A Fusarium oxysporum FOZJ2024 strain and its applications

By using Fusarium oxysporidium FOZJ2024 strain and its fermentation products, spraying them on the surface of the pests, the prevention and control problems of insects such as crape myrtle aphids, mealybugs, fall armyworms and red fire ants were solved, and efficient killing and control effects were achieved.

CN119842502BActive Publication Date: 2025-07-04GUANGDONG OCEAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510292214.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-12
Publication Date
2025-07-04
Estimated Expiration
2045-03-12

AI Technical Summary

Technical Problem

The existing technology is difficult to effectively prevent and control plant pests and agricultural and forestry hazards caused by insects such as crape myrtle aphids, mealybugs, fall armyworms and red fire ants. Especially in warm and humid environments, these pests spread quickly and spread widely, making it difficult to prevent and control.

Method used

Fusarium oxysporum FOZJ2024 strain and its fermentation products were used to spray spore suspension to treat the insect body surface, and use its powerful killing and lethal effects to prevent and control these pests.

Benefits of technology

Fusarium oxysporidium FOZJ2024 strain has excellent killing effect on the above-mentioned pests, which can significantly reduce the cumulative correction rate of insects and effective control of plant pests and agricultural and forestry hazards during death.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119842502B_ABST
    Figure CN119842502B_ABST
Patent Text Reader

Abstract

The present invention provides a Fusarium oxysporum FOZJ2024 strain and its application. This strain was deposited at the Guangdong Microbial Culture Collection Center on November 20, 2024, with the deposit number GDMCC No: 65511 and the deposit address being the 5th floor of Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou. It has excellent killing effects on Tinocallis kahawaluokalani, mealybugs, Spodoptera frugiperda, and Solenopsis invicta, and is suitable for controlling plant pests and agricultural and forestry hazards caused by these insects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology. More specifically, it relates to a Fusarium oxysporum FOZJ2024 strain and its application. Background Art

[0002] The Lagerstroemia aphid ( Tinocallis kahawaluokalani ), belonging to the insect family Drepanosiphidae of the order Hemiptera, mainly harms Lagerstroemia indica. It not only likes to gather and harm on the back of leaves, especially on young leaves, making the leaves uneven and falling off prematurely; it also harms new shoots, inhibiting the development of flower buds, shortening the inflorescence, and affecting flowering; and it will secrete honeydew, inducing sooty mold, making the leaves turn black and spreading viruses.

[0003] The mealybug ( Pseudococcidae sp.) has small body size, its body surface is covered with wax powder, and it has characteristics such as polyphagy, wide host range, aggregated distribution, and hidden occurrence. It is one of the pests that are very difficult to control at present. It mainly harms tropical and subtropical forestry and agricultural crops and greenhouse cultivated plants. It will not only suck a large amount of plant sap in a short time, resulting in phenomena such as slow plant growth, reduced leaves, weak plants, flower dropping, and poor fruit development; it will also secrete honeydew, inducing sooty mold, further leading to the decline of plants; and its reproduction and spread speed are very fast, especially in warm and humid environments. If not dealt with in time, it will quickly spread to the whole plant and even infect other plants.

[0004] The fall armyworm ( Spodoptera frugiperda ), belonging to the insect family Noctuidae of the order Lepidoptera. The characteristics of sudden occurrence, explosive occurrence, and destructiveness of the fall armyworm pose a serious threat to crops such as corn. It affects the photosynthesis, nutrient absorption, and growth and development of crops by gnawing on key parts such as the leaves and stems of crops, thereby reducing the yield and quality of crops. In addition, the fall armyworm also has the characteristic of migration and can migrate with the wind to cause harm, further increasing the difficulty of prevention and control.

[0005] The red imported fire ant ( Solenopsis invicta ), belonging to the insect family Formicidae of the order Hymenoptera. The red imported fire ant will not only gnaw on the roots, stems, young stems, tender buds, fruits, and seeds of plants, resulting in symptoms such as slow plant growth and withered yellow leaves, and even directly causing the death of plants; moreover, it is highly aggressive and will prey on a large number of insects, birds, soil-dwelling animals, etc., posing a threat to other organisms in the ecosystem and affecting biodiversity.

[0006] Therefore, finding a method that can kill the above four kinds of insects simultaneously is crucial for agricultural and forestry production. Summary of the Invention

[0007] Aiming at the deficiencies of the prior art, the present invention aims to provide a Fusarium oxysporum ( Fusarium oxysporum)The FOZJ2024 strain can effectively kill Lagerstroemia aphids, mealybugs, Spodoptera frugiperda, and red imported fire ants, and is suitable for controlling plant pests and agricultural and forestry hazards caused by these insects.

[0008] The first object of the present invention is to provide a strain of Fusarium oxysporum ( Fusarium oxysporum )FOZJ2024 strain.

[0009] The second object of the present invention is to provide the application of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in killing Lagerstroemia aphids.

[0010] The third object of the present invention is to provide the application of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in controlling plant pests caused by Lagerstroemia aphids.

[0011] The fourth object of the present invention is to provide the application of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in killing mealybugs.

[0012] The fifth object of the present invention is to provide the application of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in controlling plant pests caused by mealybugs.

[0013] The sixth object of the present invention is to provide the application of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in killing Spodoptera frugiperda.

[0014] The seventh object of the present invention is to provide the application of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in controlling plant pests caused by Spodoptera frugiperda.

[0015] The eighth object of the present invention is to provide the application of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in killing red imported fire ants.

[0016] The ninth object of the present invention is to provide the application of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in controlling agricultural and forestry hazards caused by the invasion of red imported fire ants.

[0017] The tenth object of the present invention is to provide a biological control preparation.

[0018] The above objects of the present invention are achieved by the following technical solutions:

[0019] The present invention provides a strain of Fusarium oxysporum ( Fusarium oxysporum )FOZJ2024 strain, which was deposited at the Guangdong Microbial Culture Collection Center on November 20, 2024, with the deposit number GDMCC No: 65511 and the deposit address at the 5th floor of Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou.

[0020] The above-mentioned Fusarium oxysporum FOZJ2024 strain has excellent killing effects on Tinocallis kahawaluokalani, and is suitable for controlling plant pests caused by Tinocallis kahawaluokalani. Therefore, the present invention provides the application of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation products in killing Tinocallis kahawaluokalani, and the application in controlling plant pests caused by Tinocallis kahawaluokalani.

[0021] Preferably, the Tinocallis kahawaluokalani is Tinocallis kahawaluokalani nymphs and / or Tinocallis kahawaluokalani adults.

[0022] Preferably, the concentration of the Fusarium oxysporum FOZJ2024 strain is 1×10 4 spores / mL or more, and more preferably 1×10 5 spores / mL or more.

[0023] The above-mentioned Fusarium oxysporum FOZJ2024 strain has excellent killing effects on mealybugs, and is suitable for controlling plant pests caused by mealybugs. Therefore, the present invention provides the application of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation products in killing mealybugs, and the application in controlling plant pests caused by mealybugs.

[0024] Preferably, the mealybugs are mealybug nymphs and / or mealybug adults.

[0025] Preferably, the concentration of the Fusarium oxysporum FOZJ2024 strain is 1×10 4 spores / mL or more, and more preferably 1×10 8 spores / mL or more.

[0026] The above-mentioned Fusarium oxysporum FOZJ2024 strain has excellent killing effects on Spodoptera frugiperda, and is suitable for controlling plant pests caused by Spodoptera frugiperda. Therefore, the present invention provides the application of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation products in killing Spodoptera frugiperda, and the application in controlling plant pests caused by Spodoptera frugiperda.

[0027] Preferably, the Spodoptera frugiperda is Spodoptera frugiperda larvae.

[0028] Preferably, the concentration of the Fusarium oxysporum FOZJ2024 strain is 1×10 4 spores / mL or more, and more preferably 1×10 7 spores / mL or more.

[0029] The above-mentioned Fusarium oxysporum FOZJ2024 strain has excellent killing effects on red imported fire ants and is applicable to preventing and controlling the agricultural and forestry damages caused by the infestation of red imported fire ants. Therefore, the present invention provides the application of the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product in killing red imported fire ants, as well as the application in preventing and controlling the agricultural and forestry damages caused by the infestation of red imported fire ants.

[0030] Preferably, the red imported fire ants are worker ants of red imported fire ants.

[0031] Preferably, the concentration of the Fusarium oxysporum FOZJ2024 strain is 1×10 4 spores / mL or more, and more preferably 1×10 6 spores / mL or more.

[0032] Based on this, the present invention also provides a biological control preparation containing the above-mentioned Fusarium oxysporum FOZJ2024 strain and / or its fermentation product, which can be used to prevent and control plant pests and agricultural and forestry damages caused by Lagerstroemia aphids, mealybugs, Spodoptera frugiperda, and red imported fire ants.

[0033] The present invention has the following beneficial effects:

[0034] The Fusarium oxysporum ( Fusarium oxysporum ) FOZJ2024 strain of the present invention has excellent killing effects on Lagerstroemia aphids, mealybugs, Spodoptera frugiperda, and red imported fire ants, and is applicable to preventing and controlling plant pests and agricultural and forestry damages caused by these insects. Description of the Drawings

[0035] Figure 1 is the front view of the colony of the Fusarium oxysporum ( Fusarium oxysporum ) FOZJ2024 strain.

[0036] Figure 2 is the back view of the colony of the Fusarium oxysporum ( Fusarium oxysporum ) FOZJ2024 strain.

[0037] Figure 3 is the spore morphology diagram of the Fusarium oxysporum ( Fusarium oxysporum ) FOZJ2024 strain.

[0038] Figure 4 is the phylogenetic tree of molecular identification based on the ITS sequence of the Fusarium oxysporum ( Fusarium oxysporum ) FOZJ2024 strain.

[0039] Figure 5 is the phylogenetic tree of molecular identification based on the RPB2 sequence of the Fusarium oxysporum ( Fusarium oxysporum ) FOZJ2024 strain.

[0040] Figure 6 is the Fusarium oxysporum (Fusarium oxysporum )Phylogenetic tree of the molecular identification of FOZJ2024 strain based on the TEF sequence.

[0041] Figure 7 For Fusarium oxysporum Fusarium oxysporum )Results graph of the lethal effect of FOZJ2024 strain on Tinocallis kahawaluokalani.

[0042] Figure 8 For Tinocallis kahawaluokalani infected with Fusarium oxysporum Fusarium oxysporum )Status graph of FOZJ2024 strain.

[0043] Figure 9 For Fusarium oxysporum Fusarium oxysporum )Results graph of the lethal effect of FOZJ2024 strain on mealybugs.

[0044] Figure 10 For mealybugs infected with Fusarium oxysporum Fusarium oxysporum )Status graph of FOZJ2024 strain.

[0045] Figure 11 For Fusarium oxysporum Fusarium oxysporum )Results graph of the lethal effect of FOZJ2024 strain on Spodoptera frugiperda.

[0046] Figure 12 For Spodoptera frugiperda infected with Fusarium oxysporum Fusarium oxysporum )Status graph of FOZJ2024 strain.

[0047] Figure 13 For Fusarium oxysporum Fusarium oxysporum )Results graph of the lethal effect of FOZJ2024 strain on Solenopsis invicta.

[0048] Figure 14 For Solenopsis invicta infected with Fusarium oxysporum Fusarium oxysporum )Status graph of FOZJ2024 strain. Detailed implementation manners

[0049] The present invention will be further described below in conjunction with the accompanying drawings of the specification and specific embodiments, but the embodiments do not impose any form of limitation on the present invention. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field.

[0050] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0051] Potato Dextrose Agar (PDA) Medium: Take 200.0 g of peeled potatoes, cut into small pieces, boil them and remove the residue. Then add 15.0 g of agar, continue boiling until melted, add 20.0 g of glucose, and then add distilled water to make up to 1000 mL. Finally, sterilize it in a high-pressure steam sterilizer at 121 °C and 103.4 KPa for 30 min and reserve for use.

[0052] Example 1 Isolation, Purification, Identification and Preservation of Strain FOZJ2024

[0053] I. Isolation of Strain FOZJ2024

[0054] A dead Lepidoptera larva with mycelia growing all over its body was collected from a farmland in Potou District, Zhanjiang City, Guangdong Province. The surface of the dead insect sample was disinfected with 75% ( v / v ) alcohol, washed 3 times with sterile water, then minced with sterile surgical scissors and transferred to a PDA plate containing 50 mg / L penicillin, and cultured in an incubator at 28 °C until colonies formed, and then stored in a refrigerator at 4 °C for standby.

[0055] II. Purification of Strain FOZJ2024

[0056] The dominant colonies isolated above were inoculated on a PDA plate containing 50 mg / L penicillin with an inoculation needle and cultured in an incubator at 28 °C for 3 d. Subsequently, the vigorously growing mycelia at the edge of the colony were picked and transferred to a new PDA plate for culture to obtain a purified strain.

[0057] III. Identification of Strain FOZJ2024

[0058] (1) Morphological Identification

[0059] The purified strain was spread on a PDA plate and cultured at a constant temperature of 28 °C. It was observed that the colonies grew relatively fast and could cover the entire plate in 9 - 10 d and produced a large number of small and large conidia.

[0060] The front morphology of the colony is as shown in Figure 1 . It can be seen that the colony is round, white, cotton-like in texture, very fluffy, with protruding flocculent shapes.

[0061] The back morphology of the colony is as shown in Figure 2 . It can be seen that the colony is milky white, slightly light purple, which becomes more obvious in the later stage of growth.

[0062] The morphology of the conidia was observed with a biological microscope (Leica M125), and the results are as shown in Figure 3 . It can be seen that the small conidia are single-celled, oval, colorless; the large conidia are sickle-shaped, with slightly curved shape, slightly pointed at both ends, multi-celled, and colorless.

[0063] (2)Molecular biological identification

[0064] Three genes were selected for sequence amplification and alignment in molecular biological identification. The ITS (primer sequences ITS1 as shown in SEQ ID NO:1: TCCGTAGGTGAACCTGCGG; ITS4 as shown in SEQ ID NO:2: TCCTCCGCTTATTGATATGC), RPB2 (primer sequences PmRpb2_4 as shown in SEQ ID NO:3: GCAAGCTCAACTGCTGGTG; PMRpb2_6R as shown in SEQ ID NO:4: TCCAGCGATGTGCTGTTGG), and TEF (primer sequences EF1-728F as shown in SEQ ID NO:5: CATCGAGAAGTTCGAGAAGG; EF1-986R as shown in SEQ ID NO:6: TACTTGAAGGAACCCTTACC) genes of the aforementioned purified strain were amplified by PCR, and then the nucleotide sequences of the three genes were subjected to Nucleotide BLAST alignment in the GenBank database of the NCBI website. The results showed that the similarity of the ITS and TEF genes of this strain to Fusarium oxysporum ( Fusarium oxysporum )both reached 100%, while the RPB2 gene reached 99.41%.

[0065] The neighbor-joining (NJ) Bootstrap method of MEGA11.0 software was used to resample the ITS, RPB2, and TEF gene sequences 1000 times respectively, and the p-distance was selected as the model for the phylogenetic tree to construct the phylogenetic tree. The results are as Figures 4 - 6 shown, among which, Figure 4 is the phylogenetic tree of molecular identification of Fusarium oxysporum ( Fusarium oxysporum )strain FOZJ2024 based on the ITS sequence, Figure 5 is the phylogenetic tree of molecular identification of Fusarium oxysporum ( Fusarium oxysporum )strain FOZJ2024 based on the RPB2 sequence, Figure 6 is the phylogenetic tree of molecular identification of Fusarium oxysporum ( Fusarium oxysporum )strain FOZJ2024 based on the TEF sequence. It can be seen that the three genes of this strain are all clustered on the same branch with Fusarium oxysporum ( Fusarium oxysporum )and can be distinguished from other related species.

[0066] Combining the morphological identification results and the molecular biological identification results, it can be determined that this strain is Fusarium oxysporum ( Fusarium oxysporum ), named Fusarium oxysporum ( Fusarium oxysporum )strain FOZJ2024.

[0067] IV. Deposit of strain FOZJ2024

[0068] Fusarium oxysporum Fusarium oxysporum ) The FOZJ2024 strain was deposited in the Guangdong Provincial Microbiological Culture Collection Center on November 20, 2024, with the deposit number GDMCC No: 65511, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0069] Example 2 Determination of the toxicity of strain FOZJ2024 to Aphidida spp.

[0070] 1. Test insects

[0071] At the Huguang Campus of Guangdong Ocean University, we broke off leaves of crape myrtle containing crape myrtle aphids, put them in a plastic box with a lid, put a layer of paper towels on the bottom of the box, and wrap absorbent cotton balls around the petioles to supply water.

[0072] 2. Treatment of test strains

[0073] Fusarium oxysporum Fusarium oxysporum FOZJ2024 strain was spread on PDA plate and cultured in a constant temperature box at 28 ℃ for 10 days. The colonies with good growth were selected and their hyphae and spores were gently scraped with an inoculation needle. The scraped hyphae and spores were placed in 20 mL of 0.05% ( v / v ) Tween 80 aqueous solution in a beaker, stir with a magnetic stirrer at 200 rpm until the spores are evenly dispersed, and filter with two layers of medical gauze. Count the spore concentration of the filtrate with a hemocytometer under a microscope, and then dilute to 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 Spore suspensions of spores / mL are biocontrol agents of different concentrations. v / v ) Tween 80 aqueous solution was used as the control solution.

[0074] 3. Insect test treatment methods and results

[0075] Spray the spore suspension and control solution onto the body surface of the nymphs of the crape myrtle aphid until obvious water droplets were formed, and set up 3 replicates for each treatment. Then, place them in a constant temperature environment of 25 ℃ and RH above 90% for breeding, and record the number of deaths every 2 days. Because the aphid life span is short, it is recorded for a total of 6 days.

[0076] Calculate the cumulative corrected mortality rate according to the formula "Cumulative corrected mortality rate (%) = (Cumulative treatment mortality rate - Cumulative control mortality rate) / (1 - Cumulative control mortality rate) × 100%". (Here, the cumulative treatment mortality rate refers to the total mortality rate of Eriosoma lagerstroemiae sprayed with spore suspension on and before the statistical day, and the cumulative control mortality rate refers to the total mortality rate of Eriosoma lagerstroemiae sprayed with control solution on and before the statistical day). The results are as Figure 7 shown in Table 1. Use SPSS software to analyze the data in Table 1 to obtain the virulence regression equation, median lethal concentration (LC50, Table 2), and median lethal time (LT50, Table 3) of Fusarium oxysporum Fusarium oxysporum FOZJ2024 against Eriosoma lagerstroemiae.

[0077] On the 6th day, place the Eriosoma lagerstroemiae treated with the control solution and the spore suspension at 1×10 8 spores / mL under a dissecting microscope (Jiangnan JSZ5B) for observation. The photos are as Figure 8 shown.

[0078] Table 1 Cumulative corrected mortality rate of Fusarium oxysporum Fusarium oxysporum FOZJ2024 strain against Eriosoma lagerstroemiae

[0079]

[0080] Table 2 Median lethal concentration of Fusarium oxysporum Fusarium oxysporum FOZJ2024 strain against Eriosoma lagerstroemiae

[0081]

[0082] In the regression equation of Table 2, x is the logarithm (base 10) of the spore suspension concentration, and y is the probit value of the cumulative corrected mortality rate (Probit( p ) = Φ -1 ( p ) + 5, p where

[0083] Table 3 Median lethal time of Fusarium oxysporum Fusarium oxysporum FOZJ2024 strain against Eriosoma lagerstroemiae

[0084]

[0085] In the regression equation of Table 3, x is the natural logarithm of time, and y is the probit value of the cumulative corrected mortality rate (Probit( p ) = Φ -1 ( p ) + 5, p where

[0086] visible:

[0087] (1) After treatment with spore suspensions of different concentrations, the death of the crape myrtle aphid can be caused within 2 days, and the cumulative corrected mortality rate of the crape myrtle aphid gradually increases with the extension of time.

[0088] (2) With the increase of spore suspension concentration, the cumulative corrected mortality of the crape myrtle aphid gradually increased. On the 6th day after treatment, 1×10 5 ~1×10 8 At the concentration of spores / mL, the cumulative corrected mortality of the crape myrtle aphid reached 95.07% to 100%.

[0089] (3) Compared with the second day, the LC50 values ​​of the spore suspension treatment on the fourth and sixth days were significantly reduced. In addition, compared with the fourth day, the LC50 value on the sixth day increased. This may be because the growth cycle of the crape myrtle aphid is short and it can molt every few days. From the fourth to the sixth day, the crape myrtle aphid entered the molting stage and shed its original epidermis, thereby blocking the infection of some strains of FOZJ2024.

[0090] (4) With the increase of spore suspension concentration, the LT50 value of spore suspension to Aphididae gradually decreased. 8 Spores / mL concentration of Fusarium oxysporum ( Fusarium oxysporum ) The median lethal time of FOZJ2024 strain to the crape myrtle aphid was 1.95 days.

[0091] (5) Compared with the results of the control solution treatment, a large number of white hyphae grew on the surface of the insects treated with the spore suspension.

[0092] Combining (1) to (5), it can be seen that Fusarium oxysporum ( Fusarium oxysporum ) The FOZJ2024 strain is highly toxic and lethal to the crape myrtle aphid, and can effectively kill the crape myrtle aphid.

[0093] Example 3 Determination of the toxicity of strain FOZJ2024 to mealybugs

[0094] 1. Test insects

[0095] At the Huguang Campus of Guangdong Ocean University, Zephyranthes leaves containing mealybugs were broken off and placed in a plastic box with a lid. The base of the leaves were wrapped with absorbent cotton balls to supply water.

[0096] 2. Treatment of test strains

[0097] Fusarium oxysporum Fusarium oxysporumThe FOZJ2024 strain was spread on a PDA plate and cultured in an incubator at 28 °C for 10 d. Well-grown colonies were selected, and their hyphae and spores were gently scraped with an inoculation needle. The scraped hyphae and spores were placed in a beaker containing 20 mL of an aqueous solution containing 0.05% ( v / v ), Tween 80. The mixture was stirred with a magnetic stirrer at 200 rpm until the spores were evenly dispersed, and then filtered through two layers of medical gauze. The spore concentration of the filtrate was counted using a hemocytometer under a microscope, and then diluted to 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 spores / mL spore suspensions, which were different concentrations of the biocontrol agent. An aqueous solution containing 0.05% ( v / v ), Tween 80 was used as the control solution.

[0098] 3. Methods and Results of Treating Test Insects

[0099] The spore suspension and the control solution were respectively sprayed onto the body surface of the nymphs of the mealybug until obvious water droplets formed. Each treatment was set with 3 replicates. Then, they were placed in an environment at 25 °C and RH above 90% for constant-temperature feeding. The number of dead insects was recorded every 2 days for a total of 6 d.

[0100] The cumulative corrected mortality rate was calculated according to "Cumulative corrected mortality rate (%) = (Cumulative treatment mortality rate - Cumulative control mortality rate) / (1 - Cumulative control mortality rate) × 100%" (where the cumulative treatment mortality rate refers to the sum of the mortality rates of the mealybugs sprayed with the spore suspension on the day of statistics and before, and the cumulative control mortality rate refers to the sum of the mortality rates of the mealybugs sprayed with the control solution on the day of statistics and before). The results are shown in Figure 9 and Table 4. The data in Table 4 were analyzed using SPSS software to obtain the virulence regression equation, median lethal concentration (LC50, Table 5), and median lethal time (LT50, Table 6) of Fusarium oxysporum ( Fusarium oxysporum ), FOZJ2024 against the mealybug.

[0101] On the 6th d, the mealybugs treated with the control solution and the spore suspension of 1×10 8 spores / mL were respectively placed under a dissection microscope (Jiangnan JSZ5B) for observation. The photos are shown in Figure 10 .

[0102] Table 4 Cumulative corrected mortality rate of Fusarium oxysporum ( Fusarium oxysporum ), FOZJ2024 strain against the mealybug

[0103]

[0104] Table 5Fusarium oxysporum )The median lethal concentration of FOZJ2024 strain against mealybugs

[0105]

[0106] In the regression equation of Table 5, x is the logarithm (base 10) of the spore suspension concentration, and y is the probit value of the cumulative corrected mortality (Probit( p ) = Φ -1 ( p ) + 5, p where

[0107] Table 6 Fusarium oxysporum ( Fusarium oxysporum ) The median lethal time of FOZJ2024 strain against mealybugs

[0108]

[0109] In the regression equation of Table 6, x is the natural logarithm of time, and y is the probit value of the cumulative corrected mortality (Probit( p ) = Φ -1 ( p ) + 5, p where

[0110] It can be seen that:

[0111] (1) As time prolongs, the cumulative corrected mortality of mealybugs gradually increases.

[0112] (2) As the spore suspension concentration increases, the cumulative corrected mortality of mealybugs gradually increases. At the 6th day after treatment, the cumulative corrected mortality of mealybugs reached 43.33% at the concentration of 1×10 7 spores / mL, and reached 76.67% at the concentration of 1×10 8 spores / mL.

[0113] (3) As time prolongs, the LC50 value of the spore suspension against mealybugs gradually decreases. At the 6th day after treatment, the median lethal concentration of Fusarium oxysporum ( Fusarium oxysporum ) FOZJ2024 strain against mealybugs was 7.89×10 6 spores / mL.

[0114] (4) As the spore suspension concentration increases, the LT50 value of the spore suspension against mealybugs gradually decreases. At the concentration of 1×10 8 spores / mL, the median lethal time of Fusarium oxysporum ( Fusarium oxysporum ) FOZJ2024 strain against mealybugs was 3.76 d.

[0115] (5) Compared with the results of the control solution treatment, obvious fluffy white hyphae grew on the body surface of the mealybugs after treatment with the spore suspension.

[0116] Combining (1)-(5), it can be seen that the Fusarium oxysporum ( Fusarium oxysporum ) strain FOZJ2024 has strong virulence and lethality to mealybugs and can effectively kill mealybugs.

[0117] Example 4 Toxicity determination of strain FOZJ2024 against Spodoptera frugiperda

[0118] 1. Test insects

[0119] Spodoptera frugiperda was collected from corn in the experimental field of Zhanjiang Agricultural Machinery Promotion Center and placed in a plastic box with a lid, and fed individually with corn leaves.

[0120] 2. Treatment of test strains

[0121] The Fusarium oxysporum ( Fusarium oxysporum ) strain FOZJ2024 was spread on a PDA plate and cultured in an incubator at 28 °C for 10 d. Select colonies with good growth and gently scrape their hyphae and spores with an inoculation needle. Place the scraped hyphae and spores in a beaker containing 20 mL of an aqueous solution containing 0.05% ( v / v ) Tween 80, stir with a magnetic stirrer at 200 rpm until the spores are evenly dispersed, filter with two layers of medical gauze, count the spore concentration of the filtrate with a hemocytometer under a microscope, and then dilute it into 1×10 4 、1×10 5 、1×10 6 、1×10 7 、1×10 8 spore / mL spore suspensions, which are biocontrol agents with different concentrations. An aqueous solution containing 0.05% ( v / v ) Tween 80 in 20 mL was used as the control solution.

[0122] 3. Treatment method and results of test insects

[0123] The spore suspension and the control solution were respectively sprayed onto the body surface of Spodoptera frugiperda larvae until obvious water droplets formed, and each treatment was set with 3 replicates. Then, it was placed in an environment at 25 °C and RH above 90% for constant-temperature feeding, and the number of deaths was recorded every 2 days. The lifespan of Spodoptera frugiperda larvae is generally 2-3 weeks, so a total of 8 d was recorded.

[0124] The cumulative corrected mortality rate (%) was calculated according to "Cumulative corrected mortality rate (%) = (Cumulative treatment mortality rate - Cumulative control mortality rate) / (1 - Cumulative control mortality rate) × 100%". (Among them, the cumulative treatment mortality rate refers to the total mortality rate of Spodoptera frugiperda sprayed with spore suspension on and before the statistical day, and the cumulative control mortality rate refers to the total mortality rate of Spodoptera frugiperda sprayed with control solution on and before the statistical day). The results are as Figure 11 and Table 7 show. The data in Table 7 were analyzed using SPSS software to obtain the virulence regression equation, median lethal concentration (LC50, Table 8), and median lethal time (LT50, Table 9) of Fusarium oxysporum Fusarium oxysporum FOZJ2024 against Spodoptera frugiperda.

[0125] On the 8th day, the Spodoptera frugiperda treated with the control solution and the spore suspension at 1×10 8 spores / mL were respectively placed under a dissection microscope (Jiangnan JSZ5B) for observation. The photos are as Figure 12 shown.

[0126] Table 7 Cumulative corrected mortality rate of Fusarium oxysporum Fusarium oxysporum FOZJ2024 strain against Spodoptera frugiperda

[0127]

[0128] Table 8 Median lethal concentration of Fusarium oxysporum Fusarium oxysporum FOZJ2024 strain against Spodoptera frugiperda

[0129]

[0130] In the regression equation of Table 8, x is the logarithm (base 10) of the spore suspension concentration, and y is the probit value of the cumulative corrected mortality rate (Probit( p ) = Φ -1 ( p ) + 5, p where

[0131] Table 9 Median lethal time of Fusarium oxysporum Fusarium oxysporum FOZJ2024 strain against Spodoptera frugiperda

[0132]

[0133] In the regression equation of Table 9, x is the natural logarithm of time, and y is the probit value of the cumulative corrected mortality rate (Probit( p ) = Φ -1 ( p ) + 5, p where

[0134] It can be seen that:

[0135] (1) After treatment with spore suspensions at different concentrations, the death of Spodoptera frugiperda can be caused within 2 days, and with the extension of time, the cumulative corrected mortality of Spodoptera frugiperda gradually increases.

[0136] (2) With the increase in the concentration of the spore suspension, the cumulative corrected mortality of Spodoptera frugiperda gradually increases. At the 8th day after treatment, the cumulative corrected mortality of Spodoptera frugiperda under the concentration of 1×10 7 ~1×10 8 spores / mL reaches 76.67% - 93.33%.

[0137] (3) With the extension of time, the LC50 value of the spore suspension against Spodoptera frugiperda gradually decreases. At the 8th day after treatment, the median lethal concentration of Fusarium oxysporum ( Fusarium oxysporum ) strain FOZJ2024 against Spodoptera frugiperda is 3.33×10 5 spores / mL.

[0138] (4) With the increase in the concentration of the spore suspension, the LT50 value of the spore suspension against Spodoptera frugiperda gradually decreases. Under the concentration of 1×10 8 spores / mL, the median lethal time of Fusarium oxysporum ( Fusarium oxysporum ) strain FOZJ2024 against Spodoptera frugiperda is 3.48 d.

[0139] (5) Compared with the results of treatment with the control solution, the body surface of Spodoptera frugiperda treated with the spore suspension is covered with a layer of white mycelium.

[0140] Combining (1) - (5), it can be seen that Fusarium oxysporum ( Fusarium oxysporum ) strain FOZJ2024 has strong virulence and lethality against Spodoptera frugiperda and can effectively kill Spodoptera frugiperda.

[0141] Example 5 Toxicity determination of strain FOZJ2024 against Solenopsis invicta

[0142] 1. Test insects

[0143] Solenopsis invicta was collected at the Huguang Campus of Guangdong Ocean University and placed in a glass bottle. A layer of paper towel was laid at the bottom for moisture preservation, and an anti - escape liquid (prepared by mixing 75% ( v / v ) alcohol and talcum powder with 5000 meshes in a mass ratio of 1:1) was applied at the bottle mouth. Then, a small piece of ham sausage was placed in the glass bottle for Solenopsis invicta to eat.

[0144] 2. Treatment of test strains

[0145] Fusarium oxysporum ( Fusarium oxysporum)The FOZJ2024 strain was spread on a PDA plate and cultured in an incubator at 28 °C for 10 d. Well-grown colonies were selected, and their hyphae and spores were gently scraped with an inoculation needle. The scraped hyphae and spores were placed in a beaker containing 20 mL of an aqueous solution containing 0.05% ( v / v ), and Tween 80 was stirred with a magnetic stirrer at 200 rpm until the spores were evenly dispersed. Then, it was filtered through two layers of medical gauze. The spore concentration of the filtrate was counted with a hemocytometer under a microscope, and then diluted into spore suspensions of 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 spores / mL, which were the biocontrol agents at different concentrations. An aqueous solution containing 0.05% ( v / v ) of Tween 80 was used as the control solution.

[0146] 3. Methods and Results of Treating Test Insects

[0147] The spore suspension and the control solution were respectively sprayed onto the body surfaces of Solenopsis invicta workers until obvious water droplets formed. Each treatment was set with 3 replicates. Then, they were placed in an environment at 25 °C and RH above 90% for constant-temperature feeding. The number of deaths was recorded every 2 days. Since the lifespan of Solenopsis invicta workers is relatively long, a total of 14 d was recorded.

[0148] The cumulative corrected mortality rate was calculated according to "Cumulative corrected mortality rate (%) = (Cumulative treatment mortality rate - Cumulative control mortality rate) / (1 - Cumulative control mortality rate) × 100%" (where the cumulative treatment mortality rate refers to the total mortality rate of Solenopsis invicta sprayed with the spore suspension on the day of statistics and before, and the cumulative control mortality rate refers to the total mortality rate of Solenopsis invicta sprayed with the control solution on the day of statistics and before). The results are shown in Figure 13 and Table 10. SPSS software was used to analyze the data in Table 10 to obtain the virulence regression equation, median lethal concentration (LC50, Table 11), and median lethal time (LT50, Table 12) of Fusarium oxysporum ( Fusarium oxysporum ) FOZJ2024 against Solenopsis invicta.

[0149] On the 14th d, the Solenopsis invicta treated with the control solution and the spore suspension of 1×10 8 spores / mL were respectively placed under a dissecting microscope (Jiangnan JSZ5B) for observation. The photos are shown in Figure 14 .

[0150] Table 10 Cumulative corrected mortality rate of Fusarium oxysporum ( Fusarium oxysporum ) FOZJ2024 strain against Solenopsis invicta

[0151]

[0152] Table 11 Median lethal concentration of Fusarium oxysporum Fusarium oxysporum strain FOZJ2024 against Solenopsis invicta

[0153]

[0154] In the regression equation of Table 11, x is the logarithm (base 10) of the spore suspension concentration, and y is the probit value of the cumulative corrected mortality (Probit( p ) = Φ -1 ( p ) + 5, p where

[0155] Table 12 Median lethal time of Fusarium oxysporum Fusarium oxysporum strain FOZJ2024 against Solenopsis invicta

[0156]

[0157] In the regression equation of Table 12, x is the natural logarithm of time, and y is the probit value of the cumulative corrected mortality (Probit( p ) = Φ -1 ( p ) + 5, p where

[0158] It can be seen that:

[0159] (1) As time prolongs, the cumulative corrected mortality of Solenopsis invicta gradually increases.

[0160] (2) As the spore suspension concentration increases, the cumulative corrected mortality of Solenopsis invicta gradually increases. At the 10th day after treatment, the cumulative corrected mortality of Solenopsis invicta reaches 100% at a concentration of 1×10 8 spores / mL; at the 14th day after treatment, the cumulative corrected mortality of Solenopsis invicta reaches 80% - 100% at concentrations of 1×10 6 - 1×10 8 spores / mL.

[0161] (3) As time prolongs, the LC50 value of the spore suspension against Solenopsis invicta gradually decreases. At the 14th day after treatment, the median lethal concentration of Fusarium oxysporum Fusarium oxysporum strain FOZJ2024 against Solenopsis invicta is 7.70×10 4 spores / mL.

[0162] (4) As the spore suspension concentration increases, the LT50 value of the spore suspension against Solenopsis invicta gradually decreases. At a concentration of 1×10 8 spores / mL, Fusarium oxysporum Fusarium oxysporumThe median lethal time of the FOZJ2024 strain against Solenopsis invicta is 5.06 d.

[0163] (5) Compared with the results of the control solution treatment, a lot of white hyphae grew on the body surface of Solenopsis invicta after treatment with the spore suspension.

[0164] Combined with (1)-(5), it can be seen that Fusarium oxysporum Fusarium oxysporum ) The FOZJ2024 strain has strong virulence and lethality against Solenopsis invicta and can effectively kill Solenopsis invicta.

[0165] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A strain of Fusarium oxysporum ( Fusarium oxysporum ), strain FOZJ2024, characterized in that The Fusarium oxysporum FOZJ2024 strain was deposited at the Guangdong Microbial Culture Collection Center on November 20, 2024, with the deposit number GDMCC No: 65511, and the deposit address is on the 5th floor of Building 59, No. 100 compound, Xianlie Middle Road, Guangzhou.

2. Application of the Fusarium oxysporum FOZJ2024 strain described in claim 1 in killing Lagerstroemia aphids.

3. Application of the Fusarium oxysporum FOZJ2024 strain described in claim 1 in killing mealybugs.

4. Application of the Fusarium oxysporum FOZJ2024 strain described in claim 1 in killing Spodoptera frugiperda.

5. Application of the Fusarium oxysporum FOZJ2024 strain described in claim 1 in killing Solenopsis invicta.

6. A biocontrol agent, characterized in that, Containing the Fusarium oxysporum FOZJ2024 strain described in claim 1.