Recombinant bacillus amyloliquefaciens strain as well as construction method and application thereof

Abstract

The invention discloses a recombinant bacillus amyloliquefaciens strain and a construction method and application thereof.The construction method comprises the steps that in bacillus amyloliquefaciens HM-618, a P43 promoter is used for overexpressing KtrAB protein, a PspoVG promoter is used for replacing an original promoter of an mrp gene, a PspoVG promoter is used for overexpressing OpuE protein, and the recombinant bacillus amyloliquefaciens strain is obtained and named as an HM-4KSMSO strain; the strain disclosed by the invention is more stable in expression under a high-salt condition, the lipopeptide yield is high, and the construction method is simple; particularly, when the strain is combined with C.glu, the C.glu provides proline as a lipopeptide precursor and a compatible solute under a high-salt condition for synthesizing lipopeptide by the HM-4KSMSO strain, so that the kitchen garbage can be efficiently utilized by the two bacteria, and the yield of the lipopeptide is increased.

Description

Technical Field

[0001] The invention belongs to the field of fermentation engineering, and specifically relates to a recombinant Bacillus amyloliquefaciens and a construction method and application thereof. Background Art

[0002] Lipopeptides are amphiphilic biosurfactants composed of a hydrophilic peptide chain and a lipophilic fatty hydrocarbon chain (Yang R, Lei S, Xu X, Jin H, Sun H, Zhao X, Pang B, Shi J. [1] Key elements and regulation strategies of NRPSs for biosynthesis of lipopeptides by Bacillus [J]. Applied Microbiology and Biotechnology, 2020, 104 (19): 8077-8087.). Bacillus amyloliquefaciens can synthesize lipopeptides through non-ribosomal peptide synthetases (NRPSs), which mainly include three families: iturin A, surfactin, and fengycin. Lipopeptides have a variety of biological activities, including antibacterial, antifungal, antiviral, and antitumor activities, and therefore have attracted much attention as tools in biomedicine, biocontrol, pharmaceuticals, environmental science, and food industries.

[0003] Kitchen waste is a mixture of solid and liquid. Its main chemical components include starch, cellulose, protein, lipids and inorganic salts, as well as a small amount of nitrogen, phosphorus, potassium, calcium, sodium, magnesium, iron and other trace elements. The general mass fraction of NaCl in kitchen waste in my country is between 2-5%. It is rich in carbohydrates and easy to degrade, and is a natural and readily available microbial fermentation substrate. Scientifically utilizing kitchen waste to produce high value-added products using microbial fermentation methods is more economical and environmentally friendly than traditional kitchen waste treatment methods such as landfill and incineration. However, the poor salt tolerance of microorganisms may result in the inability of most microorganisms to efficiently utilize kitchen waste. Therefore, there is an urgent need for a recombinant Bacillus amyloliquefaciens strain that can efficiently produce lipopeptides under high salt conditions. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a recombinant Bacillus amyloliquefaciens strain that can efficiently produce lipopeptides even under high-salt conditions.

[0005] The second object of the present invention is to provide a method for constructing a recombinant Bacillus amyloliquefaciens strain.

[0006] The third object of the present invention is to provide the use of the above-mentioned recombinant Bacillus amyloliquefaciens strain in fermentation production of lipopeptides.

[0007] The fourth object of the present invention is to provide the use of the above-mentioned recombinant Bacillus amyloliquefaciens strain in co-culturing with Corynebacterium glutamicum to produce lipopeptides.

[0008] A method for constructing a recombinant Bacillus amyloliquefaciens strain comprises the following steps: in Bacillus amyloliquefaciens HM-618, using P 43 Promoter overexpression of KtrAB protein, using P spoVG The promoter replaced the original promoter of the mrp gene and used P spoVG The promoter overexpressed the OpuE protein, resulting in a recombinant Bacillus amyloliquefaciens strain, named HM-4KSMSO strain;

[0009] The P 43 The nucleotide sequence of the promoter is shown in SEQ ID NO.1;

[0010] The P spoVG The nucleotide sequence of the promoter is shown in SEQ ID NO.2;

[0011] The nucleotide sequence of the gene ktrAB encoding the KtrAB protein is shown in SEQ ID NO.3;

[0012] The nucleotide sequence of the gene opuE encoding the OpuE protein is shown in SEQ ID NO.4.

[0013] A recombinant Bacillus amyloliquefaciens strain constructed by the above construction method.

[0014] The application of the above-mentioned recombinant Bacillus amyloliquefaciens strain in fermentation production of lipopeptides.

[0015] The application of the above-mentioned recombinant Bacillus amyloliquefaciens strain in co-culturing with Corynebacterium glutamicum to produce lipopeptides.

[0016] Advantages of the invention

[0017] A recombinant Bacillus amyloliquefaciens strain of the present invention is more stable under high-salt conditions, has a high lipopeptide yield, and a simple construction method; in particular, when used in combination with Corynebacterium glutamicum, Corynebacterium glutamicum provides proline as a lipopeptide precursor and a compatible solute under high-salt conditions for the recombinant Bacillus amyloliquefaciens to synthesize lipopeptides, so that the two bacteria can efficiently utilize kitchen waste, thereby increasing the yield of lipopeptides. The present invention utilizes recombinant Bacillus amyloliquefaciens HM-4KSMSO to co-cultivate with Corynebacterium glutamicum to produce lipopeptides, and the total lipopeptide yield is significantly increased to 630.4 mg / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1The lipopeptide yields of strains HM-618 and HM-4KSMSO after fermentation in medium A.

[0019] Figure 2 The lipopeptide yields of strains HM-618 and HM-4KSMSO after fermentation in medium B.

[0020] Figure 3 The lipopeptide yields of pure culture of HM-4KSMSO and co-culture of HM-4KSMSO strain and C.glu. DETAILED DESCRIPTION

[0021] The present invention improves the lipopeptide production of Bacillus amyloliquefaciens under high-salt conditions by overexpressing a potassium ion transporter KtrAB, replacing the promoter of a sodium ion antiporter mrp gene and overexpressing a proline transporter OpuE in Bacillus amyloliquefaciens HM-618; and co-culturing Corynebacterium glutamicum and recombinant Bacillus amyloliquefaciens HM-4KSMSO to promote the synthesis of lipopeptides.

[0022] The Bacillus amyloliquefaciens involved in the present invention is preferably Bacillus amyloliquefaciens HM-618, with a deposit number of CGMCC No.7097, which was deposited in the General Microbiological Center of China National Committee for the Preservation of Microorganisms on January 8, 2013, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0023] Bacillus amyloliquefaciens HM-618, referred to as HM-618.

[0024] Corynebacterium glutamicum ATCC13032 was purchased from http: / / www.cgmcc.net / , referred to as C.glu.

[0025] The present invention will be further described below in conjunction with specific embodiments:

[0026] Example 1: Construction of a recombinant Bacillus amyloliquefaciens HM-4KSMSO strain

[0027] 1. Construction of Plasmid

[0028] Construction of pJOE-P 43- ktrAB Plasmid

[0029] Reference website ( CRISPR RGEN Tools(rgenome.net)) Design ktrAB-sgRNA-F / R primers (SEQ ID NO.5 / SEQ ID NO.6). Anneal and connect ktrAB-sgRNA-F / R to obtain the connection product ktrAB-sgRNA, and connect ktrAB-sgRNA to the pJOE8999a plasmid linearized with Bsa I to obtain the pJOE-ktrAB-sgRNA plasmid;

[0030] Using B. amyloliquefaciens HM-618 as template, primers

[0031] ktrAB-UF(SEQ ID NO.7), ktrAB-UR(SEQ ID NO.8),

[0032] ktrAB--DF(SEQ ID NO.9), ktrAB-DR(SEQ ID NO.10),

[0033] ktrAB--F (SEQ ID NO.13) and ktrAB-R (SEQ ID NO.14)

[0034] PCR amplification was performed to obtain the upstream and downstream homology arms of ktrAB-, ktrAB--U and ktrAB--D, and the ktrAB (SEQ ID NO. 3) fragment.

[0035] Using the B. subtilis 168 genome (B. subtilis 168, commercially available) as a template, primers P 43 -F (SEQ ID NO.11), P 43 -R (SEQ ID NO.12), and PCR amplification was performed to obtain P 43 Promoter (SEQ ID NO.1);

[0036] The pJOE-ktrAB-sgRNA plasmid was digested with Sfi I to obtain the linearized pJOE-ktrAB-sgRNA vector. 43 The promoter, ktrAB and linearized pJOE-ktrAB-sgRNA vector were transformed into E. coli DH5α using seamless cloning enzyme ligation, and positive transformants were screened on 50 μg / mL kanamycin-resistant LB plates. After the plasmid was extracted and transferred into E. coli JM110 for demethylation, positive transformants were screened again and pJOE-P was extracted. 43 -KtrAB plasmid.

[0037] The primer sequences are as follows:

[0038] ktrAB-sgRNA-F (SEQ ID NO.5): ttgagtaaaatgtacctacgtccggatttcgtccgccttggttttagagctagaaatagc

[0039] ktrAB-sgRNA-R (SEQ ID NO.6): gctatttctagctctaaaaccaaggcggacgaaatccggacgtaggtacattttactcaa

[0040] ktrAB-U-F (SEQ ID NO.7): tatagggtcgacggccaacggcggaaatgtgaaatgcgt

[0041] ktrAB-U-R (SEQ ID NO.8): cggattacgcttcatttgtcgg

[0042] ktrAB-D-F (SEQ ID NO.9): aaagccggcgtttcttttgccgcttccat

[0043] ktrAB-D-R (SEQ ID NO.10): ttaatctagaaaggccttatgctgatgagcctgcgtaatccatat

[0044] P 43 -F (SEQ ID NO.11): gacaaatgaagcgtaatccgagcttcgtgcatgcagg

[0045] P 43 -R (SEQ ID NO.12): gtttgtcctccttattagttaatcgtgtacattcctctcttacctataatgg

[0046] ktrAB-F (SEQ ID NO.13): aactaataaggaggacaaacttgggaaaaatcaaaaataaacaatttgccgt

[0047] ktrAB-R (SEQ ID NO.14): gcaaaagaaacgccggcttttttacattcct

[0048] Construct pJOE-P spoVG-mrp plasmid

[0049] Reference website ( CRISPR RGEN Tools(rgenome.net) ) Design mrp-sgRNA-F / R primers (SEQ ID NO.15 / SEQ ID NO.16). Anneal and connect mrp-sgRNA-F / R to obtain the connection product mrp-sgRNA, and connect the mrp-sgRNA to the pJOE8999a plasmid linearized with Bsa I to obtain the pJOE-mrp-sgRNA plasmid;

[0050] Using B. amyloliquefaciens HM-618 as template, primers

[0051] mrp-UF(SEQ ID NO.17), mrp-UR(SEQ ID NO.18),

[0052] mrp--DF(SEQ ID NO.19), mrp-DR(SEQ ID NO.20)

[0053] PCR amplification was performed to obtain the upstream and downstream homology arms of mrp-, mrp--U and mrp--D fragments.

[0054] Using the B. subtilis 168 genome as a template, primers

[0055] P spoVG -F (SEQ ID NO. 21), P spoVG -R (SEQ ID NO.22), and PCR amplification was performed to obtain P spoVG Promoter (SEQ ID NO. 2) fragment.

[0056] The pJOE-mrp-sgRNA plasmid was digested with Sfi I to obtain the linearized pJOE-mrp-sgRNA vector. spoVG The promoter and linearized pJOE-mrp-sgRNA vector were transformed into E. coli DH5α using seamless cloning enzyme ligation, and positive transformants were screened on 50 μg / mL kanamycin-resistant LB plates. After extracting the plasmid, it was transferred into E. coli JM110 for demethylation, and positive transformants were screened again and pJOE-P was extracted. spoVG -mrp plasmid.

[0057] The primer sequences are as follows:

[0058] mrp-sgRNA-F (SEQ ID NO.15):ttgagtaaaatgtacctacgagtgcgatataatttgtactgttttagagctagaaatagc

[0059] mrp-sgRNA-R (SEQ ID NO. 16): gctatttctagctctaaaacagtacaaattatatcgcactcgtaggtacattttactcaa

[0060] mrp-UF (SEQ ID NO. 17): tatagggtcgacggccaacgtgatttcacgcactccacca

[0061] mrp-UR(SEQ ID NO.18):ctgctacggcataatgtattcctc

[0062] mrp-DF (SEQ ID NO. 19): aactaataaggaggacaaaccttctgttgcagctgttacatttc

[0063] mrp-DR (SEQ ID NO. 20): ttaatctagaaaggccttataaatgcccgctttcacca

[0064] P spoVG -F(SEQ ID NO.21):aatacattatgccgtagcagtaagaaaagtgattctgggagagccg

[0065] P spoVG -R(SEQ ID NO.22):gtttgtcctccttattagttaatctttccctatataaaagcattagtgtatcaattccacg

[0066] Construction of pJOE-P spoVG-opuE Plasmids

[0067] Reference website ( CRISPR RGEN Tools(rgenome.net) ) Design opuE-sgRNA-F / R primers (SEQ ID NO.23 / SEQ ID NO.24). Anneal and connect opuE-sgRNA-F / R to obtain the connection product opuE-sgRNA, and connect opuE-sgRNA to the pJOE8999a plasmid linearized with Bsa I to obtain the pJOE-opuE-sgRNA plasmid;

[0068] Using B. amyloliquefaciens HM-618 as template, primers

[0069] opuE-UF(SEQ ID NO.25), opuE-UR(SEQ ID NO.26),

[0070] opuE-DF(SEQ ID NO.27), opuE-DR(SEQ ID NO.28),

[0071] opuE-F (SEQ ID NO.31) and opuE-R (SEQ ID NO.32) were amplified by PCR to obtain the upstream and downstream homologous arms of opuE, opuE-U and opuE-D, and the opuE (SEQ ID NO.4) fragment.

[0072] Using the B. subtilis 168 genome as a template, primers

[0073] P spoVG -F (SEQ ID NO. 29), P spoVG -R (SEQ ID NO.30) was amplified by PCR to obtain P spoVG Promoter (SEQ ID NO. 2) fragment.

[0074] The pJOE-opuE-sgRNA plasmid was digested with Sfi I to obtain the linearized pJOE-opuE-sgRNA vector. spoVG The promoter, opuE and linearized pJOE-opuE-sgRNA vector were transformed into E. coli DH5α using seamless cloning enzyme ligation, and positive transformants were screened on 50 μg / mL kanamycin-resistant LB plates. After the plasmid was extracted and transferred into E. coli JM110 for demethylation, positive transformants were screened again and pJOE-P was extracted. spoVG -opuE plasmid.

[0075] The primer sequences are as follows:

[0076] opuE-sgRNA-F (SEQ ID NO. 23): ttgagtaaaatgtacctacgtggtcaacggcaaaaacagtgttttagagctagaaatagc

[0077] opuE-sgRNA-R (SEQ ID NO. 24): ctatttctagctctaaaacactgtttttgccgttgaccacgtaggtacattttactcaa

[0078] opuE-UF(SEQ ID NO.25):tatagggtcgacggccaacgggtaaacgaaatgagccaagc

[0079] opuE-UR(SEQ ID NO.26):ttcttctccgcctcttgtcac

[0080] opuE-DF(SEQ ID NO.27):agccgtcagatcaccgatgtagttgaggaaaaaata

[0081] opuE-DR (SEQ ID NO. 28): ttaatctagaaaggccttatattgcggaaccgtttgtctc

[0082] P spoVG -F(SEQ ID NO.29):tgacaagaggcggagaagaataagaaaagtgattctgggagagccg

[0083] P spoVG -R(SEQ ID NO.30):gtttgtcctccttattagttaatctttccctatataaaagcattagtgtatcaattccacg

[0084] opuE-F (SEQ ID NO. 31): aactaataaggaggacaaacaaacgtgagtattgaactaattatatctcttggcatttactt

[0085] opuE-R (SEQ ID NO.32): acatcggtgatctgacggctttttgtctatttcttgttttt

[0086] The pJOE8999a plasmid used in the above plasmid construction was constructed using pJOE8999 (purchased from Shanghai Haiji Haoge Biotechnology Co., Ltd.) as a template, and frag 1-F (SEQ ID NO.33), frag 1-R (SEQ ID NO.34), frag 2-F (SEQ ID NO.35,) frag 2-R (SEQ ID NO.36) were used to obtain two linear fragments frag1 and frag 2 with the BamH I site sequence eliminated by PCR amplification, and then connected using seamless cloning enzyme;

[0087] The primer sequences are as follows:

[0088] frag 1-F(SEQ ID NO.33):ttaacgtgagttttcgttccactgagcgtcag

[0089] frag 1-R(SEQ ID NO.34):aagactgggacccaaaaaaatatggtggttttgatagtccaacg

[0090] frag 2-F(SEQ ID NO.35):tttttttgggtcccagtcttttttacgagcaataagcttgtccg

[0091] frag 2-R(SEQ ID NO.36):ggaacgaaaactcacgttaagggattttggtcat

[0092] 2. Construction of recombinant Bacillus amyloliquefaciens HM-4KSMSO

[0093] (1) Preparation of Bacillus amyloliquefaciens competent cells:

[0094] Pick a single colony of Bacillus amyloliquefaciens into 5 mL of GMI medium and culture it at 37°C, 220 rpm for 11 hours. Take 500 μL of the bacterial solution and transfer it to 4.5 mL of GMI medium and culture it at 37°C, 220 rpm for about 3-3.5 hours until the OD reaches 600 At about 3 o'clock, 750 μL of bacterial solution was inoculated into 4.25 mL of GMII medium and cultured at 37°C, 220 rpm for 1.5 hours. The competent cell culture was completed.

[0095] (2) Preparation of GMI and GMII culture medium:

[0096] 10×Spizizen solution: 1.2% (W / V) sodium citrate, 18.3% (W / V) K2HPO4, 6% (W / V) KH2PO4,

[0097] 2% (W / V) (NH4)2SO4. (NH4)2SO4 must be prepared into a mother solution and sterilized by filtering with a 0.22μm sterile syringe filter. The remaining ingredients are prepared into a mixed solution and sterilized at 121℃ for 20 minutes.

[0098] GMI medium (5 mL formula): 0.5 mL of sterilized 10× Spizizen solution, 0.1 mL of 2% (W / V) casein hydrolyzate solution, 0.1 mL of 5% (W / V) Yeast extract, 0.1 mL of 40% (W / V) glucose solution, 0.05 mL of 0.5% (W / V)

[0099] The L-Thr solution was obtained by mixing 0.004 mL of 2.5% (W / V) MgSO4·7H2O and 4.146 mL of deionized water.

[0100] GMⅡ medium (5 mL formula): 0.5 mL of sterilized 10×Spizizen solution, 0.05 mL of 2% (W / V) casein hydrolyzate solution, 0.1 mL of 40% (W / V) glucose solution, 0.032 mL of 2.5% (W / V) MgSO4·7H2O and 4.318 mL of deionized water are mixed.

[0101] (3) Using chemical transformation method, the pJOE-P obtained in step 1 was transformed into 43 -ktrAB,pJOE-P spoVG -mrp,pJOE-P spoVG -opuE plasmid was sequentially transformed into the newly prepared Bacillus amyloliquefaciens competent cells and placed in a shaking incubator at 30°C.

[0102] 200rpm, incubate for 4h, centrifuge at 5000rpm for 3min, and apply to LB plate containing 0.2% mannose, 50μg / mL kanamycin resistance to screen positive transformants. The correct transformants were streaked on non-resistant plates and incubated at 50℃ to lose the plasmid and finally a recombinant Bacillus amyloliquefaciens strain was obtained, named HM-4KSMSO strain.

[0103] Example 2: Lipopeptide yields of a recombinant Bacillus amyloliquefaciens HM-4KSMSO (HM-4KSMSO for short) fermented in medium A and medium B

[0104] (1) HM seed medium, components (g / L): glucose 60, beef extract 10, peptone 10, yeast extract powder 10, NaCl 5;

[0105] (2) Single colonies of HM-618 and HM-4KSMSO were picked and placed in 5 mL of HM seed medium and cultured at 37°C and 200 rpm for 12 h;

[0106] (3) 1 mL of the bacterial solution obtained in step (2) was inoculated into 100 mL of HM seed culture medium and cultured at 37°C and 200 rpm for 12 h;

[0107] (4) The bacterial solution obtained in step (3) was quantified by OD 600 =0.5 were inoculated into 100 mL of culture medium A and 100 mL of culture medium B respectively, and cultured at 37°C, 220 rpm for 120 h.

[0108] The culture medium A is composed of the following components in g / L: glucose 60, yeast extract 15, peptone 5, MgSO4·7H2O 0.2, K2HPO4 0.4, FeSO4·7H2O 0.03, MnSO4 0.03, vitamin B1 5×10 -4 , vitamin B73×10 -5 .

[0109] The medium B is composed of the following components in g / L: glucose 60, yeast extract 15, peptone 5, MgSO4·7H2O 0.2, K2HPO4 0.4, FeSO4·7H2O 0.03, MnSO4 0.03, vitamin B1 5×10 -4 , vitamin B73×10 -5 , NaCl 30.

[0110] (5) Lipopeptide extraction: After the fermentation is completed, the fermentation liquid is centrifuged, acid precipitated, vacuum freeze-dried, and extracted with methanol.

[0111] (6) Detection of lipopeptides using high performance liquid chromatography.

[0112] Iturin was detected using a C18 reverse phase column (4.6 mm × 250 mm) with a mobile phase of 55% phase A (0.035%

[0113] Formic acid aqueous solution) and 45% B phase (acetonitrile), the ultraviolet detection wavelength is 220nm, the column oven is 37°C, and the flow rate is 1mL / min. Fengyuansu was detected using a C18 reverse phase chromatographic column (4.6mm×150mm), the mobile phase was 50% A phase (1% trifluoroacetic acid aqueous solution) and 50% B phase (acetonitrile), the ultraviolet detection wavelength was 210nm, the column oven was 33°C, and the flow rate was 0.8mL / min. Surfactin was detected using a C18 reverse phase chromatographic column (4.6mm×250mm), the mobile phase was 90% A phase (0.1% trifluoroacetic acid aqueous solution) and 10% B phase (methanol), the ultraviolet detection wavelength was 205nm, the column oven was 35°C, and the flow rate was 1mL / min.

[0114] (7) Figure 1 As shown, the iturin production of HM-618 and HM-4KSMSO were 36.0 mg / L and 19.7 mg / L, respectively, the surfactin production were 190.0 mg / L and 213.9 mg / L, the fengycin production were 228.8 mg / L and 342.5 mg / L, respectively, and the total lipopeptide production were 454.8 mg / L and 576.1 mg / L, respectively.

[0115] (8) Figure 2As shown, the iturin production of HM-618 and HM-4KSMSO were 14.6 mg / L and 31.8 mg / L, respectively, the surfactin production were 54.1 mg / L and 64.1 mg / L, the fengycin production were 21.5 mg / L and 24.6 mg / L, respectively, and the total lipopeptide production were 90.2 mg / L and 120.5 mg / L, respectively.

[0116] Example 3: Application of HM-4KSMSO and C.glu co-culture to produce lipopeptides

[0117] (1) BHI medium, composition in g / L: BHI 37.

[0118] (2) Fermentation medium C, ingredients in g / L: crushed wet kitchen waste 400, glucose 20, yeast extract 15, peptone 5, MgSO4·7H2O 0.2, K2HPO4 0.4, FeSO4·7H2O 0.03, MnSO4 0.03, vitamin B1 5×10 -4 , vitamin B7 3×10 -5 Wet kitchen waste (from the first student cafeteria of Beiyang Campus, Tianjin University)

[0119] (3) Pick a single colony of C. glu and place it in 5 mL of BHI medium, culture it at 30°C and 200 rpm for 12 h to obtain the primary seed of the C. glu strain; inoculate 1 mL of the primary seed of the C. glu strain into 100 mL of BHI medium, culture it at 30°C and 200 rpm for 12 h to obtain the secondary seed of the C. glu strain;

[0120] (4) Pick a single colony of HM-4KSMSO and culture it in 5 mL of HM seed medium at 37°C and 200 rpm for 12 h to obtain the primary seeds of HM-4KSMSO. Inoculate 1 mL of the primary seeds of HM-4KSMSO into 100 mL of HM seed medium and culture it at 37°C and 200 rpm for 12 h to obtain the secondary seeds of HM-4KSMSO.

[0121] (5) Fermentation culture:

[0122] The secondary seeds of C. glu strain were counted by OD 562 0.5 was inoculated into 100 mL of fermentation medium C and fermented at 30°C and 120 rpm for 4 h to obtain a single-bacteria fermentation broth. The secondary seeds of HM-4KSMSO were heated at OD 600 =2 was inoculated into the single-bacteria fermentation broth and cultured at 30°C and 120 rpm for 120 h.

[0123] The extraction of lipopeptides after fermentation and the detection of lipopeptides are the same as steps (5) and (6) in Example 2.

[0124] like Figure 3 As shown, the iturin production of HM-4KSMSO pure culture and HM-4KSMSO and C.glu co-culture were 31.5 mg / L and 40.3 mg / L, respectively, the surfactin production were 251.4 mg / L and 474.5 mg / L, the fengycin production were 64.8 mg / L and 115.6 mg / L, respectively, and the total lipopeptide production were 347.7 mg / L and 630.4 mg / L, respectively.

Claims

1. A method for constructing a recombinant Bacillus amyloliquefaciens strain, characterized in that The method comprises the following steps: in Bacillus amyloliquefaciens HM-618, using P 43 Promoter overexpression of KtrAB protein, using P spoVG The promoter replaced the original promoter of the mrp gene and used P spoVG The promoter overexpressed the OpuE protein, resulting in a recombinant Bacillus amyloliquefaciens strain, named HM-4KSMSO strain; The P 43 The nucleotide sequence of the promoter is shown in SEQ ID NO.1; The P spoVG The nucleotide sequence of the promoter is shown in SEQ ID NO.2; The nucleotide sequence of the gene ktrAB encoding the KtrAB protein is shown in SEQ ID NO.3; The nucleotide sequence of the gene opuE encoding the OpuE protein is shown in SEQ ID NO.

4.

2. A recombinant Bacillus amyloliquefaciens strain constructed by the construction method of claim 1.

3. Use of a recombinant Bacillus amyloliquefaciens strain according to claim 2 to produce lipopeptides by fermentation.

4. Use of a recombinant Bacillus amyloliquefaciens strain according to claim 2 in co-culturing with Corynebacterium glutamicum to produce lipopeptides.

Images