteria( Exobasidiuom sp.), etc. Therefore, the exploration and utilization of biocontrol fungi have great potential in biological control.

[0004] Plant endophytes exist in the plant body and easily occupy favorable ecological niches. They can withstand the plant's own defense response and interact directly with pathogens, thus providing comprehensive and effective protection for plants. The special living environment of plant endophytes determines that endophytes have both the breadth and depth of theoretical research and the potential for application in many aspects. They are a new microbial resource with great potential and yet to be developed. Endophytic fungi are a kind of endophytes. At present, many scholars have isolated endophytic antagonistic fungi from bananas, tea, peppers, corn, rapeseed, wheat, Schisandra chinensis, apple trees and other plants. These endophytic antagonistic fungi have good control effects on a variety of plant diseases. Their rational use can reduce the environmental pollution caused by chemical pesticides, which is conducive to maintaining ecological balance and the sustainable development of modern agriculture. However, there are few reports on the control of corn stalk rot by endophytic fungi. Therefore, the measures to control corn Fusarium stalk rot by using endophytic fungi have good application prospects. Summary of the invention

[0005] In view of the above-mentioned technical limitations, the present application proposes a dark green Trichoderma strain and its application in plant disease prevention and control; it overcomes the deficiencies and defects mentioned in the background technology.

[0006] To achieve the above objectives, this application adopts the following technical solutions: The invention of the present application is to provide a dark green Trichoderma strain, the dark green Trichoderma strain is JB-1, and the deposited name is dark green Trichoderma Trichoderma atroviride , deposited in the General Microbiology Center CGMCC of China Microbiological Culture Collection Administration, the address of the deposit unit is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is December 30, 2024; the deposit number is CGMCC No.41740.

[0007] The inventor isolated and purified an endophytic Trichoderma strain JB-1 with a broad spectrum of antagonistic effects on plant pathogenic fungi from grape petioles. The strain has well-developed aerial mycelium on PDA, and the colony is fluffy to felt-like, white, thick and fluffy, with protrusions. The culture dish is full of growth in 3 days, and a large number of green conidia grow on the PDA after 7 days. Conidiophores are mostly unilaterally branched, and the angle between the branch and the conidiophore is nearly right angles. The phialopile is straight or curved, sometimes hooked, and can produce thick-walled spores. The conidia are mostly oval or elliptical in shape, and a strong coconut aroma can be produced during the culture process. The whole genome DNA of the endophytic antagonistic fungus JB-1 was extracted using a fungal genomic DNA kit. Primers ITS1 / ITS4 (SEQ ID No.3: 5′-TCCGTAGGTGAACCTGCGG-3′, SEQID No.4: 5′-TCCTCCGCTTATTGATATGC-3′) and primers TEF-F / TEF-R (SEQ ID No.5: 5′-ATGGGTAAGGARGACAAGAC-3′, SEQ ID No.6: 5′-GGARGTACCAGTSATCATGTT-3′) were selected. The primers were synthesized by Shanghai Biotech Co., Ltd. and PCR amplification was performed according to the method of White et al. The amplified product was sent to Shanghai Biotech for sequencing. The sequencing results were analyzed by Blast similarity, and the rDNA-ITS sequence of strain JB-1 was similar to that of Trichoderma aureum ( T.atroviride ) and has the highest homology with dark green Trichoderma with accession numbers OQ891660.1, MH284664.1, KR080062.1, MT023026.1, MW759400.1, OP162786.1 and KX379157.1 ( T.atroviride) had a similarity of 100.00%; the EF-1α gene sequence was similar to that of Trichoderma viridis with accession numbers KJ871100.1, EU280011.1 and OR487468.1 ( T.atroviride ) are all above 98.50%. Download the dark green Trichoderma ( T.atroviride ) strains and their similar species and outgroup strains, and then spliced ​​together to construct a phylogenetic tree based on rDNA-ITS and EF-1α using Mega7.0 software ( Figure 2 ), strain JB-1 and dark green Trichoderma ( T.atroviride ) (TaIC12, TAT11, Ta56, Ta104C, Ta116 and Ta100) clustered in one branch. Based on the mycological characteristics, rDNA-ITS and EF-1α sequence analysis results of strain JB-1, it was identified as a Trichoderma fungus of the subphylum Ascomycota, class Hyphomycetes, order Hyphomycetales, and class Myxosporeans. Trichoderma atroviride ).

[0008] Optionally, the above-mentioned dark green Trichoderma strain, the ITS gene sequence of the dark green Trichoderma strain is the nucleotide sequence shown in SEQ ID No.1.

[0009] SEQ ID No.1: ATAGGGTTCACTCCCAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGACCTCGGGAGCCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCA。

[0010] The EF-1α gene sequence of the Trichoderma atroviride strain is the nucleotide sequence shown in SEQ ID No.2.

[0011] SEQ ID No.2: .

[0012] The second object of the present application is to provide a pathogen inhibitor prepared by the above-mentioned dark green Trichoderma strain, its metabolites, fermentation broth, bacterial suspension, bacterial agent and / or spore suspension, wherein the pathogen is selected from Fusarium graminearum ( Fusariumgraminearum)、Pythium sphaerocephala( Pythiuminflatum )、Corynebacterium turcica L.( Exserohilumturcicum )、Pseudomonas verticillasteroides( F. verticillioides ), Fusarium equisetum ( F. equiseti )、Temperate Fusarium ( F. temperatum )、Fusarium spp.( F. proliferatum )、Curvularia zea maydis ( Curvularialunata ) and February blue leaf spot pathogen ( Alternaria brassicicola )

[0013] The third object of the present application is to provide a plant disease inhibitor prepared by the above-mentioned dark green Trichoderma strain, its metabolites, fermentation broth, bacterial suspension, bacterial agent and / or spore suspension, wherein the plant disease is selected from one or more of corn stalk rot, corn root rot, corn ear rot, corn sheath rot, corn leaf blight, corn Curvularia leaf spot and February blue leaf spot.

[0014] The fourth object of the present application is to provide a plant growth promoter prepared from the above-mentioned dark green Trichoderma strain, its metabolites, fermentation broth, bacterial suspension, bacterial agent and / or spore suspension, wherein the plant selected is corn.

[0015] The concentration of the spore suspension of dark green Trichoderma strains included 1.0×10 4 CFU / mL-1.0×10 8 CFU / mL, respectively, were selected as 1.0×10 4 CFU / mL, 1.0×10 6 CFU / mL and 1.0×10 8 CFU / mL.

[0016] The fifth objective of the present application is to provide the use of the above-mentioned dark green Trichoderma strain in inhibiting pathogens or preparing pathogen inhibitors.

[0017] The sixth object of the present application is to provide the use of the above-mentioned dark green Trichoderma strain in inhibiting plant diseases or preparing plant disease inhibitors.

[0018] The seventh object of the present application is to provide the use of the above-mentioned dark green Trichoderma strain in promoting plant growth and development or preparing plant growth promoters.

[0019] The eighth objective of the present application is to provide the use of the above-mentioned dark green Trichoderma strain in the preparation of agricultural fertilizers or biological fertilizers.

[0020] Optionally, the above application is to select one or more of the mycelium, cake, fermentation liquid, bacterial suspension, bacterial agent and spore suspension of the dark green Trichoderma strain, and apply them to the plant growth area by mixing with seeds, as a base fertilizer, or as a topdressing, and the plant selected is corn.

[0021] Compared with the prior art, this application has the following advantages: The endophytic dark green Trichoderma JB-1 provided in the present application has a broad spectrum of antagonistic effects on plant pathogenic fungi and can be used for the prevention and control of crop diseases. At the same time, since the strain is relatively safe for the growth and development of corn and the like, and the 4 CFU / mL-1.0×10 8 It has a promoting effect on the growth and development of corn at a concentration of CFU / mL. Therefore, it is expected to play a good role in the growth and development of crops as a bacterial fertilizer, overcome a series of problems caused by the excessive use of chemical pesticides, and has broad application prospects in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The morphological characteristics of Trichoderma aureum JB-1 in one embodiment of the present application are shown; wherein, Figure 1 A is the colony morphology after 3 days of culture on PDA. Figure 1 B is the colony morphology after 7 days of culture on PDA; the microscopic morphological characteristics of Trichoderma aureum JB-1 were observed after 7 days of culture; Figure 1 C- Figure 1 F is a microscopic observation of conidiophores and spore-producing structures. Figure 1 G is a microscopic observation of chlamydospores, and H is a microscopic observation of conidia.

[0023] Figure 2 Shown is a phylogenetic tree of Trichoderma aureum strain JB-1 established based on rDNA-ITS and EF-1α in one embodiment of the present application.

[0024] Figure 3 The following is an example of the present application, in which the dark green Trichoderma strain JB-1 inhibits the pathogen of corn and cereal stalk rot (Fusarium graminearum); wherein, Figure 3 A-1 is the result of confrontation culture between Trichoderma aureum JB-1 and Fusarium graminearum. Figure 3 A-2 is the control Fusarium graminearum.

[0025] Figure 4 The results are shown as microscopic observations of the parasitism of Trichoderma viride strain JB-1 on Fusarium graminearum in one embodiment of the present application; wherein, Figure 4 A shows JB-1 clinging to and wrapping around Fusarium graminearum; Figure 4 B is the growth of JB-1 through Fusarium graminearum; Figure 4C shows the mycelium of Fusarium graminearum growing inside the mycelium of JB-1.

[0026] Figure 5 The figure shows the inhibitory effect of the volatile metabolites of Trichoderma aureum strain JB-1 on Fusarium graminearum in one embodiment of the present application; wherein, Figure 5 A-1 is the front morphological characteristics of the colonies in the JB-1 treatment group after 6 days of culture; Figure 5 A-2 is the back morphological characteristics of the JB-1 treatment group colonies after 6 days of culture; Figure 5 B-1 is the front morphological characteristics of the control group colonies after 6 days of culture; Figure 5 B-2 is the back morphological characteristics of the control group colonies after 6 days of culture. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solution and advantages of the present application more clear, the present application is further described in detail below. However, it should be understood that the description here is only used to explain the present application and is not used to limit the scope of the present application.

[0028] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present application, and the terms used herein in the specification of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. The reagents and instruments used herein are all commercially available, and the characterization means involved can refer to the relevant descriptions in the prior art, which will not be repeated herein.

[0029] In order to further understand the present application, the present application is further described in detail below in conjunction with the best embodiment.

[0030] Example 1 A dark green Trichoderma strain JB-1, deposited as dark green Trichoderma Trichoderma atroviride , deposited in the General Microbiology Center CGMCC of China Microbiological Culture Collection Administration, the address of the deposit unit is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is December 30, 2024; the deposit number is CGMCC No.41740.

[0031] The ITS gene sequence of the dark green Trichoderma strain is the nucleotide sequence shown in SEQ ID No.1.

[0032] The EF-1α gene sequence of the dark green Trichoderma strain is the nucleotide sequence shown in SEQ ID No.2.

[0033] The present application also provides a pathogen inhibitor prepared by the above-mentioned dark green Trichoderma strain, its metabolites, fermentation broth, bacterial suspension, bacterial agent and / or spore suspension, wherein the pathogen is selected from Fusarium graminearum ( Fusariumgraminearum)、Pythium sphaerocephala( Pythiuminflatum )、Corynebacterium turcica L.( Exserohilumturcicum )、Pseudomonas verticillasteroides( F. verticillioides ), Fusarium equisetum ( F. equiseti )、Temperate Fusarium ( F. temperatum )、Fusarium spp.( F. proliferatum )、Curvularia zea maydis ( Curvularialunata ) and February blue leaf spot pathogen ( Alternaria brassicicola )

[0034] The present application also provides a plant disease inhibitor prepared by the above-mentioned dark green Trichoderma strain, its metabolites, fermentation broth, bacterial suspension, bacterial agent and / or spore suspension, wherein the plant disease is selected from one or more of corn stalk rot, corn root rot, corn ear rot, corn sheath rot, corn leaf blight, corn Curvularia leaf spot and February blue leaf spot.

[0035] The present application also provides a plant growth promoter prepared by the above-mentioned dark green Trichoderma strain, its metabolites, fermentation broth, bacterial suspension, bacterial agent and / or spore suspension, and the plant selected is corn.

[0036] The concentration of the spore suspension of dark green Trichoderma strains included 1.0×10 4 CFU / mL-1.0×10 8 CFU / mL, respectively, were selected as 1.0×10 4 CFU / mL, 1.0×10 6 CFU / mL and 1.0×10 8 CFU / mL.

[0037] The present application also provides the use of the above-mentioned dark green Trichoderma strain in inhibiting pathogens or preparing pathogen inhibitors.

[0038] The present application also provides the use of the above-mentioned dark green Trichoderma strain in inhibiting plant diseases or preparing plant disease inhibitors.

[0039] The present application also provides the use of the above-mentioned dark green Trichoderma strain in promoting plant growth and development or preparing plant growth promoters.

[0040] The present application also provides the use of the above-mentioned dark green Trichoderma strain in the preparation of agricultural fertilizer or biological fertilizer, and selects one or more of the mycelium, bacterial cake, fermentation liquid, bacterial suspension, bacterial agent and spore suspension of the dark green Trichoderma strain, and applies it to the plant growth area by mixing with seeds, as a base fertilizer, or as a topdressing, and the plant selected is corn.

[0041] Example 2 Isolation and identification of Trichoderma aureum JB-1: 1. Isolation of strains: After cleaning the healthy grape petioles with tap water, dry them with sterilized filter paper, cut them into 0.5cm×0.5cm small sections, and separate them according to the conventional tissue block separation method. In the separation process, in order to ensure that the isolated strains are endophytes, three blank controls are set up (① the sterilized water coating dish after the last rinse; ② the PDA plate with the lid removed and placed on the operating table; ③ the petioles that have been dried are printed on the PDA culture medium for 10 minutes and then the petioles are removed). Then observe day by day, and when hyphae just grow on the edge of the tissue block, use a sterilized inoculation needle to pick up the hyphae and transfer them to the PDA plate with penicillin sodium. Store the purified strains on a PDA slant at 4°C for later use. The pathogen of corn root rot, Fusarium graminearum ( Fusariumgraminearum ) and Pythium sphaerocephalum ( Pythiuminflatum ) was used as the target bacteria, and the antibacterial activity of pure culture strains was detected by plate confrontation culture, and dark green Trichoderma ( Trichoderma atroviride ) strain JB-1, accession number CGMCC No.41740.

[0042] 2. Identification of strains: 2.1 Morphological identification: The strain had well-developed aerial mycelium on PDA, and the colony was fluffy to felt-like, white, thick and fluffy, with protrusions. After 3 days, the culture dish was full, and after 7 days, the PDA was covered with a large number of green conidia ( Figure 1 A, Figure 1 B). Conidiophores are mostly unilaterally branched, and the angle between the branches and the conidiophores is close to a right angle ( Figure 1 C, Figure 1 D). Bottle stalks straight or curved, sometimes hooked ( Figure 1 E, Figure 1 F), can produce thick-walled spores ( Figure 1 G), conidia are mostly oval or elliptical in shape ( Figure 1 H), a strong coconut aroma can be produced during the cultivation process. According to the cultivation characteristics and morphological characteristics of the strain, its classification status is determined to be Deuteromycotina ( Deuteromycotina ), Hyphosporida ( Hyphomycetes ), Hyphosporales ( Hyphomycetales ), Myxosporeans ( Gloiosporae ) Trichoderma Trichoderma ) fungi dark green Trichoderma ( Trichoderma atroviride ).

[0043] 2.2 Molecular Biology Identification: The whole genome DNA of the endophytic antagonistic fungus JB-1 was extracted using a fungal genomic DNA kit. Primers ITS1 / ITS4 (SEQ ID No.3: 5′-TCCGTAGGTGAACCTGCGG-3′, SEQ ID No.4: 5′-TCCTCCGCTTATTGATATGC-3′) and primers TEF-F / TEF-R (SEQID No.5: 5'-ATGGGTAAGGARGACAAGAC-3', SEQ ID No.6: 5'-GGARGTACCAGTSATCATGTT-3') were selected. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and PCR amplification was performed according to the method of White et al. The amplified product was sent to Shanghai Sangon for sequencing. The sequencing results were analyzed by Blast similarity analysis, and the rDNA-ITS sequence of strain JB-1 was similar to that of Trichoderma aureum T.atroviride The highest homology is with dark green Trichoderma with accession numbers OQ891660.1, MH284664.1, KR080062.1, MT023026.1, MW759400.1, OP162786.1 and KX379157.1. T.atroviride The similarity is 100.00%; the EF-1α gene sequence is similar to the dark green Trichoderma with accession numbers KJ871100.1, EU280011.1, and OR487468.1 T.atroviride The similarity is above 98.50%. T.atroviride The target gene sequences of the strain and its similar species and outgroup strains were aligned and spliced, and a phylogenetic tree based on rDNA-ITS and EF-1α was constructed using Mega7.0 software ( Figure 2 ), JB-1 and Trichoderma virens T.atroviride (TaIC12, TAT11, Ta56, Ta104C, Ta116 and Ta100) clustered in one branch. This indicates that strain JB-1 and Trichoderma aureum T.atroviride The genetic distance is closer, and combined with morphological and molecular biological identification, it was identified as dark green Trichoderma T.atroviride .

[0044] Embodiment 3: Inhibitory effect of dark green Trichoderma JB-1 on the pathogen of corn stalk rot: 1. Test method: The maize stalk rot pathogen Fusarium graminearum ( F.graminearum) was transferred to PDA for activation and cultured at 25°C. After the mycelium covered the plate, a 6mm diameter cake was punched with a hole puncher. The dark green Trichoderma JB-1 cake and the Fusarium graminearum cake were transferred to both sides of the PDA plate, 4cm apart, and cultured at 25°C for 7 days. The colony radius of dark green Trichoderma and Fusarium graminearum was observed and recorded, and only Fusarium graminearum was inoculated without dark green Trichoderma as a control. The colony growth rate was measured to calculate the mycelium inhibition rate. Each treatment was repeated 3 times. At the same time, the coverage index of each pathogen was observed after 7 days of culture to further judge its comprehensive antibacterial ability. The PDA formula is: 200g potato, 15g glucose, 15g agar, and 1000mL water.

[0045] 2. Calculation method of colony inhibition rate: Colony inhibition rate (%) = ((average radius of control indicator bacteria - average radius of treated indicator bacteria) / average radius of control indicator bacteria) × 100.

[0046] 3. Coverage grading standards: Level Ⅰ (+): The antagonistic Trichoderma fungus does not come into contact with the test pathogen colonies; Level II (++): The antagonistic Trichoderma is in contact with the test pathogen colony, and the antagonistic Trichoderma hyphae covers less than 50% of the target bacterial colony, and there is no obvious change in the test pathogen colony; Level III (+++): The biocontrol bacteria colonies cover a large area of ​​the target bacteria and produce a large number of spores on them, causing the target bacteria to grow and decay.

[0047] 4. Test results: From the test results, we can see (see Figure 3 A-1, Figure 3 A-2), dark green Trichoderma strain JB-1 had a good antibacterial effect on Fusarium graminearum, and the inhibition rates were (46.28±2.20)% and (85.36±0.60)% after culturing for 3d and 7d, respectively. The coverage index of dark green Trichoderma strain JB-1 on Fusarium graminearum was grade II (++).

[0048] Embodiment 4: The hyperparasitic effect of Trichoderma viride JB-1 on Fusarium graminearum: 1. Test method: The test method was the same as in Example 2. The hyperparasitism of Trichoderma aureum strain JB-1 on Fusarium graminearum was observed day by day.

[0049] 2. Test results: Microscopic observation revealed that JB-1 parasitized on the hyphae of Fusarium graminearum by entanglement or direct penetration ( Figure 4 A, Figure 4 B, Figure 4C), competing for its growth space and nutrients; with further confrontation cultivation, green conidia are produced on its hyphae, and the hyphae of Fusarium graminearum decay.

[0050] Embodiment 5: Antifungal activity of volatile metabolites of Trichoderma aureum JB-1 against Fusarium graminearum: 1. Test method: The method for determining the antibacterial activity of volatile metabolites was carried out by double-dish interlocking culture method. The strain JB-1 and Fusarium graminearum were inoculated in the center of the PDA plate, and then the culture dish with strain JB-1 was placed below and interlocked with the culture dish with Fusarium graminearum, and the double dishes were sealed with sealing film. The culture was cultured at 25°C in the dark for 3d and 6d, and the colony diameter was measured respectively, and the colony growth inhibition rate was calculated. Each treatment was repeated 3 times. The calculation method and PDA formula were the same as those in Example 3.

[0051] 2. Test results: The test results show that the volatile substances produced during the metabolism of JB-1 have a significant inhibitory effect on the tested Fusarium graminearum. On the third day of culture, the inhibition rate of Fusarium graminearum can reach 48.04%; on the sixth day of culture, the control group has almost grown all over the dish, while the diameter of the Fusarium graminearum colony in the treatment group is 48.08mm, and the inhibition rate can still reach 44.09%; compared with the control ( Figure 5 B-1, Figure 5 B-2), the aerial hyphae of Fusarium graminearum in the treatment group were short and few, and the color of the colonies and the color of the pigments produced changed significantly ( Figure 5 A-1, Figure 5 A-2).

[0052] Embodiment 6: Antifungal activity of non-volatile metabolites of Trichoderma aureum JB-1 against Fusarium graminearum: 1. Test method: The double-layer cellophane method was used. The dark green Trichoderma strain JB-1 cake (6 mm in diameter) cultured on a PDA plate for 3 days was inoculated in the center of a PDA plate with double-layer cellophane, and an agar block with a diameter of 6 mm was inoculated as a control. After culturing at 25°C in the dark for 3 days, the cellophane was removed under sterile conditions, and a 6 mm diameter Fusarium graminearum cake was inoculated, and cultured at 25°C in the dark for 3 days and 6 days, and the colony diameters were measured respectively, and the colony growth inhibition rate was calculated, and each treatment was repeated 3 times. The calculation method and PDA formula were the same as in Example 3.

[0053] 2. Test results: JB-1 was inoculated on a PDA plate with double-layer cellophane. After 3 days, the cellophane was removed and the pathogen Fusarium graminearum was inoculated in the center of the PDA plate. After 3 days of culture, compared with the control, the growth of the pathogen colony in the treatment group was significantly inhibited, the average colony diameter was 14.58 mm, and the aerial hyphae were few and thin, while the control colony grew normally, the aerial hyphae were vigorous, and the average colony diameter was 43.67 mm. The non-volatile secondary metabolites produced by it could inhibit Fusarium graminearum by 75.22%. With further culture, the inhibition rate decreased to 58.02% on the 6th day (Table 1). Compared with the control, the colony culture characteristics of the treatment group were significantly different from those of the control. This also shows that with the postponement of the culture time and the consumption of secondary metabolites in the PDA plate, its inhibitory ability to Fusarium graminearum showed a significant decreasing trend.

[0054] Table 1 shows the antibacterial effects of non-volatile metabolites produced by Trichoderma aureum strain JB-1 on Fusarium graminearum.

[0055] Table 1

[0056] Embodiment 7: Determination of the antibacterial spectrum of dark green Trichoderma JB-1: 1. Test method: The confrontation culture method was adopted. The dark green Trichoderma strain JB-1 and the tested plant pathogenic fungi cultured on the PDA plate for 3 days were punched into a 6 mm diameter cake with a hole puncher, and inoculated at both ends of the horizontal line about 2.5 cm away from the center point, respectively. Only the pathogen was inoculated without the dark green Trichoderma strain JB-1 as a control. The dark culture was carried out at a constant temperature of 25°C. The colony radius of each pathogen was measured after 3 days and 7 days of culture, and the mycelium growth inhibition rate was calculated; at the same time, the coverage index of each pathogen was observed after 7 days of culture, so as to further judge its antibacterial ability, and each treatment was repeated 3 times. The calculation method and PDA formula are the same as those in Example 3.

[0057] 2. Test results: The test results show (Table 2) that Trichoderma jB-1 has a good inhibitory effect on the mycelial growth of 8 tested plant pathogenic fungi and has a broad antifungal spectrum.

[0058] Table 2 shows the inhibitory effect of Trichoderma viride strain JB-1 on the growth of tested plant pathogenic fungi colonies.

[0059] Table 2

[0060] Note: Data in the same column with the same lowercase letters in the table indicate that the difference is not significant at the P0.05 level after Duncan's new multiple range test. The same below.

[0061] Embodiment 8: Effects of Trichoderma viride JB-1 on corn growth and development: 1. Preparation of spore suspension: After the activation of the dark green Trichoderma strain JB-1, it was inoculated on PDA medium and grown in a constant temperature incubator at 25°C for 7 days. 8 CFU / mL spore suspension stock solution, and then diluted to 1×10 6 CFU / mL and 1×10 4 The spore suspension of CFU / mL is ready for use.

[0062] 2. Test methods and survey indicators: Healthy and uniform corn seeds (Xianyu 335) were surface disinfected with 75% ethanol for 10 minutes, rinsed with sterile water 3-5 times, and placed in a 90mm disposable sterilized culture dish (two layers of sterilized filter paper were laid in the culture dish in advance), 10 seeds per dish, and then 10mL of JB-1 spore suspension of different concentrations was added to each culture dish. The seeds were cultured at 25℃ with constant temperature and humidity, and sterile water was used as the control, and each treatment was repeated 3 times. After 7 days, the development of corn seeds was counted, and the germination rate, bud length, root length, number of roots, bud fresh weight, and root fresh weight were measured.

[0063] 3. Test results: Compared with the control, strain JB-1 at the tested concentration of 1.0×10 4 CFU / mL, 1.0×10 6 CFU / mL and 1.0×10 8 There was no significant difference in the effects of the strain on the germination rate, root number, sprout fresh weight and root fresh weight of corn seeds under the same CFU / mL condition (P>0.05), but there was a significant difference in the effects on the root length and sprout length of corn under this condition (P<0.05), indicating that the strain has a certain growth-promoting effect on corn seeds and is safe for corn seeds (Table 3).

[0064] Table 3 shows the effects of different concentrations of Trichoderma aureum JB-1 on the morphological indices of corn.

[0065] Table 3

[0066] Embodiment 9: Safety evaluation of dark green Trichoderma JB-1 on corn: 1. Test methods and survey indicators: Ten plants were planted for each treatment, and the field management was repeated three times. When the corn was 4-7 days old, the corn was inoculated by silk channel injection at a concentration of 1.0×10 8CFU / mL, each ear was inoculated with 2 ml of bacterial suspension, and clean water was used as the control. Then, regular observation was made to see if the corn ears became diseased, and the development of each ear was investigated during the corn maturity period.

[0067] 2. Test results: The test results show that when the corn inoculation sites were observed 3d, 7d, 14d, 30d after inoculation with strain JB-1 and before harvest, no obvious disease symptoms were found in the corn ears. Only sporadic weak parasitic mold layers appeared on the wounds of the inoculated injured corn kernels and the dried filaments, and there was no expansion phenomenon. There was no difference in the development of the ears compared with the control, which further shows that strain JB-1 is safe for corn.

[0068] Embodiment 10: Effect of dark green Trichoderma JB-1 on the prevention and control of corn root rot at the seedling stage: 1. Test method: The preparation method of Fusarium graminearum inoculum refers to the propagation method of corn resistance identification inoculum. This experiment has 4 treatments, namely, only inoculation with Fusarium graminearum, only inoculation with JB-1, inoculation with Fusarium graminearum and JB-1, and water control. The inoculation method combines the fungus soil method with the root irrigation method: first, the surface of the corn seeds is disinfected and then germinated. When the corn sprouts are close to 1 cm, the seeds with consistent sprouts are picked out and sown in pots with a diameter of 10 cm, with 7 plants per pot. In the two treatment pots inoculated with Fusarium graminearum, 20g of pathogen propagules are mixed in the sterilized vermiculite in advance. On the day of sowing, one of the treatments is irrigated with 1×10 8 CFU / mL JB-1 spore suspension 50mL, set up a water control and only watering JB-1 treatment, each treatment was repeated 3 times, and conventional management was performed. After 20 days, the corn plants were dug out, the root culture matrix was cleaned and the water was dried with filter paper, the root disease was observed, the disease plant rate and average disease index were calculated; the growth indicators of corn such as plant height, plant fresh weight and root weight were measured.

[0069] 2. Disease index and prevention effect: Disease index = 100 × ∑ (number of diseased plants at each level × corresponding level) / (total number of plants investigated × highest level); Control effect (%) = (control disease index - treatment disease index) / control disease index × 100.

[0070] 3. Corn root rot classification standards: Level 0: the root system is healthy and has no disease spots; Level 1: there are sporadic disease spots on the root system, but they are not continuous; Level 2: the root disease spots are continuous but smaller than 1 / 4 of the root circumference; Level 3: the root disease spots are larger than 1 / 2 of the circumference but smaller than 3 / 4; Level 5: the entire root is surrounded by disease spots and the root is rotten.

[0071] 4. Test results: From the test results (Table 4), the average disease index of Fusarium graminearum stem rot in the seedling stage of corn treated with only pathogens can reach 49.80, and the average disease index of the treatment treated with JB-1 and Fusarium graminearum is 22.5, indicating that JB-1 has a certain control effect on Fusarium graminearum stem rot in the seedling stage of corn, with a control efficiency of 54.82%. Compared with the control treated with only Fusarium graminearum, the growth and development of corn plants treated with only Fusarium graminearum was significantly inhibited, and the average plant height, root length, plant fresh weight and root fresh weight were significantly lower than those of the control (P < 0.05). Comparison of the various treatments in the test found that there was no significant difference in the various indicators between the treatment treated with only JB-1 and the control treated with clear water (P>0.05), while the various indicators of the treatment treated with only Fusarium graminearum were significantly lower than those of the other three treatments (P < 0.05).

[0072] Table 4 shows the protective effect of dark green Trichoderma strain JB-1 on corn root rot at the seedling stage.

[0073] Table 4

[0074] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. A dark green Trichoderma strain, characterized in that: The dark green Trichoderma strain is JB-1, and its deposited name is dark green Trichoderma Trichoderma atroviride , deposited in the General Microbiology Center CGMCC of China Microbiological Culture Collection Administration, the address of the deposit unit is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is December 30, 2024; the deposit number is CGMCC No.41740.

2. The dark green Trichoderma strain according to claim 1, characterized in that The ITS gene sequence of the dark green Trichoderma strain is the nucleotide sequence shown in SEQ ID No.

1.

3. The pathogen inhibitor prepared from the dark green Trichoderma strain, its metabolites, fermentation liquid, bacterial suspension, bacterial agent and / or spore suspension according to claim 1 or 2, characterized in that: The pathogen is selected as Fusarium graminearum ( Fusarium graminearum )、Pythium sphaerocephala( Pythium inflatum )、Corynebacterium turcica L.( Exserohilum turcicum )、Pseudomonas verticillasteroides( F. verticillioides ), Fusarium equisetum ( F. equiseti )、Temperate Fusarium ( F. temperatum )、Fusarium spp.( F. proliferatum )、Curvularia zea maydis ( Curvularia lunata ) and February blue leaf spot pathogen ( Alternaria brassicicola ) 4. The plant disease inhibitor prepared from the dark green Trichoderma strain, its metabolites, fermentation liquid, bacterial suspension, bacterial agent and / or spore suspension according to claim 1 or 2, characterized in that: The plant diseases are selected from one or more of corn stalk rot, corn root rot, corn ear rot, corn sheath rot, corn leaf blight, corn curvature leaf spot and February blue leaf spot.

5. The plant growth promoter prepared from the dark green Trichoderma strain, its metabolites, fermentation liquid, bacterial suspension, bacterial agent and / or spore suspension according to claim 1 or 2, characterized in that: The plant selected is corn.

6. Use of the dark green Trichoderma strain according to claim 1 or 2 in inhibiting pathogens or preparing pathogen inhibitors.

7. Use of the dark green Trichoderma strain according to claim 1 or 2 in inhibiting plant diseases or preparing plant disease inhibitors.

8. Use of the dark green Trichoderma strain according to claim 1 or 2 in promoting plant growth and development or preparing a plant growth promoter.

9. Use of the dark green Trichoderma strain according to claim 1 or 2 in the preparation of agricultural fertilizers or biological fertilizers.

10. The use according to claim 9, characterized in that One or more of the mycelium, bacterial cake, fermentation liquid, bacterial suspension, bacterial agent and spore suspension of the dark green Trichoderma strain are selected and applied to the plant growth area by seed dressing, as base fertilizer or as topdressing, and the plant selected is corn.

Images